ID: 905132265

View in Genome Browser
Species Human (GRCh38)
Location 1:35769917-35769939
Sequence TTCCCTCAGCCGGAGAGCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 1043}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905132262_905132265 10 Left 905132262 1:35769884-35769906 CCTGCGCTCCACTAGGGACGGAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG 0: 1
1: 0
2: 2
3: 48
4: 1043
905132261_905132265 11 Left 905132261 1:35769883-35769905 CCCTGCGCTCCACTAGGGACGGA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG 0: 1
1: 0
2: 2
3: 48
4: 1043
905132259_905132265 12 Left 905132259 1:35769882-35769904 CCCCTGCGCTCCACTAGGGACGG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG 0: 1
1: 0
2: 2
3: 48
4: 1043
905132258_905132265 15 Left 905132258 1:35769879-35769901 CCTCCCCTGCGCTCCACTAGGGA 0: 1
1: 0
2: 0
3: 6
4: 144
Right 905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG 0: 1
1: 0
2: 2
3: 48
4: 1043
905132263_905132265 2 Left 905132263 1:35769892-35769914 CCACTAGGGACGGAGCTGTCTCT 0: 1
1: 0
2: 1
3: 5
4: 85
Right 905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG 0: 1
1: 0
2: 2
3: 48
4: 1043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905132265 Original CRISPR TTCCCTCAGCCGGAGAGCAG CGG Exonic
900010409 1:102062-102084 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
900026514 1:278627-278649 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
900307250 1:2016782-2016804 TTGCCTAGGCCGGAGGGCAGTGG - Intergenic
901295002 1:8154389-8154411 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
901345508 1:8537162-8537184 TTGCCTCAGCTGGAGTGTAGTGG - Intronic
901357352 1:8662656-8662678 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
901582399 1:10255548-10255570 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
901609673 1:10487818-10487840 TTGCCTCGGCTGGAGTGCAGTGG + Intronic
901803827 1:11725274-11725296 TTGCCTAAGCTGGAGTGCAGTGG - Exonic
902169662 1:14599369-14599391 AACTCCCAGCCGGAGAGCAGCGG - Intronic
902419744 1:16269420-16269442 TTCCCCAGGCCGGAGTGCAGTGG + Intronic
902758092 1:18562475-18562497 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
902816078 1:18917545-18917567 GTCCCTCTGCCGGGAAGCAGGGG - Intronic
902994091 1:20210456-20210478 GTCACTCAGCTGGAGTGCAGTGG + Intergenic
903994472 1:27297125-27297147 TTCCGGCTGCCGGAGAGTAGGGG + Exonic
904198270 1:28802212-28802234 TGCCCTCAGGAGGTGAGCAGGGG + Intergenic
904712501 1:32441063-32441085 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
904717952 1:32483383-32483405 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
904723292 1:32527212-32527234 TCACCTCAGCTGGAGTGCAGTGG - Intronic
904858729 1:33519454-33519476 CTCCAGCAGCCGGTGAGCAGGGG - Exonic
905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG + Exonic
905422278 1:37855916-37855938 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
905614571 1:39386469-39386491 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
905636269 1:39555408-39555430 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
905760566 1:40553872-40553894 TTGCCTAGGCTGGAGAGCAGAGG + Intergenic
905934917 1:41815807-41815829 TTGCCCAAGCCGGAGTGCAGTGG + Intronic
906127143 1:43433737-43433759 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
906213195 1:44023743-44023765 TGCCCTCAGCCTTAGAGCACAGG - Intronic
906492935 1:46282037-46282059 TCACCTAAGCCGGAGTGCAGTGG - Intronic
906612200 1:47211328-47211350 TTCCCCCGGCTGGAGTGCAGTGG - Intergenic
907077236 1:51589991-51590013 TTCCCTGGGCTGGAGTGCAGGGG - Intronic
907469391 1:54663410-54663432 TTGCCTCAGCTGGAATGCAGTGG + Intronic
907545921 1:55259978-55260000 TTCCCTCGGAGTGAGAGCAGGGG - Intergenic
907876965 1:58499443-58499465 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
908241692 1:62194132-62194154 TTGCCACAGCTGGAGTGCAGTGG - Intergenic
908466575 1:64402141-64402163 TTCCCAGTGCAGGAGAGCAGAGG + Intergenic
908980197 1:69947036-69947058 TTGCCTCAGCTGGAGTGCAGTGG - Intronic
909631756 1:77775503-77775525 TTGCCTAGGCTGGAGAGCAGCGG + Intergenic
909740373 1:79021989-79022011 TCCCCTCAGCTGGAGTGCAATGG + Intergenic
910174773 1:84417508-84417530 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
910294552 1:85631144-85631166 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
910810784 1:91233930-91233952 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
910996975 1:93116541-93116563 TTGCCTCGGCTGGAGTGCAGTGG + Intronic
911605936 1:99905234-99905256 GTCCCCCAGCTGGAGTGCAGTGG + Intronic
912517552 1:110225816-110225838 TTGCCAGAGCCGGGGAGCAGAGG - Intronic
913282141 1:117196110-117196132 TTGCCTCACCTGGAGTGCAGTGG - Intronic
913312425 1:117514321-117514343 GTCCCCCAGCTGGAGTGCAGTGG - Intronic
914243605 1:145869754-145869776 TTCCCTCAGGCGGAGCACAGTGG - Intronic
914349490 1:146827833-146827855 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
914686656 1:149985706-149985728 GTCCCTCAGGCTGAGTGCAGTGG - Intronic
914800257 1:150956344-150956366 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
914861474 1:151389788-151389810 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
915230596 1:154442824-154442846 TTGCCCAAGCCGGAGTGCAGTGG + Intronic
915602051 1:156928608-156928630 TTACCTGGGCTGGAGAGCAGTGG + Intronic
915671301 1:157491084-157491106 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
916016491 1:160754410-160754432 TTGCCTAGGCCGGAGTGCAGTGG - Exonic
916656372 1:166879239-166879261 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
917088259 1:171325885-171325907 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
917181351 1:172301460-172301482 TTGCCTGAGCTGGAGTGCAGTGG - Intronic
917526671 1:175794381-175794403 TGACCTCAGGCTGAGAGCAGTGG - Intergenic
917704337 1:177616401-177616423 TGCCCCCCGCTGGAGAGCAGTGG - Intergenic
917909510 1:179628368-179628390 TTCCCCAAGCTGGAGTGCAGTGG + Intronic
917926344 1:179792157-179792179 TTGCCTCAGCTAGAGTGCAGTGG + Intronic
918205670 1:182307016-182307038 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
918274775 1:182943484-182943506 TTGCCCCAGCTGGAGTGCAGCGG + Intronic
918294775 1:183146152-183146174 TTGCCTCAGCTGGAGTGCAGTGG - Intergenic
918305404 1:183241206-183241228 TTCCCCAGGCTGGAGAGCAGTGG - Intronic
918312586 1:183295886-183295908 TCCCCTAAGCTGGAGTGCAGTGG + Intronic
918360059 1:183748443-183748465 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
918470650 1:184869580-184869602 TTTCCCAAGCCGGAGTGCAGTGG + Intronic
918476936 1:184935028-184935050 TTACCCAAGCCGGAGTGCAGTGG - Intronic
919015930 1:192036251-192036273 TCACCCCAGCAGGAGAGCAGTGG - Intergenic
919103909 1:193125614-193125636 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
919543712 1:198884756-198884778 TTCCCCAGGCTGGAGAGCAGTGG + Intergenic
919891795 1:201981023-201981045 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
920120415 1:203652182-203652204 TCCCCTAAGCTGGAGTGCAGTGG + Intronic
920185780 1:204158455-204158477 TTGCCTTAGCTGGAGTGCAGTGG + Intronic
920323347 1:205141604-205141626 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
920509578 1:206540931-206540953 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
920583752 1:207137655-207137677 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
920684562 1:208099608-208099630 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
920749752 1:208662469-208662491 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
921127241 1:212188657-212188679 TTGCCTCAGCTGGCGTGCAGTGG - Intergenic
921537590 1:216370636-216370658 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
921599742 1:217093741-217093763 TCACCTCAGCTGGAGTGCAGTGG - Intronic
922076421 1:222249298-222249320 TTGCCTCATCTGTAGAGCAGTGG + Intergenic
922210404 1:223481997-223482019 TTGCCCATGCCGGAGAGCAGTGG + Intergenic
922294954 1:224241814-224241836 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
922298963 1:224278770-224278792 TTGCCTAGGCTGGAGAGCAGTGG + Intronic
922308104 1:224362118-224362140 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
922324096 1:224512438-224512460 TTGCCTCAGCTGAAGTGCAGAGG - Intronic
922450280 1:225731908-225731930 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
922758819 1:228111476-228111498 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
922893623 1:229082098-229082120 TTCCCCCAGTTGGAGTGCAGTGG + Intergenic
922940182 1:229456865-229456887 TTGCCCCAGCTGGAGGGCAGTGG + Intronic
922984905 1:229858710-229858732 TTGCCCAGGCCGGAGAGCAGGGG - Intergenic
923610020 1:235482785-235482807 TTACCTGAGCTGGAGTGCAGTGG - Intronic
923694760 1:236237157-236237179 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
923698023 1:236273764-236273786 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
923747083 1:236711388-236711410 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
923863579 1:237916557-237916579 TTCCCTCAGTCGGAAACCAAGGG - Intergenic
923923478 1:238596490-238596512 TCACCCAAGCCGGAGAGCAGTGG - Intergenic
924240472 1:242035147-242035169 TTCCCTAAGCTGAAGAGCAGTGG - Intergenic
924461946 1:244267338-244267360 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1063384040 10:5604749-5604771 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1063455432 10:6179274-6179296 TTCCCTCTGGGGAAGAGCAGTGG + Intronic
1063584480 10:7339198-7339220 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1064083085 10:12324026-12324048 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1064495844 10:15909544-15909566 GTCACTCAGGCTGAGAGCAGTGG + Intergenic
1064850142 10:19700869-19700891 TTCCCTCAGGCTGGGTGCAGTGG + Intronic
1064868605 10:19910967-19910989 TCCCCTCAGCTGGAGTGCAGTGG - Intronic
1064889625 10:20155917-20155939 TTGCCTCGGCTGGAGTGCAGTGG + Intronic
1064978527 10:21143407-21143429 TTCACCCAGCTGGAGTGCAGTGG - Intronic
1065003602 10:21359937-21359959 TTGCCTAAGCTGGAGTGCAGAGG + Intergenic
1065054756 10:21833429-21833451 TTGCCTCAGCTGGAGTGCAATGG - Intronic
1065400388 10:25293783-25293805 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
1065577299 10:27134533-27134555 TTGCCTAAGCCAGAGTGCAGTGG - Intronic
1066120058 10:32277597-32277619 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1066358354 10:34706719-34706741 TTACCCCAGCTGGAGTGCAGTGG - Intronic
1067447279 10:46359096-46359118 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1067504487 10:46838329-46838351 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1067590100 10:47501667-47501689 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1067637222 10:48009764-48009786 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1068703498 10:60046844-60046866 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1069048927 10:63771609-63771631 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1069449736 10:68507110-68507132 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1069732121 10:70623809-70623831 TTACCTAAGCTGGAGTGCAGTGG + Intergenic
1069934286 10:71904755-71904777 TTGCCTAGGCCGGAGTGCAGTGG - Intergenic
1070030658 10:72673939-72673961 TTGCCTCAGGCAGAGTGCAGTGG - Intergenic
1070133815 10:73674194-73674216 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1070178051 10:73989193-73989215 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
1070258910 10:74834556-74834578 TTGCCTAGGCTGGAGAGCAGTGG + Intronic
1071133632 10:82426670-82426692 TTACCCCAGCTGGAGAGCAGTGG + Intronic
1071739510 10:88341017-88341039 TTACCCCAGCTGGAGTGCAGTGG - Intronic
1071770736 10:88726652-88726674 TTCCCTGGGCTGGAGTGCAGTGG - Intronic
1072646408 10:97258492-97258514 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1072963754 10:99954070-99954092 TTGCCCAAGCTGGAGAGCAGTGG + Intronic
1073162702 10:101413599-101413621 TTCCCTCAGGCTGGGTGCAGTGG - Intronic
1073182363 10:101592349-101592371 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1073202548 10:101747606-101747628 TTGCCCAAGCCGGAGTGCAGTGG - Intergenic
1073231172 10:101971509-101971531 TTGCCTAAGCTGGAGAGCAGTGG - Intronic
1073433086 10:103499503-103499525 TTCTTTCAGCTGGAGTGCAGTGG + Intronic
1073778721 10:106813911-106813933 TAGCCTCAGCTGGAGTGCAGTGG - Intronic
1073778822 10:106814997-106815019 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1073887375 10:108055298-108055320 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
1074480603 10:113816715-113816737 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1074552542 10:114458031-114458053 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1074790323 10:116880062-116880084 GTCCCTCTGCAGGAGGGCAGGGG + Intronic
1075133829 10:119764619-119764641 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1075514771 10:123100159-123100181 TTCCCACAGCCAGAGGGGAGTGG + Intergenic
1075619127 10:123912667-123912689 TTCCTCCAGCCGGAGTGGAGAGG - Intronic
1076392909 10:130117084-130117106 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1076863024 10:133150913-133150935 ATCCCTCTCCCGGAGGGCAGTGG + Intergenic
1077447491 11:2604436-2604458 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1077468003 11:2742780-2742802 TTCCCTCAGCAGCCGTGCAGAGG - Intronic
1077902961 11:6504868-6504890 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1078312656 11:10260838-10260860 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1078524577 11:12090683-12090705 TTGCCTAGGCCGGAGTGCAGTGG - Intergenic
1079189274 11:18264646-18264668 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
1079243063 11:18734355-18734377 GTCACTCAGCTGGAGTGCAGTGG + Intronic
1079253310 11:18804089-18804111 TTCCCCTAGCTGGAGTGCAGTGG + Intergenic
1079571784 11:21952526-21952548 TTTCCTCAGGCAGAGAGAAGGGG - Intergenic
1080638150 11:34141210-34141232 TAACCTCAGCCTGAGGGCAGGGG + Intronic
1080696111 11:34604188-34604210 TTGCCCCAGCCGGAGTGCAGTGG - Intergenic
1081220223 11:40451423-40451445 TTGCCTGGGCCGGAGTGCAGTGG + Intronic
1082065744 11:47898845-47898867 GTCACTCAGCTGGAGTGCAGTGG + Intergenic
1082068572 11:47920311-47920333 ATCCCCCAGCTGGAGTGCAGTGG - Intergenic
1082818432 11:57526502-57526524 TTCCCCCAGTCCTAGAGCAGTGG + Intergenic
1083169053 11:60911575-60911597 GTCACCCAGCTGGAGAGCAGTGG + Intergenic
1083586747 11:63865276-63865298 TCACCTCAGCTGGAGTGCAGTGG + Intronic
1083783542 11:64930911-64930933 TTGCCTCAGCTGGAGAGCAGTGG + Intronic
1084159482 11:67338293-67338315 TCTCCTGAGCTGGAGAGCAGTGG - Intronic
1084340944 11:68500515-68500537 TTGCCCAAGCCGGAGTGCAGTGG + Intronic
1084435986 11:69140295-69140317 TTACCTGGGCCGGAGTGCAGTGG + Intergenic
1084619307 11:70258101-70258123 TTCCCCAAGCTGGAGTGCAGTGG + Intergenic
1084893336 11:72248031-72248053 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
1085075471 11:73587450-73587472 TCACCTCAGCTGGAGTGCAGTGG - Intronic
1085080034 11:73626249-73626271 TTACCACAGCTGGAGTGCAGTGG - Intergenic
1085188739 11:74599403-74599425 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1085285350 11:75356349-75356371 TCGCCTCAGCTGGAGAGCAGTGG - Intergenic
1085290769 11:75397724-75397746 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1086515532 11:87607871-87607893 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1087050369 11:93880850-93880872 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1087614125 11:100468979-100469001 TTCCCCCGGCTGGAGTGCAGTGG - Intergenic
1087731574 11:101784252-101784274 TTGCCTAGGCCGGAGAGCAGTGG + Intronic
1087837989 11:102894017-102894039 TTGCCTCAGCTGGAGTGCAGTGG + Intergenic
1088254289 11:107888510-107888532 GTCCCCAAGCCGGAGAGCAGTGG + Intronic
1088290558 11:108232577-108232599 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1088638082 11:111844040-111844062 GTCGCTCAGCTGGAGTGCAGCGG + Intronic
1089037957 11:115415783-115415805 TTGCCTGAGCTGGAGTGCAGTGG - Intronic
1089151781 11:116369960-116369982 TTCCCTAAGCAGGAGGGCAGAGG - Intergenic
1089993353 11:122882668-122882690 TTCCCAGCGCCGGAGGGCAGAGG - Exonic
1090019077 11:123111177-123111199 GTGCCTCAGCTGGAGTGCAGTGG + Intronic
1090491696 11:127168776-127168798 TTGCCCCAGCTGGAGTGCAGGGG - Intergenic
1090639263 11:128716637-128716659 TTCCATCAGGAGCAGAGCAGCGG - Intronic
1090736087 11:129613293-129613315 TTTCCACAGCCACAGAGCAGTGG + Intergenic
1090846429 11:130533579-130533601 TTCCCTCAGCTATGGAGCAGAGG - Intergenic
1090853172 11:130588380-130588402 TTGCCTCAGTTGGAGTGCAGTGG + Intergenic
1091292106 11:134446637-134446659 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1091661831 12:2389952-2389974 TTTCCTCAGCCTGGGAGTAGAGG - Intronic
1091696046 12:2628822-2628844 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1092179404 12:6435088-6435110 TTCCCTCATCTGGTGAGCAAGGG + Intergenic
1092366379 12:7880433-7880455 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1092617504 12:10228923-10228945 TTGCCTCGGCTGGAGTGCAGTGG - Intergenic
1092758222 12:11784736-11784758 TTGCCTCGGCTGGAGTGCAGTGG + Intronic
1093741553 12:22694427-22694449 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
1094624813 12:32113581-32113603 TTTCCCCAGCTGGAGTGCAGTGG + Intronic
1094740604 12:33283818-33283840 TTCACCAAGCCGGAGTGCAGTGG - Intergenic
1095253597 12:40007132-40007154 TTCTCTCAGCCACAGAGCAAAGG - Intronic
1095304887 12:40627172-40627194 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1095452544 12:42348148-42348170 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1095995481 12:48079457-48079479 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1096068980 12:48764020-48764042 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1096232907 12:49906716-49906738 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1096270475 12:50162641-50162663 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1096412170 12:51385026-51385048 TTCCTTAAGCTGGAGTGCAGTGG + Intronic
1096585272 12:52615820-52615842 TTCCCTGTGGCAGAGAGCAGCGG + Intronic
1096682182 12:53263477-53263499 GTCACTCAGGCGGAGTGCAGTGG + Intergenic
1096711300 12:53458343-53458365 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1097080342 12:56425833-56425855 TTACCTAAGCTGGAGTGCAGTGG - Intronic
1097866202 12:64561149-64561171 TCCCTGCAGCCGGAGAGCTGAGG + Intergenic
1098276408 12:68816410-68816432 TTGCTTAAGCCGGAGTGCAGTGG + Intronic
1098567971 12:71956647-71956669 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
1098833491 12:75391427-75391449 ATCCTTCAGCCTCAGAGCAGTGG - Intronic
1098888316 12:75982804-75982826 TTCACTCTGCTGGAGTGCAGTGG + Intergenic
1098992896 12:77084755-77084777 TTGCCAAAGCTGGAGAGCAGTGG - Intergenic
1100195509 12:92240262-92240284 TTGCCCAAGCCGGAGTGCAGCGG + Intergenic
1100798833 12:98210365-98210387 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1100851617 12:98718270-98718292 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1101118582 12:101555654-101555676 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1101132974 12:101708645-101708667 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1101813095 12:108124512-108124534 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1102137377 12:110586590-110586612 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1102391479 12:112552281-112552303 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1102504664 12:113376201-113376223 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1103104435 12:118210776-118210798 TTGCCCCGGCTGGAGAGCAGTGG + Intronic
