ID: 905130884

View in Genome Browser
Species Human (GRCh38)
Location 1:35756287-35756309
Sequence AGGTTATTATGGGTGCCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905130884 Original CRISPR AGGTTATTATGGGTGCCACT AGG Intronic
900816324 1:4849265-4849287 AGATTATTCTGGGTGCGTCTGGG - Intergenic
905130884 1:35756287-35756309 AGGTTATTATGGGTGCCACTAGG + Intronic
906420924 1:45666204-45666226 AGGTTGCAGTGGGTGCCACTGGG - Intronic
922078684 1:222272968-222272990 AGATTATCAGTGGTGCCACTTGG - Intergenic
1071424729 10:85537829-85537851 AGGTTATATTTGGTGCCAGTAGG - Intergenic
1071761192 10:88609225-88609247 AGGTTATTATGAATGCTGCTAGG + Intergenic
1076671437 10:132122842-132122864 AGGTTGTGGTGGGTGGCACTGGG + Intronic
1077925540 11:6679077-6679099 ATGTTATTCTAAGTGCCACTGGG - Intergenic
1083705502 11:64511706-64511728 AGATTATTATTGGTGCCCATAGG - Intergenic
1085314517 11:75536309-75536331 AGGTGATTATGGGAGCCACAGGG - Intergenic
1090183479 11:124720582-124720604 AGGTTTTTATGGGTGGATCTGGG - Intergenic
1090716839 11:129438653-129438675 AGGGCCTTCTGGGTGCCACTGGG + Intronic
1094113663 12:26886880-26886902 AAATTATTATGGGAGTCACTTGG - Intergenic
1098886361 12:75964592-75964614 AGGATATGATAGGTGCCCCTGGG + Intergenic
1099111202 12:78563717-78563739 AGGTTATTATGTCTGCCACATGG + Intergenic
1099558558 12:84143722-84143744 AAGTTATTACAGGTACCACTGGG - Intergenic
1104584754 12:130039025-130039047 AGGATTTAATGGGTGTCACTGGG + Intergenic
1117254632 14:53965072-53965094 AGTTTTTTATGAGTGCAACTTGG - Intergenic
1118158849 14:63268858-63268880 TGGATATTATTGGTGCCACCAGG - Intronic
1118731677 14:68671138-68671160 CAGTTATCATGGGTGCCCCTTGG - Intronic
1123099173 14:105784112-105784134 AGGTGTTAGTGGGTGCCACTGGG + Intergenic
1127569106 15:60223563-60223585 GGGTCATTAGGGGTGTCACTAGG - Intergenic
1129603813 15:77015006-77015028 GGGTTATCCTGGGTGCCACATGG + Intronic
1135085199 16:19469629-19469651 AGGTTATTATGGCCGTCACTGGG - Intronic
1135757262 16:25108374-25108396 AGGTGATTTTGGGTGCCAATTGG + Intergenic
1138347784 16:56330585-56330607 AAGTTTTTCTGGATGCCACTGGG - Intronic
1143069370 17:4277596-4277618 GGATTACTGTGGGTGCCACTTGG - Intronic
1144031961 17:11331166-11331188 AGCTTCTTCTGGATGCCACTGGG - Intronic
1154318849 18:13327942-13327964 AGGTTTCTTTGGGTGCCCCTTGG - Intronic
1155708600 18:28847511-28847533 AGGGGATTTTGGTTGCCACTGGG - Intergenic
1156650199 18:39216735-39216757 AGGATGTTGTGGGTGCCATTTGG + Intergenic
1157301929 18:46485381-46485403 AGGCAAATATGGGAGCCACTGGG + Intronic
1158494605 18:57943046-57943068 TGATTTTTATGGGTGCCACAAGG + Intergenic
1160563345 18:79772340-79772362 AGGTTTTGATGGGTGCATCTCGG + Intergenic
1161111469 19:2473126-2473148 AGGTTGTTATGGCTGGCACGGGG + Intergenic
1161508072 19:4654858-4654880 AGGTTATTTTGGGTGCCTGTGGG + Exonic
1162791972 19:13067755-13067777 AGGTAGTTATGGCTCCCACTAGG - Intronic
925230375 2:2227509-2227531 AGGTCCTTATGGGTTCCACCTGG - Intronic
932057204 2:68457774-68457796 AAGATATTCTGGGGGCCACTGGG + Intergenic
933428611 2:82145374-82145396 ATGTGATTATCTGTGCCACTTGG + Intergenic
935736089 2:106107659-106107681 AGGTTATTTTGGGAGCCTTTTGG - Intronic
1170964592 20:21055022-21055044 TGATTATCATGGGTGCCACCAGG - Intergenic
1178848499 21:36193397-36193419 AGGTTCTTCTTGGTGCCTCTGGG + Intronic
1183796428 22:40122325-40122347 CTGCTATTATGTGTGCCACTGGG + Intronic
949807992 3:7976514-7976536 AGGTTATTATGGGTGCAGGATGG - Intergenic
950580598 3:13859481-13859503 ATGAAATTATAGGTGCCACTGGG + Intronic
953071926 3:39529494-39529516 ATGTTATTATGGGCACCAATTGG - Intergenic
953983162 3:47422839-47422861 TGGTTGTTGTGGGTGGCACTTGG - Intronic
955042949 3:55334596-55334618 AGGTAACTGTGGGTGCCACGTGG + Intergenic
958716792 3:97793480-97793502 AGGTTATCATGAGTGACAATAGG - Intronic
959872595 3:111345559-111345581 AGTTTATAATGGGTTTCACTGGG - Intronic
963525299 3:146408801-146408823 TGGGTATTAAGGGAGCCACTTGG - Intronic
969993206 4:11285127-11285149 TGGGAATTATGGGAGCCACTAGG + Intergenic
970412364 4:15820884-15820906 ACATTATTATTGGTGCCACATGG + Intronic
976035283 4:80811071-80811093 AGGTTATTATAAATGCCAGTTGG + Intronic
977987309 4:103398506-103398528 ATGTTCTGATGGGTTCCACTTGG + Intergenic
986254386 5:6089860-6089882 AAGTTCATATGTGTGCCACTGGG - Intergenic
988034454 5:25807832-25807854 AGGCTATGATGGCGGCCACTAGG + Intergenic
993292425 5:86091775-86091797 GGATTCTTATGTGTGCCACTGGG - Intergenic
999561201 5:152805084-152805106 GGGGTCTTATGGCTGCCACTGGG - Intergenic
1004445039 6:15690268-15690290 TGGTTATTCTGGGAGCCACATGG + Intergenic
1012072020 6:94634062-94634084 AGGGTATTATGGATTTCACTGGG + Intergenic
1012121721 6:95376346-95376368 AGGTTATTATTTGTGGCATTGGG + Intergenic
1013195093 6:107837864-107837886 AGGTTATTCTGGGACACACTGGG - Intergenic
1013728102 6:113126398-113126420 AGGTTGTTGTGGGTGGCAGTGGG + Intergenic
1013974967 6:116066517-116066539 AGATTATTTTGGCTGCCATTTGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1022911442 7:34902762-34902784 AGGAAATTATGGGTGCAAATAGG + Intergenic
1023503995 7:40881173-40881195 AGTTAATGATGGGTGCCTCTAGG - Intergenic
1024088421 7:45916240-45916262 AGTTTATAAAGGGTGCCACTGGG + Intronic
1026448697 7:70508210-70508232 AGGCTCTAATGGGTCCCACTGGG - Intronic
1033015521 7:137667125-137667147 AGGTTATTATTTGTGCCAGCAGG + Intronic
1034430406 7:151038525-151038547 ATTTTATTAAGGGAGCCACTGGG - Intronic
1044839654 8:96326973-96326995 AGGTTCTAACTGGTGCCACTGGG + Intronic
1046259425 8:111747193-111747215 ATCATATTATGGGGGCCACTTGG - Intergenic
1046762471 8:118035662-118035684 ATGTTTTTAAAGGTGCCACTGGG - Intronic
1048791331 8:138106882-138106904 AAGTTATTATCTGTGCCCCTGGG - Intergenic
1053261889 9:36673925-36673947 AGGTAATTCTGGGTGGCACATGG - Intronic
1054824914 9:69564007-69564029 AGGTAATTATGGTGGTCACTGGG - Intronic
1056621911 9:88221677-88221699 AGGGAATTCTTGGTGCCACTAGG - Intergenic
1187526094 X:20056600-20056622 AGGGGATTATGGGCACCACTGGG - Intronic
1189334533 X:40162806-40162828 AGTTTATTGTGGGTTCGACTAGG - Intronic
1196662784 X:118285152-118285174 GGGTTATTTTGGGTGGCAGTGGG - Intergenic
1199488150 X:148370622-148370644 AGGTTATTAATTGTGCAACTGGG + Intergenic