ID: 905126463

View in Genome Browser
Species Human (GRCh38)
Location 1:35718977-35718999
Sequence GCGCGGGGCCGCGTTGACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905126452_905126463 3 Left 905126452 1:35718951-35718973 CCCTGCGCCGGAACCGCTTCGCC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126458_905126463 -10 Left 905126458 1:35718964-35718986 CCGCTTCGCCCCCGCGCGGGGCC 0: 1
1: 1
2: 1
3: 33
4: 225
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126453_905126463 2 Left 905126453 1:35718952-35718974 CCTGCGCCGGAACCGCTTCGCCC 0: 1
1: 1
2: 0
3: 4
4: 56
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126454_905126463 -4 Left 905126454 1:35718958-35718980 CCGGAACCGCTTCGCCCCCGCGC 0: 1
1: 0
2: 0
3: 0
4: 78
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126450_905126463 9 Left 905126450 1:35718945-35718967 CCAGGCCCCTGCGCCGGAACCGC 0: 1
1: 0
2: 1
3: 18
4: 184
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126447_905126463 15 Left 905126447 1:35718939-35718961 CCCGCGCCAGGCCCCTGCGCCGG 0: 1
1: 0
2: 2
3: 36
4: 362
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126449_905126463 14 Left 905126449 1:35718940-35718962 CCGCGCCAGGCCCCTGCGCCGGA 0: 1
1: 0
2: 2
3: 17
4: 230
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126446_905126463 16 Left 905126446 1:35718938-35718960 CCCCGCGCCAGGCCCCTGCGCCG 0: 1
1: 1
2: 2
3: 35
4: 397
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126451_905126463 4 Left 905126451 1:35718950-35718972 CCCCTGCGCCGGAACCGCTTCGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126445_905126463 24 Left 905126445 1:35718930-35718952 CCGCGGAGCCCCGCGCCAGGCCC 0: 1
1: 0
2: 3
3: 68
4: 523
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905126463 Original CRISPR GCGCGGGGCCGCGTTGACCC AGG Exonic