ID: 905127871

View in Genome Browser
Species Human (GRCh38)
Location 1:35728431-35728453
Sequence CCATTGCCCAAAAGAAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905127863_905127871 28 Left 905127863 1:35728380-35728402 CCCAAAACCACAAGTTTTACAAA 0: 1
1: 0
2: 2
3: 56
4: 502
Right 905127871 1:35728431-35728453 CCATTGCCCAAAAGAAAACTGGG 0: 1
1: 0
2: 0
3: 25
4: 216
905127864_905127871 27 Left 905127864 1:35728381-35728403 CCAAAACCACAAGTTTTACAAAT 0: 1
1: 0
2: 5
3: 41
4: 383
Right 905127871 1:35728431-35728453 CCATTGCCCAAAAGAAAACTGGG 0: 1
1: 0
2: 0
3: 25
4: 216
905127865_905127871 21 Left 905127865 1:35728387-35728409 CCACAAGTTTTACAAATTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 223
Right 905127871 1:35728431-35728453 CCATTGCCCAAAAGAAAACTGGG 0: 1
1: 0
2: 0
3: 25
4: 216
905127867_905127871 3 Left 905127867 1:35728405-35728427 CCTGGTTGTAGCTACAGAGCAAG 0: 1
1: 0
2: 2
3: 15
4: 120
Right 905127871 1:35728431-35728453 CCATTGCCCAAAAGAAAACTGGG 0: 1
1: 0
2: 0
3: 25
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905127871 Original CRISPR CCATTGCCCAAAAGAAAACT GGG Intronic
900145042 1:1155179-1155201 AAATTGCTGAAAAGAAAACTGGG - Intergenic
901256919 1:7837061-7837083 CTTTTGCCCATGAGAAAACTGGG - Exonic
903425020 1:23247043-23247065 CCATTTCCCATATGAAAAATCGG + Intergenic
903535090 1:24061427-24061449 CCACTGCCCCAAAGAAACATCGG - Intronic
903729572 1:25482110-25482132 CCATTGCCCTTCAGAAATCTTGG + Intronic
904070009 1:27787815-27787837 CCATTACCAAAAAGTAAATTTGG + Intronic
904283425 1:29437345-29437367 CCATTCCAAAAAAGAAAAATTGG - Intergenic
905127871 1:35728431-35728453 CCATTGCCCAAAAGAAAACTGGG + Intronic
908012110 1:59788963-59788985 TCATTTCCCAGAAGGAAACTAGG - Intergenic
909071678 1:71001833-71001855 CGATTGCCCAATACTAAACTGGG + Intronic
910037802 1:82809240-82809262 ACATTCCCCAAAACATAACTCGG + Intergenic
911086583 1:93983239-93983261 CCAATGCCTAAAACAATACTTGG - Intergenic
913103450 1:115591673-115591695 CCATTGCATAAATGAAATCTAGG + Intergenic
913192655 1:116426557-116426579 CCATTGCCCTGAATAAATCTGGG - Intergenic
913288211 1:117247266-117247288 CAATTATCCAAAAGAAAATTGGG + Intergenic
914264266 1:146024608-146024630 ACAGTTCCCAAAAGAAAACCAGG - Intergenic
914364964 1:146969926-146969948 ACATTGCCAAAAAGAAGCCTGGG - Intronic
916375395 1:164148210-164148232 CCATTGCCCAAAAGGAACTATGG + Intergenic
917174144 1:172213219-172213241 CTATTGGCCAGAAGCAAACTTGG - Intronic
918052077 1:180982478-180982500 CTTTTTCCCAAAAGAAAAATTGG - Intronic
918503603 1:185226862-185226884 CCATTGCTCAGAAGAAAGATCGG - Intronic
920049280 1:203153584-203153606 CCAATCCCCAAAAGGAGACTCGG - Intronic
922339175 1:224641668-224641690 CCAGTGCCCAAAATAGAACCTGG - Intronic
922557694 1:226545615-226545637 ACAGTTCCCAAATGAAAACTGGG - Intergenic
923392187 1:233523457-233523479 ACAATGCCCCAAAGGAAACTGGG + Intergenic
923411026 1:233709202-233709224 CCATTGACAAAGAGAAAACTTGG + Intergenic
923623047 1:235593500-235593522 ACAATGCCCAAAAGACAGCTGGG + Intronic