1103134479 12:118496038-118496060 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
1103312699 12:120024239-120024261 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1103319555 12:120083697-120083719 TTGCCTAGGCTGGAGAGCAGTGG + Intronic
1103674033 12:122641706-122641728 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1103785977 12:123433452-123433474 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1103809956 12:123605370-123605392 TTCCCTCAGGGGTTGAGCAGGGG + Intronic
1104214468 12:126722605-126722627 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1104526434 12:129527267-129527289 TTGCCCAAGCCGGAGTGCAGTGG - Intronic
1104829594 12:131741010-131741032 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1105034064 12:132905531-132905553 TTCCCCCGGCTGGAGTGCAGTGG - Intronic
1105212419 13:18264961-18264983 TTCCCTCAGACAGGAAGCAGAGG + Intergenic
1105391774 13:19986155-19986177 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1105453774 13:20522954-20522976 ATCCCCCAGCTGGAGTGCAGTGG + Intronic
1105531936 13:21228459-21228481 GTCCCTGAGAGGGAGAGCAGTGG - Intergenic
1105568073 13:21571656-21571678 TTGCCCAAGCCGGAGTGCAGTGG - Intronic
1105818739 13:24060997-24061019 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1106167141 13:27257858-27257880 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1107847636 13:44533418-44533440 TTACCTAAGCTGGAGTGCAGTGG - Intronic
1107861450 13:44664983-44665005 GTCGCTCAGGCTGAGAGCAGTGG + Intergenic
1107866027 13:44704174-44704196 TCACCTGAGCTGGAGAGCAGTGG + Intergenic
1108752513 13:53462701-53462723 TTCTCCCAGCTGGAGTGCAGTGG - Intergenic
1108801732 13:54104811-54104833 TCCCCCCAGCTGGAGTGCAGTGG - Intergenic
1108836828 13:54561298-54561320 TCCCCTCGGCTGGAGCGCAGTGG + Intergenic
1108914772 13:55593490-55593512 GTCACTCAGCTGGAGCGCAGTGG + Intergenic
1109451325 13:62518493-62518515 TCACCTCGGCCGGAGTGCAGTGG - Intergenic
1109778932 13:67081526-67081548 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1109818768 13:67623682-67623704 TTCCCTCAGACGGTGGGGAGGGG - Intergenic
1110077835 13:71271707-71271729 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
1110294629 13:73849337-73849359 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
1110428163 13:75392673-75392695 TTCCCCCAGCTGGAGTGCAGTGG + Intronic
1110508756 13:76323358-76323380 TTGCCTCAGCTGGAGTGCAGTGG + Intergenic
1111129280 13:83953508-83953530 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1111147103 13:84196534-84196556 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1111731851 13:92086696-92086718 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1112127256 13:96481663-96481685 GTCCCTGAGCTGGAGAGCGGAGG - Intronic
1112419281 13:99233150-99233172 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1113515803 13:110897164-110897186 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1114041872 14:18686339-18686361 TTCCCCAGGCCGGAGTGCAGTGG + Intergenic
1114441508 14:22751981-22752003 TTCCCCAAGCCAGAGTGCAGTGG + Intergenic
1114469342 14:22948573-22948595 TCACCTCGGCCGGAGTGCAGTGG + Intronic
1115257088 14:31414878-31414900 TCGCCCCAGCTGGAGAGCAGTGG + Intronic
1115598108 14:34928796-34928818 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1115649024 14:35390062-35390084 TCCCCCCAGCTGGAGTGCAGTGG + Intergenic
1115691934 14:35853451-35853473 GTCTCTCAGCTGGAGTGCAGTGG + Intronic
1116418260 14:44704564-44704586 TTGCCTCGGCTGGAGTGCAGTGG - Intergenic
1117225505 14:53654145-53654167 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1117417118 14:55507469-55507491 TTCCCTCTGCCGGGGAGGACTGG - Intergenic
1117665195 14:58049197-58049219 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1117896280 14:60490582-60490604 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1117957274 14:61132230-61132252 TGCCATCACCCTGAGAGCAGGGG - Intergenic
1118286241 14:64476363-64476385 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1118407809 14:65443678-65443700 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1118801654 14:69195253-69195275 GTCACTCAGCTGGAGTGCAGTGG + Intronic
1118954440 14:70467192-70467214 TTCACTCAGCTGGAGTGCAGTGG + Intergenic
1119275391 14:73350585-73350607 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1119371877 14:74152918-74152940 TTGCCCCAGCTGGAGGGCAGTGG - Intronic
1119600171 14:75970517-75970539 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1119813358 14:77543087-77543109 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
1120046120 14:79808195-79808217 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
1120186870 14:81402523-81402545 TACCCTAAGCCGGAAAGGAGGGG + Intronic
1120262611 14:82205909-82205931 TTCGCCCAGCTGGAGTGCAGTGG + Intergenic
1120337815 14:83180658-83180680 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1120531234 14:85633758-85633780 TTGCCTAAGCTGGAGTGCAGTGG - Exonic
1120990969 14:90377041-90377063 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
1121101405 14:91253023-91253045 GTCCCCCAGCTGGAGAACAGGGG - Intronic
1121403746 14:93705195-93705217 TTGCCTAAGCTGGAGCGCAGTGG - Intronic
1122109536 14:99487502-99487524 TTCTCACTGCCGCAGAGCAGTGG - Intronic
1122726838 14:103761232-103761254 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1123194589 14:106604350-106604372 TCCCATCAGCTGCAGAGCAGTGG - Intergenic
1123222550 14:106870665-106870687 TCCCATCAGCTGCAGAGCAGTGG - Intergenic
1202839174 14_GL000009v2_random:104980-105002 TTTCCTAAGCTGGAGCGCAGTGG - Intergenic
1202908554 14_GL000194v1_random:95133-95155 TTTCCTAAGCTGGAGCGCAGTGG - Intergenic
1202873569 14_GL000225v1_random:188092-188114 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
1123474152 15:20576960-20576982 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1123643858 15:22423393-22423415 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1123670345 15:22650463-22650485 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1123734453 15:23171972-23171994 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1123755251 15:23392911-23392933 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1124284959 15:28393280-28393302 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1124297738 15:28518334-28518356 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1124378564 15:29144688-29144710 TCCCCCCAGCTGGAGTGCAGAGG - Intronic
1124439483 15:29675836-29675858 CACCCTCAGCCGTAGAGCTGGGG + Intergenic
1125149852 15:36519317-36519339 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
1126003991 15:44239494-44239516 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
1126046765 15:44649236-44649258 TTGCCTAGGCCGGAGGGCAGTGG + Intronic
1126148596 15:45501538-45501560 TCCCCTAAGCTGGAGGGCAGTGG + Intronic
1126758378 15:51946593-51946615 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1127277590 15:57460951-57460973 TTCCCTCAGCCAGAGAGATGTGG - Intronic
1127443895 15:59040152-59040174 TTGCCTAGGCTGGAGAGCAGTGG + Intronic
1127678201 15:61265327-61265349 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1127786911 15:62363838-62363860 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1127817071 15:62620516-62620538 TTGCCTAAGCTGGAGCGCAGTGG + Intronic
1127976316 15:63999803-63999825 TTGCCCCAGCTGGAGTGCAGAGG + Intronic
1128214350 15:65924105-65924127 TACCAGCAGCAGGAGAGCAGTGG + Intronic
1128226495 15:66005056-66005078 TTGCCCCAGATGGAGAGCAGAGG - Intronic
1128342745 15:66834157-66834179 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1128594450 15:68930872-68930894 TTCCCTGACCAGGAGAGGAGAGG - Intronic
1128805869 15:70530944-70530966 TTCCCTCAGCCAGCGGGCATTGG + Intergenic
1128829765 15:70756831-70756853 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1128950221 15:71871642-71871664 TTACCTAAGCTGGAGTGCAGTGG - Intronic
1129217262 15:74107478-74107500 GTCCCCCAGCCAGAGGGCAGGGG + Intronic
1129235833 15:74223214-74223236 TCCCCTCACCAGGAGAGCAGAGG - Intergenic
1129292050 15:74575934-74575956 TTGCCTCAGCTGGAGTGCAGTGG + Intronic
1129371770 15:75100972-75100994 TTGCCTAAGCTGGAGGGCAGTGG + Intronic
1130509127 15:84573795-84573817 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
1131009710 15:89006928-89006950 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1131068228 15:89447921-89447943 GTCCCCCAGCCGGTGAGCAGTGG + Intergenic
1131492875 15:92878125-92878147 TTGCCTAAGCTGGAGGGCAGTGG + Intergenic
1131704162 15:94974693-94974715 TCGCCTCAGCTGGAGTGCAGTGG + Intergenic
1132081290 15:98868145-98868167 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1132562595 16:604091-604113 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1132841599 16:1980794-1980816 GTCCCTCACCCGGATGGCAGGGG + Exonic
1132967840 16:2669230-2669252 TTCCCTCAGTCGGAAACCAAGGG + Intergenic
1133569975 16:7031559-7031581 TTGCCTCGGCTGGAGTGCAGTGG - Intronic
1133636685 16:7673076-7673098 TTCCTTCAGCTGGAGTGCATAGG - Intronic
1133727478 16:8550875-8550897 TTCTCTCAGGAGGAGAGCAGTGG - Intergenic
1134063840 16:11214177-11214199 CTCCCTCATCTGGAGTGCAGTGG - Intergenic
1134078681 16:11309796-11309818 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1134132627 16:11659805-11659827 GTCACCCAGCTGGAGAGCAGTGG + Intergenic
1134361413 16:13534262-13534284 TTGCCTGAGCTGGAGTGCAGTGG + Intergenic
1134630328 16:15751650-15751672 GTCGCCCAGCTGGAGAGCAGTGG + Intronic
1135285346 16:21188341-21188363 TTCCATCAGCTGAAGAGTAGGGG - Intergenic
1135591435 16:23707671-23707693 TTGCCTCGGCTGGAGTGCAGTGG - Intronic
1135659952 16:24287476-24287498 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1135709057 16:24699677-24699699 TTGCCTGGGCCGGAGTGCAGTGG - Intergenic
1135958501 16:26976508-26976530 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1136006022 16:27329635-27329657 TTCCCCAAGCTGGAGAGCAGTGG - Intronic
1136085664 16:27883077-27883099 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1136161777 16:28424699-28424721 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1136201189 16:28690293-28690315 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1136217532 16:28804482-28804504 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1136231190 16:28886457-28886479 CTCCCTCACCCTAAGAGCAGGGG - Intronic
1136241000 16:28943988-28944010 ATCCCCCAGCTGGGGAGCAGGGG - Intergenic
1136310642 16:29407007-29407029 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1136498307 16:30657359-30657381 TTCCCTAAGCTGGAGTGCAGTGG - Intergenic
1136578845 16:31140149-31140171 GTCCCCCAGCTGGAGTGCAGTGG - Intronic
1137640291 16:50023164-50023186 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1137695225 16:50457169-50457191 TTGCCTAAGCTGGAGAGCAGTGG + Intergenic
1138843868 16:60540982-60541004 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1139508623 16:67413117-67413139 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1139758935 16:69168586-69168608 TTGCCTAGGCAGGAGAGCAGTGG - Intronic
1139772666 16:69291667-69291689 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1139836944 16:69846679-69846701 ATCACTCAGCTGGAGTGCAGTGG - Intronic
1139984547 16:70887721-70887743 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1140350710 16:74259745-74259767 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
1141318199 16:82981482-82981504 TTACCCCAGGAGGAGAGCAGAGG - Intronic
1141499456 16:84433610-84433632 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1142073690 16:88105181-88105203 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1142159780 16:88551149-88551171 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1142333731 16:89473138-89473160 TTGCCTCGGCTGGAGGGCAGTGG - Intronic
1142370743 16:89679939-89679961 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1142436795 16:90064756-90064778 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1142453932 16:90204848-90204870 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1142783606 17:2201982-2202004 TTGCCCCAGCTGGAGTGCAGCGG - Intronic
1143118667 17:4594407-4594429 TTACCTAGGCTGGAGAGCAGTGG - Intronic
1143201296 17:5115509-5115531 TTGCCCAAGCCGGAGTGCAGTGG - Intronic
1143538262 17:7554657-7554679 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1143824320 17:9591836-9591858 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1143956528 17:10674384-10674406 TTGCCTAGGCTGGAGAGCAGTGG - Exonic
1144173759 17:12684804-12684826 TTTCCCCAGCTGGAGTGCAGTGG - Intronic
1144279783 17:13713876-13713898 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1144468968 17:15519860-15519882 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1144590809 17:16522050-16522072 TTACCCCAGCTGGAGTGCAGTGG - Intergenic
1144869709 17:18361744-18361766 TTGCCCAGGCCGGAGAGCAGTGG - Intronic
1145892917 17:28430463-28430485 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
1145952380 17:28829252-28829274 TTGCCTCAGCTGGAGTGCAATGG + Intronic
1146300940 17:31688934-31688956 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1146393029 17:32440339-32440361 TTGCCTAGGCTGGAGAGCAGTGG - Intergenic
1146485349 17:33238291-33238313 TTCACTCACCCGGAGAGACGAGG + Intronic
1146619005 17:34382156-34382178 TTCCCCAAGCTGGAGTGCAGTGG + Intergenic
1146774410 17:35599868-35599890 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1146862593 17:36317267-36317289 TTACCCAAGCCGGAGTGCAGTGG + Intronic
1147092921 17:38121364-38121386 TTACCCAAGCCGGAGTGCAGTGG + Intergenic
1147104287 17:38199124-38199146 TTACCCAAGCCGGAGTGCAGTGG - Intergenic
1147185633 17:38711793-38711815 TTCCCTAAGCCCGTGAGAAGAGG + Intronic
1147328600 17:39683034-39683056 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1147530972 17:41276809-41276831 TTTCCTCAGCTGGAAAGTAGAGG - Intergenic
1147549593 17:41430337-41430359 TTGCCCAAGCTGGAGAGCAGTGG + Intergenic
1147858615 17:43502462-43502484 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1147954593 17:44125236-44125258 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1148388519 17:47253777-47253799 TTCCCGCAGCGGGAGGGGAGGGG - Intergenic
1148544979 17:48511389-48511411 TTGCCTCAGCTGGAGTGTAGTGG + Intergenic
1148584167 17:48765574-48765596 TTGCCTAGGCTGGAGAGCAGTGG + Intronic
1148614303 17:48988162-48988184 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1148651107 17:49250613-49250635 TTGCCTGGGCCGGAGTGCAGTGG - Intergenic
1148723399 17:49771165-49771187 TTGCCTGGGCCGGAGTGCAGTGG - Intronic
1148738219 17:49876792-49876814 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1149899341 17:60459530-60459552 TTGCCTAGGCTGGAGAGCAGTGG + Intronic
1150129480 17:62659504-62659526 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1150167848 17:62962055-62962077 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1150188282 17:63209718-63209740 TTCCTTTAGCCCGAGAGCAGTGG - Intronic
1150245779 17:63674038-63674060 TTGCCTAAGCTGGAGCGCAGTGG - Intronic
1150341808 17:64374447-64374469 TTGCCTGAGCTGGAGTGCAGTGG - Intronic
1150424441 17:65066383-65066405 CTTCTTCAGCCAGAGAGCAGAGG + Intergenic
1150562077 17:66302810-66302832 TTGCCTCCGCCGGGGAGCTGCGG - Exonic
1150748361 17:67835467-67835489 TTCACTCAGCCAGAGTGCTGGGG - Intronic
1150801746 17:68288541-68288563 TTCCATCATCCGTAAAGCAGGGG - Intronic
1150827123 17:68486911-68486933 TCACCTCAGCTGGAGTGCAGTGG + Intergenic
1150911890 17:69396670-69396692 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
1150919077 17:69464753-69464775 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1150990877 17:70257695-70257717 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1151255137 17:72871099-72871121 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1151487358 17:74409554-74409576 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1151725754 17:75883154-75883176 TTCCCCCAGCTGGAGTGCAGTGG + Intronic
1151884316 17:76914676-76914698 GTCCCCCAGCTGGAGCGCAGTGG + Intronic
1151899285 17:77001159-77001181 TTCCCCCAGCTGGAGTGCAATGG - Intergenic
1152489920 17:80623935-80623957 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1152821961 17:82441958-82441980 GTCCCTCAACTAGAGAGCAGAGG + Intronic
1152963361 18:94442-94464 TTGCCTGGGCTGGAGAGCAGTGG + Intergenic
1153217365 18:2833120-2833142 GTCGCCCAGCTGGAGAGCAGTGG - Intergenic
1153325737 18:3818397-3818419 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
1153895584 18:9556230-9556252 GTCCCCCAGCTGGAGTGCAGTGG + Intronic
1154366210 18:13711329-13711351 TTCCCCAGGCCGGAGTGCAGTGG - Intronic
1154372793 18:13779858-13779880 TGCCCACAGCTGGAGTGCAGTGG - Intergenic
1154951263 18:21212559-21212581 CTCCCTCGGCTGGAGTGCAGTGG + Intergenic
1154965476 18:21351531-21351553 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
1155045274 18:22097792-22097814 TTACCTCAGAAGCAGAGCAGAGG + Intronic
1155066847 18:22275509-22275531 TTACCCCAGCTGGAGTGCAGTGG - Intergenic
1155324839 18:24655277-24655299 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1155404107 18:25468785-25468807 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1155527359 18:26730858-26730880 TTACCCCAGCTGGAGTGCAGTGG + Intergenic
1155755564 18:29490650-29490672 TTGCCCAAGCCGGAGAGCAGTGG - Intergenic
1156042115 18:32834673-32834695 TTCCCTAAGCCTCAGAGCACAGG - Intergenic
1156272508 18:35549342-35549364 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1156706465 18:39888839-39888861 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1157603652 18:48911936-48911958 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
1158269930 18:55701614-55701636 TTCCCCAGGCTGGAGAGCAGTGG + Intergenic
1158433098 18:57409376-57409398 GTCGCTCAGCTGGAGTGCAGTGG - Intergenic
1158547861 18:58411076-58411098 GTCCCTCAGCTGGAGTGCAGTGG - Intergenic
1158768935 18:60491360-60491382 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1159691563 18:71494823-71494845 CTCCCTCGGCTGGAGTGCAGAGG + Intergenic
1159836490 18:73343034-73343056 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
1161060436 19:2211959-2211981 TTCTCGCAGCAGGTGAGCAGAGG - Intronic
1161110222 19:2465247-2465269 TTGCCCCAGCTGGAGAGCAGTGG + Intergenic
1161187525 19:2931444-2931466 CTCCCCCAGCTGGAGTGCAGTGG - Intergenic
1161377116 19:3945439-3945461 TCACCCCAGCTGGAGAGCAGTGG - Intergenic
1161526941 19:4762005-4762027 TTCCCGGAGCAGGTGAGCAGAGG - Intergenic
1161863259 19:6815185-6815207 TTGCCTGGGCCGGAGTGCAGTGG + Intronic
1161868608 19:6853303-6853325 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1162106399 19:8372431-8372453 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1162233455 19:9285719-9285741 GTCCCTCAGGCAGAGAGCAATGG - Intergenic
1162252142 19:9454668-9454690 TTTCCTCAGTCGGAAACCAGGGG - Intergenic
1162305778 19:9872580-9872602 CTCCCTCAGCCTGAGAACTGGGG + Intronic
1162373255 19:10291164-10291186 TGCCCTCGGCCGGAGCGCGGTGG + Exonic
1162453312 19:10767583-10767605 TTCCACCAGGCCGAGAGCAGTGG - Intronic
1162576343 19:11501216-11501238 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1162582181 19:11538229-11538251 TCCCCTCGGCTGGAGTGCAGTGG - Intergenic
1162697593 19:12488325-12488347 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1163028591 19:14528901-14528923 GTCCCCCAGCTGGAGTGCAGTGG - Intronic
1163106681 19:15127217-15127239 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1163119362 19:15207706-15207728 TTCCCTAGGCCGGAGTGCAGTGG + Intergenic
1163165583 19:15495600-15495622 TTGCCTAAGCAGGAGCGCAGTGG + Intronic
1163174303 19:15553246-15553268 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1163247829 19:16108234-16108256 TTGCCTAGGCCGGAGTGCAGTGG - Intergenic
1163592742 19:18203676-18203698 CCCCCTCCGCCGCAGAGCAGGGG + Intronic
1163723724 19:18910792-18910814 TTCCCTCACCTGCACAGCAGTGG - Intronic
1163835672 19:19571991-19572013 TCCCCCCAGCTGGAGTGCAGTGG - Intronic
1164084536 19:21889225-21889247 TTCCCTCAGTCGGAAACCAAGGG + Intergenic
1164087585 19:21917816-21917838 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1164791823 19:30992662-30992684 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1165033275 19:33013912-33013934 TTGCCTCGGCTGGAGTGCAGTGG + Intronic
1165051961 19:33147561-33147583 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1165161179 19:33817378-33817400 TGCCCTCACCTGGAGATCAGGGG + Intergenic
1165162894 19:33828450-33828472 TTTCCTGAGCTTGAGAGCAGTGG + Intergenic
1165179397 19:33954758-33954780 TTTCCCCAGCTGGAGTGCAGTGG - Intergenic
1165536546 19:36451965-36451987 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1165611673 19:37159207-37159229 TTGCCTCGGCTGGAGTGCAGTGG - Intronic
1165731267 19:38147099-38147121 TTGCCCAAGCCGGAGTGCAGTGG + Intronic
1165854786 19:38873026-38873048 GTCGCTCAGGCGGAGTGCAGTGG - Intronic
1166085253 19:40470343-40470365 TTGCCCAAGCCGGAGTGCAGTGG + Intronic
1166462830 19:43004367-43004389 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1166468965 19:43060826-43060848 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1166480105 19:43164345-43164367 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1166640555 19:44491608-44491630 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1166696259 19:44853234-44853256 TCCCCCCAGCTGGAGTGCAGTGG + Intronic
1166874554 19:45889662-45889684 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1166877112 19:45903969-45903991 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
1167136482 19:47619295-47619317 TCCCCTAGGCCGGAGTGCAGTGG + Intronic
1167136898 19:47622004-47622026 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1167296959 19:48656432-48656454 TTGCCCAAGCTGGAGAGCAGTGG + Intergenic
1167324895 19:48818386-48818408 TTCCCTGAGGAGGAGGGCAGAGG - Intronic
1167654522 19:50754868-50754890 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1167725786 19:51211867-51211889 TGCCCTCGGCCTGTGAGCAGGGG + Intergenic
1167908531 19:52682626-52682648 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1168036332 19:53722631-53722653 TTTCCCCAGCTGGAGAGCGGTGG + Intergenic
1168352028 19:55681315-55681337 TTCCCTCATCTGGAAAACAGAGG - Intronic
1168443064 19:56388670-56388692 TTGCCCCAGCTGGAGCGCAGTGG + Intronic
1168514665 19:57001502-57001524 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1168545477 19:57246211-57246233 TTGCCTCGGCTGGAGTGCAGTGG + Intronic
1168572372 19:57482144-57482166 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1168676907 19:58285189-58285211 TCGCCTCAGCTGGAGTGCAGTGG + Intronic
926105363 2:10146435-10146457 TTCCCTATTCCGCAGAGCAGAGG - Intronic
926114183 2:10201107-10201129 TTCCCCAGGCTGGAGAGCAGTGG - Intronic
926196183 2:10764929-10764951 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
926242403 2:11098702-11098724 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
927798102 2:26069743-26069765 TTGCCCCGGCTGGAGAGCAGTGG + Intronic
927989592 2:27438138-27438160 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
928013836 2:27635775-27635797 TGCCCCAAGCCGGAGTGCAGTGG - Intronic
928397533 2:30954398-30954420 TTGCCTCAGCTGGAGTGCAATGG + Intronic
928941927 2:36735119-36735141 TTGCCCCGGCTGGAGAGCAGTGG - Intronic
929126870 2:38530153-38530175 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
929140356 2:38661684-38661706 TCACCTCAGCTGGAGTGCAGTGG + Intergenic
929161484 2:38836890-38836912 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
929493347 2:42417201-42417223 TTGCCCAGGCCGGAGAGCAGTGG - Intronic
929547473 2:42864997-42865019 TTGCCCAAGCTGGAGAGCAGTGG + Intergenic
929587212 2:43124087-43124109 TGCACTCAGCTGGGGAGCAGGGG + Intergenic
929789465 2:45012746-45012768 TTCCATCAGCCTGAGATCACTGG - Intergenic
930077017 2:47414638-47414660 TTCCCTAGGCCAGAGTGCAGTGG + Intronic
930160157 2:48146603-48146625 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
930259453 2:49127930-49127952 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
930563037 2:52984669-52984691 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
930866657 2:56128806-56128828 TTACCTGGGCCGGAGGGCAGTGG + Intergenic
932210331 2:69922838-69922860 TTGCCCAAGCCGGAGTGCAGTGG - Intronic
933174594 2:79160755-79160777 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
933410230 2:81916231-81916253 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
933712514 2:85337292-85337314 TTGCCTAAGCTGGAGGGCAGCGG - Intergenic
933840382 2:86281586-86281608 TTGCCTGGGCTGGAGAGCAGTGG - Intronic
934301205 2:91777441-91777463 TTCCCTCAGACAGGAAGCAGAGG - Intergenic
935071942 2:99702377-99702399 GTCACTCAGCTGGAGTGCAGTGG + Intronic
935096507 2:99949389-99949411 TTCCATAAACTGGAGAGCAGGGG + Intronic
935215443 2:100971979-100972001 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
935263653 2:101376315-101376337 TTGCCCAAGCCGGAGTGCAGTGG + Intronic
935347183 2:102118976-102118998 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
935433662 2:103004754-103004776 TTGCCTAAGACAGAGAGCAGGGG + Intergenic
935657293 2:105434526-105434548 TTGCCCAAGCCGGAGTGCAGTGG - Intronic
935830166 2:106994071-106994093 TTGACTCAGCTGGGGAGCAGAGG + Intergenic
935910508 2:107891265-107891287 TTCCCCGAGCTGGAGTGCAGTGG - Intergenic
935961197 2:108427275-108427297 TTACCCCAGCTGGAGTGCAGTGG - Intergenic
935968633 2:108508104-108508126 TTCCCCGAGCTGGAGTGCAGTGG - Exonic
935987316 2:108687734-108687756 TGCCCTCAGCTGGAGTGCAATGG + Intergenic
936132300 2:109856408-109856430 TTCCCCGAGCTGGAGTGCAGTGG - Exonic
936212397 2:110515077-110515099 TTCCCCGAGCTGGAGTGCAGTGG + Exonic
936259485 2:110946857-110946879 TTCTCTCAGCTGGACAACAGGGG - Intronic
936369618 2:111892795-111892817 TCACCCCAGCCGGAGTGCAGTGG + Intergenic
936421537 2:112369644-112369666 TTCCCCGAGCTGGAGTGCAGTGG + Intergenic
936528886 2:113261333-113261355 TGCCCTCAGCCGGGGAACAGAGG + Intronic
936608005 2:113976786-113976808 CTGCCTCAGCTGAAGAGCAGAGG - Intergenic
937387844 2:121453253-121453275 TTCCCTAAACTGGAGTGCAGTGG - Intronic
937416775 2:121721148-121721170 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
938090773 2:128433222-128433244 TTCCCCAAGCTGGAGTGCAGTGG + Intergenic
938848014 2:135231746-135231768 TTGCCTCAGCTGAAGTGCAGTGG - Intronic
938869164 2:135455629-135455651 TCCCCTAGGCCGGAGTGCAGTGG + Intronic
939079840 2:137646610-137646632 TTACCTAAGCTGGAGTGCAGTGG - Intronic
939432967 2:142133975-142133997 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
939819329 2:146937180-146937202 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
939910327 2:147974593-147974615 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
939963725 2:148590149-148590171 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
940300277 2:152169891-152169913 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
940790031 2:158022417-158022439 TTCCCTGGGCTGGAGTGCAGTGG - Intronic
941060189 2:160838199-160838221 TTTCCTCAGCCAGAAATCAGGGG + Intergenic
941793660 2:169577499-169577521 TTCCCTCAACCAAAGAGCCGTGG + Intergenic
941835858 2:170019813-170019835 GTCACTCAGCTGGAGTGCAGTGG + Intronic
942645107 2:178102164-178102186 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
943033395 2:182712594-182712616 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
943082558 2:183273388-183273410 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
944145629 2:196504254-196504276 ATCCCCCAGCTGGAGTGCAGTGG - Intronic
944308492 2:198205309-198205331 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
944560361 2:200929868-200929890 TTCACTCTGCTGGATAGCAGGGG + Intronic
944572663 2:201060002-201060024 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
944674148 2:202021005-202021027 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
944808292 2:203303835-203303857 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
945293387 2:208147068-208147090 ATCCCTGAGCCCTAGAGCAGAGG + Intergenic
946256839 2:218448522-218448544 TTCCCCAGGCTGGAGAGCAGTGG - Intronic
946357896 2:219200245-219200267 TTGCCTCGGCTGGAGTGCAGTGG - Intronic
946652250 2:221906042-221906064 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
946721609 2:222614797-222614819 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
946798088 2:223378051-223378073 GTCACTCAGCTGGAGTGCAGTGG - Intergenic
946914619 2:224505175-224505197 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
947447563 2:230175981-230176003 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
947607297 2:231496001-231496023 TCCCCTCGGCTGGAGTGCAGTGG + Intergenic
947775082 2:232702105-232702127 TTCCCTCAGCTGGAGTGTAGTGG - Intronic
948405023 2:237711031-237711053 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
948908552 2:240991633-240991655 TCCCCTCCGGCAGAGAGCAGGGG + Intronic
948986382 2:241527207-241527229 CCACCTCAGCCGGAGTGCAGTGG + Intergenic
949085384 2:242149511-242149533 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1168787157 20:549605-549627 GTCACTCAGCTGGAGTGCAGTGG - Intergenic
1168958799 20:1854152-1854174 TTCCCCAGGCTGGAGAGCAGTGG + Intergenic
1169033582 20:2432086-2432108 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1169456546 20:5757640-5757662 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1169546062 20:6652163-6652185 TTGCCTGGGCTGGAGAGCAGTGG - Intergenic
1169903595 20:10577679-10577701 TTGCCTCAGCTGGAGTACAGTGG - Intronic
1170988870 20:21284061-21284083 GCCCCTGAGCTGGAGAGCAGTGG + Intergenic
1172053032 20:32133844-32133866 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1172078977 20:32323836-32323858 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1172132751 20:32666425-32666447 TTGCCCAAGCCGGAGTGCAGTGG - Intergenic
1172198296 20:33107162-33107184 TTGCCCCAGCTGGAGCGCAGAGG - Intronic
1172253120 20:33493921-33493943 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1172293941 20:33794818-33794840 TCCCCCAAGCTGGAGAGCAGTGG - Intergenic
1172415219 20:34760235-34760257 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1172517570 20:35545525-35545547 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1172697197 20:36831087-36831109 TTCCCTCAACCAGCCAGCAGGGG - Intronic
1173097059 20:40044320-40044342 TTCCTTGAGCTGGAGAGCTGGGG - Intergenic
1173862353 20:46292310-46292332 TCAGCTCAGCTGGAGAGCAGAGG - Intronic
1174018908 20:47513127-47513149 TTTCCCCAGCTGGAGTGCAGTGG - Intronic
1174813392 20:53666328-53666350 TTGCCTGAGCTGGAGTGCAGTGG + Intergenic
1175055492 20:56193868-56193890 GTCACCCAGCCGGAGTGCAGTGG + Intergenic
1175140429 20:56856770-56856792 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1175142438 20:56870941-56870963 TTCCCTAGGCTGGAGGGCAGTGG - Intergenic
1175725667 20:61316753-61316775 TCCCCTCACCCGAAAAGCAGAGG - Intronic
1176012683 20:62908017-62908039 TTGCCCAGGCCGGAGAGCAGTGG + Intronic
1176055450 20:63143828-63143850 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
1176627912 21:9109786-9109808 TTTCCTAAGCTGGAGCGCAGTGG - Intergenic
1177148153 21:17428622-17428644 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1177527165 21:22309211-22309233 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1177830301 21:26131187-26131209 TTACCTGGGCCGGAGTGCAGTGG - Intronic
1177990238 21:28028210-28028232 TTCCCTCATGGGAAGAGCAGAGG + Intergenic
1178311446 21:31533279-31533301 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1179177387 21:39018670-39018692 TTGCCTCAGTTGGAGTGCAGTGG - Intergenic
1179233945 21:39528803-39528825 TTGGCTCAGCCGGATAGGAGAGG - Intergenic
1179493195 21:41754961-41754983 TGCCCTCATCCTCAGAGCAGAGG - Intronic
1180020751 21:45124835-45124857 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1180379243 22:12123625-12123647 TTTCCTAAGCTGGAGTGCAGTGG + Intergenic
1180679358 22:17614308-17614330 TTCCCTAAGCTAGAGTGCAGTGG - Intronic
1180694174 22:17741511-17741533 TTCCCCAAGCTGGAGTGCAGTGG + Intronic
1180815234 22:18785280-18785302 TTCCCTCAGACAGGAAGCAGAGG + Intergenic
1180927197 22:19564143-19564165 GTCACTCAGCTGGAGTGCAGTGG + Intergenic
1181069664 22:20325351-20325373 GTCACTCAGCTGGAGTGCAGTGG + Intergenic
1181157821 22:20935564-20935586 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1181201424 22:21219617-21219639 TTCCCTCAGACAGGAAGCAGAGG + Intronic
1181468276 22:23122443-23122465 TGCCCACAGCTGGAGGGCAGGGG + Intronic
1181700323 22:24617346-24617368 TTCCCTCAGACAGGAAGCAGAGG - Intronic
1181790521 22:25262142-25262164 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1181795650 22:25307219-25307241 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
1181826328 22:25519183-25519205 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1181852138 22:25757019-25757041 TTGCCCAAGTCGGAGAGCAGTGG - Intronic
1182089171 22:27582541-27582563 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
1182188369 22:28431936-28431958 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1182915792 22:34029066-34029088 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
1183433220 22:37778466-37778488 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1183544169 22:38446913-38446935 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
1183687854 22:39372168-39372190 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1183894676 22:40958851-40958873 TTGCCTCGGCTGGAGTGCAGTGG + Intronic
1183936467 22:41265302-41265324 GAGCCTCAGCCTGAGAGCAGTGG + Intronic
1183947896 22:41337286-41337308 TTCCCTAAGCTGGAGTGCAGTGG - Intronic
1184585632 22:45446122-45446144 TTGCCTCGGCTGGAGTGCAGTGG - Intergenic
1184758356 22:46530227-46530249 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1184935715 22:47718931-47718953 ATCCCCCAGCTGGAGTGCAGTGG + Intergenic
1185284446 22:49994072-49994094 TTCCCTAACCTGGAGATCAGGGG - Intergenic
1203225490 22_KI270731v1_random:75813-75835 TTCCCTCAGACAGGAAGCAGAGG - Intergenic
1203265340 22_KI270734v1_random:10971-10993 TTCCCTCAGACAGGAAGCAGAGG + Intergenic
949192715 3:1268939-1268961 TTGCCTCGGCTGGAGTGCAGTGG - Intronic
949193756 3:1281502-1281524 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
949447642 3:4152325-4152347 TTGCCCAAGCTGGAGAGCAGTGG + Intronic
949966900 3:9364384-9364406 TTACCCCAGCCGGAGTGCAGTGG + Intronic
950728594 3:14936376-14936398 TTGCCTAGGCTGGAGAGCAGTGG - Intergenic
950760682 3:15221912-15221934 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
951297521 3:20957165-20957187 TTGACTCAGCTGGAGTGCAGTGG - Intergenic
952370830 3:32721097-32721119 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
952719344 3:36516021-36516043 TTGCCCTAGCCAGAGAGCAGTGG + Intronic
952954853 3:38550568-38550590 TTCCGTCAGCAGGCGGGCAGCGG - Exonic
953009387 3:39010417-39010439 TTCCCCAAGCTGGAGTGCAGTGG + Intergenic
953169657 3:40495771-40495793 CTCCCATAGCCGGAGTGCAGTGG + Intergenic
953247263 3:41205634-41205656 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
953405279 3:42656809-42656831 TTCCATCGCCAGGAGAGCAGTGG - Intronic
953997603 3:47532218-47532240 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
954014581 3:47675903-47675925 TTCCCCCGGCTGGAGTGCAGTGG - Intronic
954226440 3:49184666-49184688 TTACCTAGGCCGGAGTGCAGTGG + Intronic
954743468 3:52773072-52773094 GTCACTCAGCTGGAGTGCAGTGG - Intergenic
954899951 3:54010373-54010395 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
955004025 3:54952773-54952795 TGCCCTCAGCTGTAGAACAGAGG + Intronic
955459894 3:59170279-59170301 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
955618481 3:60834823-60834845 TTCCCCAAGCTGGAGGGCAGTGG - Intronic
956433923 3:69214820-69214842 TTCCCTTGGCTGGAGTGCAGTGG - Intronic
956843693 3:73162800-73162822 TCGCCTCAGCTGGAGTGCAGTGG - Intergenic
956856861 3:73283687-73283709 TTACCTAAGCTGGAGTGCAGTGG + Intergenic
957049434 3:75399882-75399904 TTTCCCCAGCTGGAGTGCAGTGG - Intergenic
958424195 3:93962727-93962749 TTCCCTAGGACTGAGAGCAGTGG + Intronic
958429251 3:94018803-94018825 TCCCCTAGGCCGGAGTGCAGTGG + Intronic
959089511 3:101887131-101887153 TTGCCTAGGCTGGAGAGCAGCGG + Intergenic
959114287 3:102157705-102157727 TTACCTAAGCTGGAGTGCAGTGG + Intronic
959375054 3:105579326-105579348 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
959388533 3:105743418-105743440 TTCACCCAGCAGGAGTGCAGTGG - Intronic
959527282 3:107391366-107391388 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
959701407 3:109302491-109302513 TTGCCCAAGCTGGAGAGCAGTGG + Intronic
960710788 3:120525928-120525950 TTCCCCCATCCGAAGAGCAATGG + Intergenic
960819622 3:121715241-121715263 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
961253088 3:125522920-125522942 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
961482300 3:127191874-127191896 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
961577935 3:127853749-127853771 TTGCCCAAGCCGGAGTGCAGTGG - Intergenic
961714608 3:128849851-128849873 TGCACACAGCCGCAGAGCAGGGG - Intergenic
961881751 3:130066358-130066380 TTTCCCCAGCTGGAGTGCAGTGG - Intergenic
962075917 3:132081554-132081576 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
962950775 3:140216431-140216453 TACCCTCTGCTGGAGGGCAGAGG + Intronic
963077886 3:141364635-141364657 TTGCCTCAGCTGGAGTGCAATGG - Intronic
963084260 3:141422220-141422242 TTCACTCAGGGGGACAGCAGAGG + Intronic
963148946 3:142023841-142023863 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
963169526 3:142236795-142236817 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
963411071 3:144928739-144928761 TTCCCTGTGCTGGAGTGCAGTGG + Intergenic
964094593 3:152916852-152916874 TTGCCTCAGCTGGAGTGCAATGG - Intergenic
964686970 3:159405841-159405863 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
964844039 3:161026656-161026678 TTTCCCCAGCAGGAGTGCAGTGG - Intronic
965509127 3:169549011-169549033 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
966181073 3:177189166-177189188 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
966853557 3:184178848-184178870 TTCCCTCAGGAGGAACGCAGTGG + Exonic
967729465 3:192893993-192894015 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
967905675 3:194497686-194497708 TCCCCCCAGGCGGAGTGCAGTGG - Intronic
967989961 3:195123351-195123373 TTCCGTCAGCCGGCCAGGAGAGG - Intronic
968325365 3:197809256-197809278 TTACCCCAGCTGGAGTGCAGTGG - Intronic
968513456 4:1005242-1005264 TGCACTCAGCCAGAGAGCTGGGG + Intergenic
968711652 4:2123763-2123785 TCCCCTAGGCTGGAGAGCAGAGG - Intronic
968748789 4:2375411-2375433 TTCCCCCTGCTGGACAGCAGTGG + Intronic
968796276 4:2707080-2707102 TTGCCTCGGCTGGAGCGCAGTGG - Intronic
968995729 4:3944378-3944400 TTCCCCTAGCTGGAGTGCAGTGG + Intergenic
969118590 4:4889985-4890007 TGCCCTCAGCGGGTGAGCAGAGG + Intergenic
969524989 4:7699773-7699795 CTCCCTCACCAGGACAGCAGTGG - Intronic
969539877 4:7781495-7781517 TTCTGTCAGCAGGAGAGTAGCGG + Exonic
971205521 4:24564025-24564047 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
971216873 4:24670299-24670321 TTCCCTAGGCTGGAGTGCAGAGG - Intergenic
971337098 4:25733558-25733580 GTCACTCAGCTGGAGTGCAGTGG + Intergenic
971751550 4:30656237-30656259 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
971987670 4:33847258-33847280 TTGCCCCAGCTGGAGTGCAGAGG + Intergenic
972507877 4:39738525-39738547 TTACCCAAGCTGGAGAGCAGTGG + Intronic
973056514 4:45666211-45666233 GTCCCCCAGCTGGAGTGCAGTGG + Intergenic
973341113 4:49005597-49005619 TTCCTCCAGCTGGAGTGCAGTGG + Intronic
973910367 4:55573709-55573731 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
974877116 4:67714434-67714456 TTCCCTGAGCCTGGGAGCACAGG + Intergenic
975151139 4:71021960-71021982 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
975775828 4:77786239-77786261 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
976266825 4:83193004-83193026 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
976579336 4:86717226-86717248 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
976675746 4:87700678-87700700 TTGCCTTAGCTGGAGTGCAGTGG - Intergenic
976726548 4:88221227-88221249 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
977239825 4:94555090-94555112 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
977301152 4:95269326-95269348 TTACCCCAGCTGGAGTGCAGTGG + Intronic
977691425 4:99916176-99916198 TTACCCCAGCTGGAGTGCAGTGG + Intronic
978454441 4:108872374-108872396 TTGCCTGAGCTGGAGTGCAGTGG - Intronic
978536938 4:109772616-109772638 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
978762983 4:112375217-112375239 GTCACTCAGCCGGAGTGTAGAGG + Intronic
978790169 4:112654728-112654750 TTGCCTAAGCTGGAAAGCAGTGG - Intronic
980943666 4:139298711-139298733 TTGCCCAGGCCGGAGAGCAGAGG + Intronic
981124815 4:141093324-141093346 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
981741706 4:148009168-148009190 GTCGCTCAGCTGGAGTGCAGTGG + Intronic
981792950 4:148560721-148560743 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
981927833 4:150158818-150158840 TCACCTCAGCTGGAGTGCAGTGG - Intronic
982005765 4:151061461-151061483 TTGCCCCAGCTGGAGAGCAATGG + Intergenic
982250717 4:153403803-153403825 TCACCTCAGCTGGAGTGCAGTGG + Intronic
982453818 4:155584218-155584240 TTACCTAAGCTGGAGTGCAGTGG - Intergenic
983548311 4:168986900-168986922 TTGCCTCGGCTGGAGTGCAGTGG - Intronic
984106782 4:175557816-175557838 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
985042012 4:185900086-185900108 TTGCCTGAGCTGGAGTGCAGTGG - Intronic
985428524 4:189855303-189855325 TCACCTCAGCTGGAGTGCAGTGG - Intergenic
985432455 4:189894092-189894114 TTTCCTAGGCCGGAGTGCAGGGG - Intergenic
1202760862 4_GL000008v2_random:109109-109131 TTTCCTAAGCTGGAGTGCAGTGG + Intergenic
985499846 5:236062-236084 TTGCTTCGGCTGGAGAGCAGTGG + Intronic
986637810 5:9840912-9840934 TTCACCCAGCTGGAGTGCAGTGG + Intergenic
987332531 5:16869823-16869845 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
987568406 5:19624045-19624067 TTCCCCCAGCTAGAGTGCAGTGG + Intronic
987596674 5:20010272-20010294 TCCCCTAAGCTGGAGTGCAGTGG + Intronic
987738206 5:21871685-21871707 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
987850860 5:23352346-23352368 TTCCCCAGGCCGGAGTGCAGTGG - Intergenic
987864248 5:23520002-23520024 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
988470123 5:31530158-31530180 GTCCCTAAGCTGGAGTGCAGTGG + Intronic
988549345 5:32186099-32186121 TTGCCTAAGCTGGAGTGCAGAGG + Intergenic
988654732 5:33197195-33197217 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
989024842 5:37055310-37055332 GTCGCTCAGCTGGAGTGCAGTGG - Intronic
989049552 5:37305831-37305853 TTGCCTGAGCTGGAGTGCAGTGG - Intronic
989381393 5:40812988-40813010 TCCCCCCAGCTGGAGTGCAGTGG + Intergenic
989570154 5:42938421-42938443 TTTCCCAAGCCGGAGTGCAGTGG - Intergenic
989609256 5:43275938-43275960 TTACCTAGGCTGGAGAGCAGTGG + Intronic
989756927 5:44966375-44966397 TTGCCTAGGCTGGAGAGCAGTGG - Intergenic
989800761 5:45535556-45535578 TTCCCTAGGCTGGAGGGCAGTGG - Intronic
990074893 5:51832162-51832184 GTCGCCCAGCCGGAGTGCAGTGG + Intergenic
990169885 5:53036347-53036369 TTCCCTCAGCTGGAAAGCTGAGG + Intronic
990313715 5:54564816-54564838 TTGCCTAGGCTGGAGAGCAGTGG - Intergenic
990418148 5:55606256-55606278 TTGCCTAGGCCGGAGTGCAGTGG - Intergenic
990574486 5:57111234-57111256 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
990885808 5:60591853-60591875 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
992609277 5:78493283-78493305 CTGCTTCAGCCTGAGAGCAGTGG - Intronic
992665167 5:79001200-79001222 TTGCCCCAGCTGGAGTGCAGAGG + Intronic
993898019 5:93561731-93561753 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
994650079 5:102516372-102516394 GTTCCTCAGCTGGAGTGCAGTGG + Intergenic
995469142 5:112481949-112481971 TTCCCTCAGCCATAAAGCACAGG - Intergenic
995604863 5:113842703-113842725 TTACCTCAGGCTGGGAGCAGTGG - Intergenic
995774213 5:115708574-115708596 TTCTCTCACCCGGACAGTAGTGG + Intergenic
996726675 5:126678710-126678732 TTGCCTGAGCAGGAGTGCAGTGG - Intergenic
996732130 5:126726666-126726688 TTACCCCAGCTGGAGTGCAGTGG + Intergenic
996939043 5:128981851-128981873 TCCCCTAAGCTGGAGTGCAGTGG + Intronic
997288815 5:132708240-132708262 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
997330185 5:133054240-133054262 TTCCCTACGCTGGAGTGCAGTGG + Intronic
997524208 5:134541968-134541990 TTCCCTCAGCCAGAGTGAAGGGG + Intronic
997567627 5:134901866-134901888 TTGCCTAAGCTGGAGCGCAGTGG - Intergenic
998333257 5:141347745-141347767 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
998653748 5:144151443-144151465 TTGCCTCGGCTGGAGTGCAGTGG - Intergenic
999080359 5:148837928-148837950 TTGCCTAAGCTGGAGTGCAGAGG + Intergenic
1000015581 5:157272904-157272926 TTCCCCAAGCTGGAGTGCAGTGG + Intronic
1000968624 5:167689468-167689490 TTCCCACAGCCAGAGATCCGAGG + Intronic
1001050353 5:168409009-168409031 TTTCCCCAGCTGGACAGCAGAGG + Intronic
1002057574 5:176607381-176607403 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1002165553 5:177342644-177342666 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
1002388270 5:178887842-178887864 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
1002530727 5:179842991-179843013 GTCCCCCAGCCGGAGTGCAGTGG - Intronic
1002695213 5:181083476-181083498 TTGCCTAGGCTGGAGAGCAGTGG - Intergenic
1002757531 6:176449-176471 TTGCCTCGGCCAGAGTGCAGTGG - Intergenic
1003348184 6:5290758-5290780 TCCCCTAAGCTGGAGTGCAGTGG + Intronic
1003489405 6:6607858-6607880 TTCTGTCAGCTGGAGTGCAGTGG - Intronic
1003545449 6:7054194-7054216 TTGCCTCAGCTGGAGTGCGGCGG - Intergenic
1003927692 6:10892337-10892359 TTACCCCAGCTGGAGTGCAGTGG + Intronic
1004638104 6:17487816-17487838 TTACCTAGGCCGGAGTGCAGTGG + Intronic
1004956653 6:20734907-20734929 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
1005096287 6:22120439-22120461 TTACCTCGGCTGGAGTGCAGTGG + Intergenic
1005958559 6:30681043-30681065 TTGCCCAAGCCGTAGAGCAGTGG - Intronic
1006876138 6:37298583-37298605 TTGCCCAAGCCGGAGTGCAGTGG + Intronic
1006889697 6:37415598-37415620 TCTCCTAAGCTGGAGAGCAGTGG + Intergenic
1007440417 6:41854810-41854832 TTCCCCAAGCTGGAGTGCAGTGG + Intronic
1007672072 6:43563960-43563982 TTGCCTAAGCTGGAGTGCAGGGG + Intronic
1008100709 6:47387958-47387980 TTCCCCAAGCTGGAGTGCAGTGG + Intergenic
1010242410 6:73628529-73628551 TTCCCCAAGCTGGAGAGCAGTGG - Intronic
1010444182 6:75932738-75932760 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1011004390 6:82627149-82627171 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1011270746 6:85577376-85577398 GTCACCCAGCCGGAGTGCAGTGG - Intronic
1011569447 6:88718345-88718367 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
1011914273 6:92483680-92483702 TTCACTCTGCTGGAGTGCAGTGG + Intergenic
1012289062 6:97428431-97428453 GTCACTCAGCTGGAGTGCAGTGG + Intergenic
1012572933 6:100753539-100753561 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1012849745 6:104432172-104432194 TTTCCTAGGCTGGAGAGCAGTGG - Intergenic
1013228993 6:108144461-108144483 TTTCCCCAGCTGGAGTGCAGTGG + Intronic
1013359935 6:109384214-109384236 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1013505595 6:110796968-110796990 TTGCCTCGGCTGGAGTGCAGTGG - Intronic
1013722212 6:113043963-113043985 GTCTCTCAGCTGGAGCGCAGTGG - Intergenic
1014545430 6:122729735-122729757 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1014783505 6:125591666-125591688 TTGCCTCAGCTGGAGTGCAATGG + Intergenic
1015022542 6:128493520-128493542 TTCACCCAGCTGGAGCGCAGTGG - Intronic
1015029626 6:128579627-128579649 TCACCTAAGCCGGAGTGCAGTGG + Intergenic
1015033749 6:128627506-128627528 TTTCCTCAGCCGGAGTGCAGTGG - Intergenic
1016452090 6:144193961-144193983 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
1016495423 6:144656449-144656471 TTGCCCCAGCTGGAGCGCAGTGG + Intronic
1016925293 6:149339327-149339349 GTCACTCAGCTGGAGTGCAGTGG - Intronic
1017046192 6:150349210-150349232 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1017104766 6:150877090-150877112 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
1017506234 6:155071131-155071153 TTGCCTAAGCTGGAGCGCAGTGG - Intronic
1017768924 6:157630025-157630047 TTGCCTCAGCTGGAGTGCAGTGG + Intronic
1018594849 6:165468116-165468138 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1018892869 6:167995355-167995377 TTCCCTCTGCGGGAGAGCCTTGG - Intergenic
1019469341 7:1210273-1210295 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1019507109 7:1397121-1397143 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1019574881 7:1732679-1732701 TTCCCCGAGCCGCAAAGCAGGGG + Intronic
1020027258 7:4907844-4907866 TTGCCCCAGCGGGAGTGCAGTGG + Intronic
1020028751 7:4918521-4918543 TTGCCTTAGCTGGAGTGCAGTGG + Intronic
1020224930 7:6272518-6272540 CTCCCGCAGCCGGCGAGCCGGGG + Exonic
1020282773 7:6658523-6658545 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1020377490 7:7504458-7504480 TTCCCCCAGCTGGAGTACAGTGG - Intronic
1020439018 7:8197504-8197526 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1020886100 7:13820826-13820848 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1021177952 7:17472301-17472323 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1021229179 7:18064739-18064761 TCACCTAGGCCGGAGAGCAGGGG + Intergenic
1021552297 7:21884001-21884023 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1021590981 7:22261584-22261606 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
1021669451 7:23020710-23020732 ACCCCTCACCCAGAGAGCAGAGG + Intergenic
1022007151 7:26276835-26276857 TTGCCTCGGCTGGAGTGCAGTGG + Intergenic
1022717516 7:32912006-32912028 TTGCCTCAGCTGGAGTGCAGTGG + Intergenic
1022827484 7:34030659-34030681 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1023415421 7:39927565-39927587 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1023917652 7:44602135-44602157 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1023985668 7:45093545-45093567 TTGCCCCAGCCGGAGTGCGGTGG + Intergenic
1024653561 7:51429724-51429746 TTGCCCAAGCCGGAGTGCAGTGG - Intergenic
1024662103 7:51506882-51506904 TTGCCCAAGCTGGAGAGCAGTGG + Intergenic
1024689547 7:51784044-51784066 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1025031414 7:55560111-55560133 TTCCCCAGGCCGGAGTGCAGTGG - Intronic
1025735134 7:64140297-64140319 TTACCCAAGCTGGAGAGCAGTGG + Intronic
1025870837 7:65432890-65432912 TTGCCTAGGCTGGAGAGCAGTGG + Intergenic
1025910984 7:65828379-65828401 TTACCTAGGCTGGAGAGCAGTGG - Intergenic
1026022009 7:66715781-66715803 TTACCTAAGCTGGAGTGCAGTGG + Intronic
1026134283 7:67645724-67645746 ATCCCTCAACCTGATAGCAGAGG - Intergenic
1026238667 7:68552291-68552313 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1026482946 7:70794659-70794681 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1026555057 7:71401133-71401155 TTGCCTTAGCTGGAGTGCAGTGG + Intronic
1026718425 7:72809958-72809980 ATCCCCCAGCTGGAGTGCAGTGG - Intronic
1026747287 7:73023293-73023315 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
1026750937 7:73051436-73051458 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
1026754586 7:73079546-73079568 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
1026758238 7:73107579-73107601 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
1026858077 7:73768197-73768219 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1026863502 7:73809157-73809179 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1026886365 7:73950092-73950114 TTACCCCAGCTGGAGTGCAGTGG + Intergenic
1026937224 7:74264822-74264844 TTGCCCAAGCCGGAGTGCAGTGG + Intergenic
1027033390 7:74907880-74907902 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
1027089167 7:75285905-75285927 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
1027092810 7:75313833-75313855 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
1027096453 7:75341800-75341822 TCCCCTAAGCTGGAGTGCAGTGG + Intergenic
1027322892 7:77025889-77025911 TCCCCTAAGCTGGAGTGCAGTGG - Intergenic
1027345170 7:77252107-77252129 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1027612605 7:80380347-80380369 TTGCCTGAGCTGGAGTGCAGTGG + Intronic
1027809952 7:82883808-82883830 TTCCCCAAGCTGGAGTGCAGTGG + Intronic
1029158496 7:98534354-98534376 CTCTGTCAGCTGGAGAGCAGTGG + Intergenic
1029372608 7:100158797-100158819 TTCTCGCAGCCTCAGAGCAGCGG - Intergenic
1029397561 7:100318758-100318780 TCCCCTAAGCTGGAGTGCAGTGG + Intronic
1029427436 7:100504963-100504985 TCTCCTCAGCTGGAGCGCAGTGG - Intergenic
1029472077 7:100760934-100760956 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1029892341 7:103943806-103943828 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
1029995582 7:105005052-105005074 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1030034945 7:105400957-105400979 TTGCCCAAGCCGGAGTGCAGTGG - Intergenic
1030439663 7:109572503-109572525 TTTCCCCAGCTGGAGTGCAGTGG + Intergenic
1030719064 7:112847736-112847758 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
1031549036 7:123085484-123085506 TTTCCCAAGCCGGAGTGCAGTGG + Intergenic
1032308079 7:130755557-130755579 TTGCCACAGCTGGAGTGCAGTGG + Intergenic
1032350861 7:131162071-131162093 TTACCTAGGCCGGAGTGCAGTGG + Intronic
1032362806 7:131271867-131271889 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1032543774 7:132725483-132725505 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1032668572 7:134063049-134063071 TTCCTTCTTCCAGAGAGCAGAGG - Intronic
1032850141 7:135787809-135787831 TTGCCTCGGCTGGAGGGCAGTGG + Intergenic
1033132726 7:138759097-138759119 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1033368459 7:140689005-140689027 TTCCCTGGGCTGGAGTGCAGTGG + Intronic
1034179268 7:149125529-149125551 TACCTTCAGCAGGAGAGCACGGG + Intronic
1034196907 7:149255060-149255082 TTACTTAGGCCGGAGAGCAGGGG + Exonic
1034428974 7:151030898-151030920 TTGCCCCGGCTGGAGAGCAGTGG - Intronic
1034444409 7:151105725-151105747 TTCCCCAGGCCGGAGTGCAGTGG - Intronic
1034645204 7:152640230-152640252 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1034923407 7:155101949-155101971 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1035147489 7:156834561-156834583 TCCCCTAGGCCGGAGAGCAGTGG - Intronic
1035437541 7:158870391-158870413 TTGCCTAGGCCGGAGTGCAGTGG + Intronic
1035963841 8:4168087-4168109 TTTCCCAAGCTGGAGAGCAGTGG - Intronic
1036425788 8:8644224-8644246 TTCACCCAGCTGGAGTGCAGTGG + Intergenic
1036646721 8:10615566-10615588 TTGCCTAGGCTGGAGAGCAGTGG + Intronic
1037400627 8:18492113-18492135 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
1037593154 8:20330386-20330408 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1037598962 8:20377756-20377778 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1037639374 8:20729000-20729022 TTGCCCAAGCCGGAGTGCAGTGG + Intergenic
1037809014 8:22075145-22075167 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1038121965 8:24627293-24627315 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1038599595 8:28926611-28926633 TTGCCCTAGCTGGAGAGCAGTGG + Intronic
1038755885 8:30340321-30340343 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1039060434 8:33567796-33567818 GTCACTCAGCTGGAGTGCAGCGG + Intergenic
1039213019 8:35236649-35236671 TTCCCTCTGCTGGAGTCCAGAGG - Intronic
1039512134 8:38100794-38100816 TTACCTCGGCCGGAGTGCAGCGG + Intergenic
1040424904 8:47275894-47275916 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1041883403 8:62779111-62779133 TTCCCTCTGCTTGAGAGGAGAGG - Intronic
1042271212 8:66957375-66957397 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1042933716 8:74037591-74037613 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1043342984 8:79263998-79264020 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1043865031 8:85364986-85365008 TGCCCACAGAGGGAGAGCAGAGG - Intronic
1044094855 8:88050281-88050303 TTGCCCAAGCCGGAGTGCAGTGG - Intronic
1044930240 8:97245083-97245105 TTTCCTCAGCAGGAATGCAGAGG - Intergenic
1044981335 8:97719451-97719473 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
1045126396 8:99095127-99095149 TTCCCACAGAGGGAGAGAAGTGG - Intronic
1045131627 8:99160609-99160631 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1045988212 8:108275114-108275136 TTTCTTCAGCTGGAGTGCAGTGG - Intronic
1046452559 8:114412850-114412872 TTGCCTAGGCTGGAGAGCAGAGG - Intergenic
1046545123 8:115639787-115639809 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
1046754856 8:117962711-117962733 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1046796381 8:118377356-118377378 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1046931072 8:119842419-119842441 TTGCCTAGGCCAGAGAGCAGTGG + Intronic
1047228410 8:122975657-122975679 TTCCCCCAAGCTGAGAGCAGGGG + Intergenic
1047243537 8:123117273-123117295 TTCACCCAGGCGGAGTGCAGTGG - Intronic
1047271905 8:123368376-123368398 TTCCCCAGGCCGGAGTGCAGTGG - Intronic
1047525178 8:125626855-125626877 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1047740136 8:127800052-127800074 TTTCCTCAGCTGCTGAGCAGGGG + Intergenic
1047747905 8:127858845-127858867 TTGCTTAGGCCGGAGAGCAGTGG + Intergenic
1048008278 8:130436759-130436781 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1048741512 8:137566014-137566036 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1049421689 8:142519423-142519445 TCCACCCAGCTGGAGAGCAGAGG - Intronic
1049512290 8:143034711-143034733 TTGCCTAGGCTGGAGAGCAGTGG - Intergenic
1049570349 8:143367454-143367476 TTCCCCAGGCCGGAGTGCAGTGG - Intergenic
1049880138 8:145056394-145056416 TTCCCTCAGTCGGAAACCAAGGG - Intergenic
1050036607 9:1442802-1442824 TTGCCTCAGTAGGAGTGCAGTGG + Intergenic
1050365445 9:4869470-4869492 TTGCCTAGGCCGGAGTGCAGTGG - Intronic
1050640678 9:7664091-7664113 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1051407147 9:16749658-16749680 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1051765945 9:20523929-20523951 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1051778223 9:20659178-20659200 TTCCCTAGGCTGGAGGGCAGTGG - Intronic
1052749503 9:32474989-32475011 ATCACTCGGCTGGAGAGCAGTGG + Intronic
1052909047 9:33863725-33863747 TTCACTCTGCTGGAGTGCAGTGG + Intronic
1055036173 9:71820910-71820932 TTCCCCAGGCCGGAGTGCAGTGG + Intergenic
1055554816 9:77463218-77463240 TTTCCTCATCCAGAGAGCAAAGG - Intronic
1055610687 9:78021087-78021109 TTACCTAAGCTGGAGTGCAGTGG + