ID: 905126463

View in Genome Browser
Species Human (GRCh38)
Location 1:35718977-35718999
Sequence GCGCGGGGCCGCGTTGACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905126453_905126463 2 Left 905126453 1:35718952-35718974 CCTGCGCCGGAACCGCTTCGCCC 0: 1
1: 1
2: 0
3: 4
4: 56
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126451_905126463 4 Left 905126451 1:35718950-35718972 CCCCTGCGCCGGAACCGCTTCGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126452_905126463 3 Left 905126452 1:35718951-35718973 CCCTGCGCCGGAACCGCTTCGCC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126449_905126463 14 Left 905126449 1:35718940-35718962 CCGCGCCAGGCCCCTGCGCCGGA 0: 1
1: 0
2: 2
3: 17
4: 230
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126447_905126463 15 Left 905126447 1:35718939-35718961 CCCGCGCCAGGCCCCTGCGCCGG 0: 1
1: 0
2: 2
3: 36
4: 362
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126454_905126463 -4 Left 905126454 1:35718958-35718980 CCGGAACCGCTTCGCCCCCGCGC 0: 1
1: 0
2: 0
3: 0
4: 78
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126450_905126463 9 Left 905126450 1:35718945-35718967 CCAGGCCCCTGCGCCGGAACCGC 0: 1
1: 0
2: 1
3: 18
4: 184
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126445_905126463 24 Left 905126445 1:35718930-35718952 CCGCGGAGCCCCGCGCCAGGCCC 0: 1
1: 0
2: 3
3: 68
4: 523
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126458_905126463 -10 Left 905126458 1:35718964-35718986 CCGCTTCGCCCCCGCGCGGGGCC 0: 1
1: 1
2: 1
3: 33
4: 225
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168
905126446_905126463 16 Left 905126446 1:35718938-35718960 CCCCGCGCCAGGCCCCTGCGCCG 0: 1
1: 1
2: 2
3: 35
4: 397
Right 905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905126463 Original CRISPR GCGCGGGGCCGCGTTGACCC AGG Exonic
901242812 1:7704785-7704807 GCGCGGGGCCGGGCTGGGCCGGG + Intronic
905126463 1:35718977-35718999 GCGCGGGGCCGCGTTGACCCAGG + Exonic
906680965 1:47725283-47725305 GGGCGGGGGCGCCCTGACCCGGG - Intergenic
908195503 1:61742769-61742791 GCGTGCGTCCGCGCTGACCCGGG + Intronic
911664702 1:100539498-100539520 GCGCCGGGCCGCGGTGCCCAGGG - Exonic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
916120434 1:161524370-161524392 GCGCGGCGCGGCGCTGACCCCGG - Intergenic
916130196 1:161606020-161606042 GCGCAGCGCGGCGCTGACCCCGG - Intronic
916414040 1:164576400-164576422 GCGCGGCGCCGCGTCGCACCCGG + Intronic
916483395 1:165235626-165235648 GCGCGGGGCGGCGCGGACCCGGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1067462136 10:46465839-46465861 GGGCGGGGCCGAGTGGGCCCCGG - Exonic
1067625059 10:47918759-47918781 GGGCGGGGCCGAGTGGGCCCCGG + Intergenic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1070610147 10:77927040-77927062 CCGCGGGGCCCCGGTGAGCCGGG - Intergenic
1074753724 10:116609697-116609719 CCGCGAGGCCGCCTCGACCCAGG - Intergenic
1074829985 10:117241316-117241338 GGGCGGGGCTGCGGGGACCCCGG + Intronic
1075032200 10:119030701-119030723 GCGAGGGGCGGCGGCGACCCTGG - Exonic
1075521454 10:123146093-123146115 CCTCGGGGCTGCCTTGACCCTGG + Intergenic
1075800686 10:125151852-125151874 GGGCGGGGCCGCTCGGACCCGGG - Intronic
1078233220 11:9461146-9461168 GCGCGGGCCCGCTTGGGCCCGGG + Intronic
1083822531 11:65181406-65181428 GCGCGGGGCCGAGATTACCTCGG - Exonic
1084000797 11:66294465-66294487 GCCCGAGGCCGCCTTGGCCCGGG + Exonic
1084412151 11:69011326-69011348 GCGCGGGGCCGAGGGGAGCCAGG - Intronic
1084640135 11:70420815-70420837 GCGGGGGGCTGGGTTTACCCGGG + Intronic
1084640152 11:70420863-70420885 GCGGGGGGCTGGGTTTACCCGGG + Intronic
1085197921 11:74683488-74683510 GCGCGGGGCCGCGTCGCACAGGG - Intergenic
1089527718 11:119107859-119107881 GCGCGGGCCCGCGGGGACCGGGG + Exonic
1094837574 12:34329326-34329348 GCGCGGGGCTGCGGTGATCCTGG - Intergenic
1094838147 12:34331841-34331863 GCGCAGGGCCGAGGGGACCCTGG + Intergenic
1094846380 12:34363219-34363241 GCGCGGGGCCCAGGGGACCCTGG - Intergenic
1094849025 12:34374063-34374085 GCGTGGGGCCCAGGTGACCCTGG - Intergenic
1094852713 12:34389409-34389431 GCGCGAGGCCGAGGGGACCCTGG + Intergenic
1094855526 12:34401180-34401202 GCGCGGGGCCCAGCGGACCCGGG + Intergenic
1094856108 12:34403545-34403567 GTGTGGGGCCGAGGTGACCCTGG + Intergenic
1102254027 12:111405931-111405953 GCGCGGGGCGGCATGGGCCCGGG + Exonic
1104936216 12:132365760-132365782 GCGCGTGGCCGCGTGGCACCTGG - Intergenic
1104936241 12:132365878-132365900 GCGCGTGGCCGCGTGGCACCTGG - Intergenic
1114075022 14:19157270-19157292 GCGCTGGGCCCCGTGGACACTGG + Intergenic
1114075073 14:19157467-19157489 GCGCTGGGCCCCGGCGACCCTGG + Intergenic
1114075122 14:19157717-19157739 GCGCTGGGCCCTGTGGACCCTGG + Intergenic
1114075381 14:19158763-19158785 GCGCTAGGCCCCGTGGACCCTGG + Intergenic
1114087147 14:19242265-19242287 GCGCTGGGCCCTGTGGACCCTGG - Intergenic
1114087196 14:19242510-19242532 GCGCTGGGCCCCGGCGACCCTGG - Intergenic
1114087246 14:19242706-19242728 GCGCTGGGCCCCGTGGACACTGG - Intergenic
1114553926 14:23550895-23550917 GCGGGGGGCCGCCGAGACCCAGG + Intronic
1115545455 14:34462026-34462048 CCGCGGGGCCGCATTTCCCCAGG - Intronic
1115852662 14:37599856-37599878 GCGCGCGGCCGCGGGGACCCAGG - Intronic
1122418211 14:101560478-101560500 GCGCGGGGCGGCGCCGGCCCCGG - Intergenic
1122703780 14:103607742-103607764 GGGCGGGGGCGAGCTGACCCTGG - Intronic
1202898254 14_GL000194v1_random:22193-22215 GCGCTGGGCCCCGGGGACCCTGG - Intergenic
1202898414 14_GL000194v1_random:22808-22830 GCGCTGGGCTCCGTCGACCCTGG - Intergenic
1202898818 14_GL000194v1_random:24405-24427 GCGCTTGGCCCCGTGGACCCTGG - Intergenic
1202899411 14_GL000194v1_random:26888-26910 GCGCTGGGCCTCCTGGACCCTGG - Intergenic
1202899465 14_GL000194v1_random:27102-27124 GCGCTGGGCCCCGTGGACCCAGG - Intergenic
1129294451 15:74592209-74592231 GCGAGGGGCCAAGTTGCCCCGGG + Intronic
1130411726 15:83653838-83653860 GCGCGGGGCCGCGGCGACGGCGG - Intergenic
1131200001 15:90388227-90388249 GGGCGGGGCCTCGGGGACCCCGG + Exonic
1131515369 15:93073219-93073241 GCGCGGGGCCGCGTCGACATTGG - Intronic
1132757694 16:1493909-1493931 GCGTGGGGCCGCGCTGTGCCCGG + Intronic
1136153102 16:28364998-28365020 CAGCAGGGCCGCGCTGACCCGGG + Intergenic
1138439442 16:57025433-57025455 GCGTGGGGCTGCCCTGACCCAGG - Exonic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1142110154 16:88327004-88327026 AGGCGGGGCCGCCCTGACCCAGG - Intergenic
1145077442 17:19867604-19867626 GGGCCGGGCCTCGCTGACCCTGG - Exonic
1148081245 17:44968513-44968535 GGGCGGGGCCGCGGAGACCCCGG + Intergenic
1148772843 17:50076901-50076923 GGGCGGGGCCTAGTTGATCCGGG + Intronic
1149833720 17:59893537-59893559 GCTCGGGGCTGCGCTGACCTGGG - Intronic
1149994569 17:61399960-61399982 GCGCGGGGCCGGGCTGGGCCGGG - Exonic
1150764633 17:67993571-67993593 GCGCGCCGCCGCGCTGGCCCCGG - Intronic
1151723690 17:75872907-75872929 GGGCGGGGCCTCCTTGCCCCTGG - Intergenic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1203162546 17_GL000205v2_random:64287-64309 GCGCTGGGCCCCGGTGACCCTGG - Intergenic
1160025434 18:75211804-75211826 GCGCGGGGACGCGGGGCCCCGGG - Intronic
1160873220 19:1286304-1286326 GCGCGCGGCCGCGCTCACCTGGG - Exonic
1161153623 19:2721506-2721528 GCGTGGGGCGGCGGTGACCTTGG - Intronic
1161175872 19:2841848-2841870 GCGCAGGGACGCGGGGACCCCGG - Intronic
1161314687 19:3612418-3612440 GGGCGGGACGGCGTTCACCCGGG + Intronic
1166368439 19:42288995-42289017 GCTCGGGGCCGGGCTGAGCCAGG - Exonic
1166529553 19:43534372-43534394 GCGCGGGGCGGGGGTGACGCCGG - Exonic
1168408063 19:56120998-56121020 GCGCGCGGCCGGGGTGACGCGGG - Intronic
1202647987 1_KI270706v1_random:158533-158555 GAGCTGGGCCCCGTGGACCCAGG + Intergenic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927472643 2:23386718-23386740 GCGCTGGGCAGCGTCGGCCCCGG + Intronic
927945851 2:27134709-27134731 CCGCGGGGCCGCGTTTCCCGGGG + Intergenic
928341503 2:30447148-30447170 GCGCGGGGCGCCGGGGACCCGGG + Intergenic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
932569588 2:72931591-72931613 GCGCAGGGCCACCTGGACCCTGG - Intronic
935820155 2:106886430-106886452 GCGCGGAGCAGCGCTGGCCCCGG - Exonic
938489343 2:131753813-131753835 GCGCTGGGCCCCGTGGACCCTGG + Intronic
938490030 2:131756483-131756505 GCGCTGGGCCCCGGGGACCCTGG + Intronic
944221753 2:197310519-197310541 GCGCGGGGCGGCGCGGAGCCCGG - Intronic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
947741386 2:232486548-232486570 GCGCGGGGCCTCCCTGCCCCCGG - Exonic
1171810638 20:29742744-29742766 GCGCGGGGCCGCCTTGGTGCTGG - Intergenic
1173605244 20:44326935-44326957 GCGCGGGGCCCCGCAGTCCCGGG - Intergenic
1176603716 21:8813486-8813508 GCGCTAGGCCCCGGTGACCCTGG - Intergenic
1176603859 21:8814196-8814218 GAGCTGGGCCCCGTGGACCCAGG - Intergenic
1176617940 21:9038184-9038206 GCGCTGGGCCCCGGGGACCCTGG - Intergenic
1176618098 21:9038799-9038821 GCGCTGGGCTCCGTCGACCCTGG - Intergenic
1176618791 21:9041660-9041682 GCGCTGGGCCTCCTGGACCCTGG - Intergenic
1176618841 21:9041874-9041896 GCGCTGGGCCCCGTGGACCCAGG - Intergenic
1176706484 21:10122638-10122660 GCGCTGGGCCCCGGGGACCCTGG + Intergenic
1176706830 21:10124066-10124088 GCGCTGAGCCCCGTGGACCCTGG + Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180290672 22:10850185-10850207 GCGCTGGGCCCCGTGGACACTGG + Intergenic
1180290721 22:10850381-10850403 GCGCTGGGCCCCGGCGACCCTGG + Intergenic
1180290771 22:10850626-10850648 GCGCTGGGCCCTGTGGACCCTGG + Intergenic
1180345999 22:11705037-11705059 GCGCTAGGCCCCGGTGACCCTGG - Intergenic
1180346144 22:11705773-11705795 GAGCTGGGCCCCGTGGACCCAGG - Intergenic
1180353916 22:11823930-11823952 GCACTGGGCCCCGTGGACCCAGG - Intergenic
1180384330 22:12168395-12168417 GCACTGGGCCCCGTGGACCCAGG + Intergenic
1180493473 22:15879606-15879628 GCGCTGGGCCCCGTGGACACTGG + Intergenic
1180493522 22:15879803-15879825 GCGCTGGGCCCCGGCGACCCTGG + Intergenic
1180493572 22:15880053-15880075 GCGCTGGGCCCTGTGGACCCTGG + Intergenic
1181811386 22:25405530-25405552 GGGAGGGGCCGCGGGGACCCGGG - Intergenic
1183511422 22:38237415-38237437 GTGCGGGACCCCGATGACCCTGG + Intronic
950040269 3:9915539-9915561 GCGCGGGGCAGCGTGGAGCAGGG - Exonic
965571884 3:170181453-170181475 GCGCAGGGCCGCGCAGATCCGGG + Intronic
966886363 3:184379938-184379960 GCGAGGGGCCGGGCTGAGCCCGG - Intronic
967880382 3:194297320-194297342 GCCCGGGGCCGGGTGGATCCCGG - Intergenic
968512530 4:1001933-1001955 GCCCCGGGCCGCGCTGACCCTGG + Intronic
968514918 4:1011873-1011895 GCCCGGGGCGGCGATGACCGCGG + Intronic
968611846 4:1560804-1560826 GCCCGTGGCCACGATGACCCTGG - Intergenic
969021665 4:4143437-4143459 GCGAGGGGCCGCCTGGTCCCCGG - Intergenic
971351815 4:25862618-25862640 GCGCGGGGCCCCGGGGACGCGGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
973374257 4:49276719-49276741 GAGCTGGGCCACGTGGACCCAGG + Intergenic
973383155 4:49333520-49333542 GAGCTGGGCCACGTGGACCCAGG - Intergenic
973386764 4:49518535-49518557 GAGCTGGGCCCCGTGGACCCAGG - Intergenic
976235343 4:82890984-82891006 GTGCGGGGCAGCGGAGACCCAGG + Intronic
976704678 4:88007989-88008011 GCGTGGAGCCGCGATAACCCCGG + Exonic
976765339 4:88592630-88592652 GCGCTGGGCCGCGTTCCGCCTGG + Intronic
986330770 5:6714481-6714503 GCGCGGGGCCGCGCGGCCCGGGG - Intergenic
987258252 5:16179435-16179457 GCGCGGGGCCGCGGGGACCGGGG + Exonic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
998184666 5:139968955-139968977 GCGCGGGTCCGCGTTCAGGCAGG + Intronic
1000082251 5:157859055-157859077 GCGGCGGGCGGCGGTGACCCCGG - Exonic
1002091672 5:176810152-176810174 GCCCGGGGCTGCGGCGACCCCGG - Intergenic
1002567137 5:180118583-180118605 GGTCGGGGCCACGTTGGCCCAGG - Intronic
1002580960 5:180209199-180209221 GCGCAGCGCCGCGTTGCTCCGGG - Intergenic
1002797694 6:488116-488138 GGGCGGGGCGGCGATGCCCCCGG + Intronic
1007444668 6:41895531-41895553 ACGCGCGGCCGCTTTGAGCCTGG + Intergenic
1007633602 6:43285561-43285583 GCGCGGGGCCGCGTCCCCCACGG - Exonic
1019145161 6:169971385-169971407 CCGCAGGGCGCCGTTGACCCCGG + Intergenic
1019421840 7:954354-954376 GCGCGGGGCCGGGTGGGTCCGGG - Intronic
1019989778 7:4683020-4683042 GCGGGGGTCGGGGTTGACCCCGG - Intronic
1022410319 7:30134949-30134971 GCGCGGCGCCGCGCTGTCCCCGG + Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1026732641 7:72925109-72925131 GCGCGGAGCCGCGATGTCTCCGG + Intronic
1027111423 7:75442710-75442732 GCGCGGAGCCGCGATGTCTCCGG - Intronic
1027283652 7:76627243-76627265 GCGCGGAGCCGCGATGTCTCCGG - Intronic
1030295872 7:107926306-107926328 GCGCTGGGACGCGTTGAACAAGG + Exonic
1032525409 7:132575973-132575995 CCACGGGGCCGCGATGACACTGG + Intronic
1035848907 8:2894231-2894253 CCGAGGGGCAGCGCTGACCCTGG + Intergenic
1037928861 8:22865588-22865610 GCGGGGGGCCGCGTGCGCCCGGG - Intronic
1040604938 8:48922041-48922063 GCACGCGGCCGCGCTGCCCCTGG - Intergenic
1049789715 8:144467002-144467024 CCGCGCGGCCGCGGTGTCCCTGG + Exonic
1053643633 9:40109152-40109174 GCGCTGGGCCCAGGTGACCCTGG + Intergenic
1053643776 9:40109755-40109777 GCGCTGGGCCTCGGGGACCCTGG + Intergenic
1053644129 9:40111211-40111233 GCGCTGAGCCCCGTGGACCCTGG + Intergenic
1053761595 9:41352629-41352651 GCGCTGGGCCCCGGGGACCCTGG - Intergenic
1053762027 9:41354274-41354296 GCGCTGAGCCCCGTGGACCCTGG - Intergenic
1053762378 9:41355735-41355757 GCGCTGGGCCCCGGGGACCCTGG - Intergenic
1053762520 9:41356339-41356361 GCGCTGGGCCCAGGTGACCCTGG - Intergenic
1054324630 9:63706986-63707008 GCGCTGGGCCCCGGGGACCCTGG + Intergenic
1054325414 9:63710104-63710126 GCGCTGGGCCCCGGGGACCCTGG + Intergenic
1054540190 9:66263745-66263767 GCGCTGGGCCCCGGGGACCCTGG - Intergenic
1054540621 9:66265391-66265413 GCGCTGAGCCCCGTGGACCCTGG - Intergenic
1054540974 9:66266852-66266874 GCGCTGGGCCCCGGGGACCCTGG - Intergenic
1054541118 9:66267453-66267475 GCGCTGGGCCCAGGTGACCCTGG - Intergenic
1056886729 9:90450136-90450158 GAGAGGGGCCACCTTGACCCAGG + Intergenic
1057781921 9:98056989-98057011 GGGCGGGGCCGCGGGGAGCCAGG + Intronic
1060296538 9:122347169-122347191 GCACGGGGCCGCGCTTCCCCCGG - Intergenic
1062375889 9:136261759-136261781 GCGGGGGGCAGCGCAGACCCGGG - Intergenic
1062462024 9:136666097-136666119 ACGAGGGGCCGCGGCGACCCCGG - Intronic
1202791383 9_KI270719v1_random:92122-92144 GCGCTGGGCCCAGGTGACCCTGG + Intergenic
1202791522 9_KI270719v1_random:92727-92749 GCGCTGGGCCCCGGGGACCCTGG + Intergenic
1202791574 9_KI270719v1_random:92941-92963 GCGCTGAGCCCCGTGGACCCTGG + Intergenic
1201151320 Y:11097022-11097044 GCGCTGGGCCCCGGGGACCCTGG - Intergenic
1201151482 Y:11097635-11097657 GCGCTGGGCCCCGTCGACCCTGG - Intergenic
1201151890 Y:11099231-11099253 GCGCTTGGCCCCGTGGACCCTGG - Intergenic
1201152494 Y:11101749-11101771 GCGCTGGGCCTCCTGGACCCTGG - Intergenic
1201152548 Y:11101963-11101985 GCGCTGGGCCCCGTGGACCCAGG - Intergenic