924473265 1:244362273-244362295 CCATCAGCCAAAACAAAACTAGG - Intronic
1063155683 10:3377064-3377086 CCATGTCCCAAAAGAAAAAAAGG + Intergenic
1069209346 10:65736376-65736398 CTATTGCAAAAAAGAAAGCTGGG - Intergenic
1070463749 10:76697188-76697210 ACATTGCTCCAAAGAAAACTGGG + Intergenic
1073695637 10:105863645-105863667 ACACTAACCAAAAGAAAACTTGG + Intergenic
1075319391 10:121477878-121477900 AAATTTTCCAAAAGAAAACTTGG - Intergenic
1076509850 10:131005496-131005518 CCATTAACCAAAACAAAAATTGG - Intergenic
1078524028 11:12086932-12086954 TCATTTCCCAAGAGAAAGCTTGG - Intergenic
1079265924 11:18933074-18933096 CCAATGGCCAAAATAGAACTGGG + Intergenic
1079653008 11:22953879-22953901 AAATTGCCCAATTGAAAACTTGG + Intergenic
1083991382 11:66247870-66247892 CCTTAGCCCAAAAGACACCTGGG + Intergenic
1085785457 11:79444478-79444500 CCATCACCCAGAAGAAAACACGG - Intergenic
1086043394 11:82504977-82504999 AAATTGCCCAAAAGAAAAAGAGG - Intergenic
1087133493 11:94691278-94691300 ACATTGGCCAAAGGAAACCTTGG + Intergenic
1087241378 11:95784996-95785018 GCATTGCCCAAGAGAAATATAGG - Intronic
1090163673 11:124523004-124523026 CCATAACCCAAAAGAAAAATTGG + Intergenic
1093076373 12:14762736-14762758 CCATGGACCTTAAGAAAACTTGG - Intergenic
1093785502 12:23187753-23187775 CCATAGCCCAAAGGTTAACTTGG - Intergenic
1095132838 12:38564297-38564319 CCATAGCCAAAAAGCACACTTGG + Intergenic
1097057904 12:56261079-56261101 CCATTGCCCAAAATAACTCTAGG + Intergenic
1097112608 12:56672664-56672686 TCATTGCTAAAAAGAATACTTGG + Intronic
1097971853 12:65641555-65641577 CTATTGCCCAGAACAAAATTGGG - Intergenic
1099536480 12:83852026-83852048 CCATTGACAAAATGAAAAGTTGG - Intergenic
1099816046 12:87648933-87648955 CTTTTGCCTAAAAGAAGACTTGG + Intergenic
1101698145 12:107146285-107146307 TCACTGCCTAAAAGGAAACTTGG - Intergenic
1103246069 12:119458628-119458650 CAAGGGCCCTAAAGAAAACTAGG - Intronic
1104373206 12:128242642-128242664 CCATTGCCCATAAGGAAAGGAGG + Intergenic
1105206110 13:18225980-18226002 CCAGTGCACAAGAGAGAACTTGG - Intergenic
1106225689 13:27784956-27784978 CTATTGCCCTAAATAAAACTGGG + Intergenic
1108156647 13:47592143-47592165 CCATTCCACAAGAGAAAACTAGG + Intergenic
1108811506 13:54230350-54230372 CTATTACCCATGAGAAAACTGGG + Intergenic
1110404445 13:75134120-75134142 CCATTGCCCAAACCCAAAGTGGG + Intergenic
1111381877 13:87465812-87465834 CTATTTCCAAAAAGAAAATTTGG + Intergenic
1117210288 14:53490540-53490562 CCATTACACAAAAATAAACTAGG - Intergenic
1118575701 14:67239910-67239932 CCATACCCCAAAAGAAAAAACGG - Intergenic
1118855081 14:69614577-69614599 CCATTTCCCACATAAAAACTTGG + Intronic
1119183838 14:72622574-72622596 CAATTTCCCAAAGGAAAACTAGG + Intronic
1119498180 14:75099089-75099111 GCATGGACCAAAAGAAAACAAGG + Intronic
1120004017 14:79336359-79336381 TAATTTCCCAAAAGAAAACCGGG + Intronic
1122549448 14:102542038-102542060 CCACTACCCAAAACAAAAGTTGG + Intergenic
1126842680 15:52732314-52732336 CCATTTCCCAAGAGAACACAAGG + Intergenic
1126922940 15:53547879-53547901 GGAATGCACAAAAGAAAACTAGG + Intronic
1130407716 15:83617061-83617083 CCATTACCCCAGAGATAACTGGG - Intronic
1133384031 16:5354446-5354468 CCATTACACACAAGAAAACCGGG - Intergenic
1133639335 16:7701705-7701727 TCATTGCTCAAATTAAAACTAGG + Intronic
1133822372 16:9248134-9248156 CAATTGCCTCAATGAAAACTAGG - Intergenic
1134268162 16:12709492-12709514 CAATTGGTCAAAATAAAACTAGG + Intronic
1134834089 16:17346887-17346909 CCACTGAACAAAAGAGAACTGGG - Intronic
1135513450 16:23109260-23109282 CCATTTTCCAATATAAAACTAGG + Intronic
1137670915 16:50278404-50278426 CAATAGCCCAATAGAAAAATGGG - Intronic
1139812414 16:69633112-69633134 ACATTGCCAAAAAGCAAACTTGG + Intronic
1140296008 16:73710541-73710563 CCCTTCCCTAAAATAAAACTAGG + Intergenic
1146212912 17:30956147-30956169 CCCTTTCCCAAAATAAAGCTTGG + Intronic
1146336974 17:31981264-31981286 CCACTGCCCAATAGAAGAATGGG + Intronic
1147054612 17:37824780-37824802 GCATTGCTCAAAAGACACCTGGG + Intergenic
1148897659 17:50849175-50849197 CCCTTGCCCAGAAGAAAGATTGG + Intergenic
1150453732 17:65290539-65290561 GCATTGCCAAGAAGAAAACTAGG + Intergenic
1150454649 17:65297501-65297523 CTAGAGCCCAAAAGAAAGCTGGG + Intergenic
1150668614 17:67169888-67169910 CCATTCCCAAAGGGAAAACTAGG + Intronic
1151468200 17:74301387-74301409 CCACTGGCCAAAAGATGACTTGG - Intronic
1155605239 18:27597917-27597939 CCATTTCCCTGAAGAAAAATTGG + Intergenic
1156520154 18:37715318-37715340 CCATTGACCAAAAGAAGTCTTGG - Intergenic
1156526485 18:37772755-37772777 TCATTGCCCTAAATAAAAATAGG + Intergenic
1158518724 18:58152469-58152491 CCTCTTCCCCAAAGAAAACTTGG - Intronic
1158524306 18:58198444-58198466 CCATTCCCTAAAACAAAATTCGG - Intronic
1158876799 18:61741889-61741911 CCATGTCACAGAAGAAAACTGGG + Intergenic
1161148914 19:2696535-2696557 CCATTGCCCAAAGGCAAAAGCGG + Intronic
1162458498 19:10800326-10800348 CAATTGGCCAAATCAAAACTGGG - Intronic
1164304052 19:23988000-23988022 TCATTGCCCAAAAAAGAAATTGG - Intergenic
1167192757 19:48003099-48003121 CCAGTGCCCAAAGCATAACTTGG + Intronic
1168127283 19:54292224-54292246 ACATTCCCTAAAATAAAACTGGG - Intergenic
925820422 2:7794342-7794364 TCTTTGCCCAAAAGACCACTGGG + Intergenic
927643861 2:24862605-24862627 TCTTCCCCCAAAAGAAAACTTGG - Intronic
929408763 2:41672795-41672817 CCATTCCCAAAGAAAAAACTTGG + Intergenic
936057551 2:109272263-109272285 CAATTGCCCAACCAAAAACTGGG + Intronic
937147846 2:119662740-119662762 GCATTGCACTAAAGAACACTAGG + Intergenic
938110153 2:128558944-128558966 CCATTTTCCAAGGGAAAACTTGG + Intergenic
938171953 2:129086722-129086744 CCATTTACTAAAATAAAACTTGG - Intergenic
940831470 2:158470923-158470945 CCAGTGCCCTAAGGAAGACTGGG - Intronic
941879049 2:170463034-170463056 CTATTGCTTAAAAGGAAACTTGG - Intronic
942316851 2:174705012-174705034 CCACTCCCCAAAATAAAATTTGG - Intergenic
944827619 2:203501419-203501441 AAATTGCCCAAATGGAAACTGGG + Intronic
946026964 2:216677718-216677740 CCATTGCCCAAAGGAGAGCCTGG + Intronic
947284005 2:228490217-228490239 GCATTGCCAAAAAGAAGACTCGG - Intergenic
947472787 2:230413845-230413867 CCATTGCCCCACAGAAAAGGTGG + Intergenic
947592080 2:231391635-231391657 CCCTTGCCCAAGGGAAGACTGGG - Intergenic
948109790 2:235445285-235445307 CAATTGCTCACAAGAAAAATGGG - Intergenic
1170151753 20:13233781-13233803 CCATTGCCCAAATGTTCACTAGG + Intronic
1170274265 20:14566181-14566203 CAAATGACCAAAAGAAAAATGGG + Intronic
1173339407 20:42140131-42140153 ACATTGCCTAAGAAAAAACTTGG - Intronic
1174233691 20:49069541-49069563 GCATTCCCCAAAAGGAAATTGGG + Intronic
1175054759 20:56188225-56188247 CCAGAGCTCAAAAGAAAACTTGG + Intergenic
1175280429 20:57800669-57800691 CTATTCCTCAAAAGAAAACTGGG + Intergenic
1175501949 20:59456813-59456835 CCATGGCCCAACAGAACCCTGGG + Intergenic
1178588552 21:33890081-33890103 CCATTTCCCAGCAGAAAACATGG + Exonic
1178644477 21:34374144-34374166 CCATTCCCCAAAAGTGAAGTTGG - Intergenic
1180672887 22:17566840-17566862 CCATTGCCCACCAGAAAAGGTGG + Intronic
1180759853 22:18192734-18192756 CCAGTGCGCAAGAGAGAACTTGG + Intergenic
1180770165 22:18377036-18377058 CCAGTGCGCAAGAGAGAACTTGG + Intergenic
1180775815 22:18431966-18431988 CCAGTGCGCAAGAGAGAACTTGG - Intergenic
1180808889 22:18743001-18743023 CCAGTGCGCAAGAGAGAACTTGG - Intergenic
1180828105 22:18879990-18880012 CCAGTGCGCAAGAGAGAACTTGG + Intergenic
1181214559 22:21315851-21315873 CCAGTGCGCAAGAGAGAACTTGG + Intergenic
1181933293 22:26420380-26420402 CCACTGCCCCAAATAAAAGTTGG - Intergenic
1182718288 22:32377480-32377502 CTCTGGCCGAAAAGAAAACTAGG - Intronic
1183921548 22:41173421-41173443 CCATTGCCTTAAAGATCACTGGG + Intronic
1203231997 22_KI270731v1_random:118220-118242 CCAGTGCGCAAGAGAGAACTTGG + Intergenic
1203278204 22_KI270734v1_random:105990-106012 CCAGTGCGCAAGAGAGAACTTGG + Intergenic
950047795 3:9960625-9960647 TGATTCCCCAAAGGAAAACTGGG - Intergenic
950205503 3:11077092-11077114 CCCTTTCACACAAGAAAACTAGG + Intergenic
951780076 3:26353037-26353059 CCATTGCCAGAGAGAAAACAAGG + Intergenic
952173203 3:30832631-30832653 ACCTAGACCAAAAGAAAACTTGG + Intronic
952570214 3:34706655-34706677 ATTTTGCCCAAAAGAAAAATAGG + Intergenic
953334566 3:42083282-42083304 AGATAGCCCAAAAGAAAAATGGG - Intronic
955513070 3:59700530-59700552 TAATTCCCCAAAAGAAATCTAGG + Intergenic
955690487 3:61585838-61585860 CCACTGACCAAAACAGAACTTGG - Intronic
956302818 3:67790959-67790981 CCATTCCCCAAGACAGAACTCGG - Intergenic
956455796 3:69419589-69419611 CCCAAGCCCAAAGGAAAACTGGG + Intronic
958456134 3:94333768-94333790 CCATGCCTCAAAAGAAAAATTGG + Intergenic
961587525 3:127945621-127945643 ACATAACCCAAATGAAAACTGGG - Intronic
961737818 3:129013348-129013370 CCTTAGGCCAAAAGAAAAGTAGG + Intronic
961935268 3:130576106-130576128 CGATTGCCCTAATAAAAACTGGG + Intronic
962041867 3:131715889-131715911 CTGTTGCCCAAAAGAAATCAAGG - Intronic
963104930 3:141638916-141638938 CCATTGCCCAAAACTTACCTTGG + Intergenic
963156399 3:142101992-142102014 CCATTTTCCAAATAAAAACTAGG + Intronic
964785706 3:160393888-160393910 CAAGTGACCCAAAGAAAACTCGG - Intronic
964954871 3:162341032-162341054 ACAATGCCCAAAAGAAATCAGGG - Intergenic
968331470 3:197874122-197874144 CCCCTGCACTAAAGAAAACTTGG - Intronic
970051850 4:11923489-11923511 CAACTACCCAAAGGAAAACTAGG - Intergenic
971785263 4:31094155-31094177 CCATTACTCAAGAGAAAACATGG + Intronic
971886691 4:32458873-32458895 CAATTGCCTAAAAAAGAACTGGG - Intergenic
972088392 4:35249444-35249466 ACATTGCTTAAAAGAAAACCAGG + Intergenic
975074520 4:70188332-70188354 CCATTGCACAGAATGAAACTGGG + Intergenic
975653867 4:76621447-76621469 CCTTTGCACCAAAGCAAACTTGG + Intronic
977250850 4:94687146-94687168 CGATTGCACAAAAGTCAACTGGG - Intergenic
979350472 4:119638379-119638401 CCCTTTCCCAAATCAAAACTGGG + Intergenic
981281228 4:142961844-142961866 CTATTTTCCAAAAGAAGACTTGG - Intergenic
982244486 4:153336997-153337019 CCAGTGCCTAAAAGAGTACTTGG - Exonic
983035233 4:162856497-162856519 ACACTGCCTAAAAAAAAACTAGG + Intergenic
984504691 4:180602292-180602314 TCATTGCCCAAAACAATACCTGG - Intergenic
988283278 5:29177090-29177112 CCATTGCCCAATATACAACGAGG - Intergenic
988485979 5:31668450-31668472 CCATTGCCCAAATAAATCCTTGG + Intronic
990534189 5:56704016-56704038 CCACTGCCCCAGAGAAAACTTGG + Intergenic
990650144 5:57888959-57888981 CAATTGCCCCAGAGAAAACTGGG - Intergenic
991302878 5:65145935-65145957 CCATTGATCAAAAGACAACACGG + Intergenic
991626380 5:68605521-68605543 CCAATGGCCAAAAGAAAATAGGG - Intergenic
996707069 5:126508215-126508237 CCAGGGCCGAAAAGAAATCTGGG - Intergenic
1000937708 5:167322650-167322672 TCACTGTCCAAAAGAAAAATAGG + Intronic
1002605841 5:180382174-180382196 CCATTTCCCAAAGGAAAACCAGG + Intergenic
1003529460 6:6925733-6925755 CCAGTGCCCAACACCAAACTGGG + Intergenic
1004502914 6:16225067-16225089 CCATTCACCAATTGAAAACTTGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1006889691 6:37415372-37415394 ACACTGATCAAAAGAAAACTAGG - Intergenic
1007791743 6:44313094-44313116 GCATTGACAAAAAGCAAACTGGG + Exonic
1010381336 6:75228965-75228987 ACATTTCTCAAAAGAAGACTTGG + Intergenic
1012444153 6:99291326-99291348 CCATTGCCCAAAGGAAATTAAGG + Intronic
1012858503 6:104530551-104530573 CCATTGCCCTAAAGAGAAATAGG - Intergenic
1014106412 6:117568331-117568353 CCTTTGCTCAAAAGAAAACACGG + Intronic
1014597013 6:123357806-123357828 CCATCGTTGAAAAGAAAACTTGG - Intronic
1015934749 6:138397407-138397429 CAAGTGTCCCAAAGAAAACTAGG + Intergenic
1016788949 6:148046265-148046287 ATATTGCCAAAAACAAAACTCGG - Intergenic
1017125605 6:151061378-151061400 CCATTACCCAATAAAAACCTTGG - Intronic
1017306438 6:152923477-152923499 GCATTACCCAAAAGAACACAAGG + Intergenic
1017382347 6:153845158-153845180 CAAATGCCCTAGAGAAAACTGGG + Intergenic
1018093032 6:160362264-160362286 GGATTGCCCAAAAGAAAATCTGG - Intronic
1018987470 6:168648848-168648870 CCAGTGTCAAAAAGAAACCTAGG + Intronic
1019020610 6:168914616-168914638 TAATTGGCAAAAAGAAAACTTGG + Intergenic
1019662400 7:2232337-2232359 CCATTGCCCAAACGAGATCAGGG + Intronic
1021673434 7:23056603-23056625 CCAATCCCCAAAAGAAACCATGG + Intergenic
1021806909 7:24366746-24366768 GCATTGCAGATAAGAAAACTAGG + Intergenic
1023291323 7:38671708-38671730 AGATTCCCCAAAAGAACACTCGG + Intergenic
1025820589 7:64959271-64959293 CCACTGCCTGAAAGAAAACTCGG + Intergenic
1027950776 7:84812192-84812214 TCATTGCCAAAAAGGAAACAAGG + Intergenic
1028229454 7:88288717-88288739 CAATTGCCCATTAGAAAATTGGG + Intronic
1031713284 7:125075749-125075771 CCATTACAAAAAAGAAAAATTGG - Intergenic
1034351799 7:150420687-150420709 CCACTGCCCAGAACAAAACTGGG + Intergenic
1036062174 8:5335564-5335586 CAATTCCCTGAAAGAAAACTAGG - Intergenic
1038922979 8:32105920-32105942 CCACTGCTCAAAAGAAACCCTGG - Intronic
1040929563 8:52719380-52719402 ACATTGCCTAAAAGAAAATTAGG - Intronic
1042163552 8:65922463-65922485 CCATTGTTTAAAAGAAAACCTGG - Intergenic
1043751875 8:83947421-83947443 CACTAGCCCACAAGAAAACTGGG + Intergenic
1044396679 8:91721089-91721111 CTATTGCCCAAAGAAAAAGTGGG - Intergenic
1045141622 8:99291293-99291315 CTATTACCCTAAAGAAAACTTGG - Intronic
1046021551 8:108671456-108671478 CCTGTGCCCAAAAGAAAAGCAGG + Intronic
1046536107 8:115512905-115512927 CCATTCCCCATAACAATACTTGG - Intronic
1047799717 8:128296315-128296337 CCATTGCGCAAAAGAAAGAGTGG - Intergenic
1049105620 8:140610651-140610673 CCACAGCCCAAAAGAGAACACGG + Intronic
1051105717 9:13577767-13577789 ACATTGCCCGAAGGAAAACTTGG + Intergenic
1051436253 9:17035805-17035827 CACTTGGCCAAATGAAAACTTGG + Intergenic
1052433418 9:28396004-28396026 CCATTGGGCAGAAGGAAACTAGG + Intronic
1052501546 9:29298242-29298264 CCTTTGCTCAAAAGAATATTAGG - Intergenic
1054800097 9:69339464-69339486 TCTGTGCCAAAAAGAAAACTAGG - Intronic
1055706732 9:79013470-79013492 CTATTGCCAAAGAGACAACTTGG + Intergenic
1056462650 9:86823299-86823321 TCATTGCCTGAAAGAAAACTTGG + Intergenic
1057577250 9:96253022-96253044 CCATTGCCCCAAATAAAAATGGG + Intronic
1059242968 9:112823656-112823678 CTACTACTCAAAAGAAAACTTGG - Intronic
1060146653 9:121258948-121258970 CCAGTGCCCAACACAGAACTTGG - Intronic
1060242163 9:121913338-121913360 CCATTGGCAAAAAGAAGACCAGG + Intronic
1060609492 9:124949820-124949842 CCAATGCCCAGAAGAAAATCTGG + Intronic
1062469208 9:136694968-136694990 CCATTGAGCAACAGCAAACTGGG - Intergenic
1186169641 X:6863329-6863351 CTATTGTCCAAAAGAAGACGAGG + Intergenic
1186431534 X:9509396-9509418 ACATTGCCTAAAAGAACCCTTGG + Intronic
1186621328 X:11243376-11243398 CCAGTGCCCAAATCAATACTGGG - Intronic
1186644687 X:11493999-11494021 CCATTTCTGAAATGAAAACTGGG + Intronic
1187282369 X:17867430-17867452 TCACTGCCCAAAACAAATCTGGG - Intergenic
1188418009 X:29960465-29960487 TCTTTGCCTAAAAAAAAACTTGG - Intergenic
1189511937 X:41671494-41671516 CCTTGCCTCAAAAGAAAACTCGG - Exonic
1189947955 X:46199296-46199318 CCTTTATCCAAAAGAAATCTAGG + Intergenic
1191138583 X:57092650-57092672 CCATTGCCTGAAAACAAACTCGG + Intergenic
1192592678 X:72374019-72374041 CCTTTGCCCATATTAAAACTGGG + Intronic
1193007968 X:76642428-76642450 CCACTGCCCAGAAATAAACTTGG - Intergenic
1193534306 X:82694059-82694081 GCAATGCCTAAAAGAAAACCTGG + Intergenic
1197460868 X:126739065-126739087 ACATTGTCCAAAAGAAGATTGGG - Intergenic
1199202263 X:145106085-145106107 CCATTTCCCAAAGTAAAACATGG - Intergenic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic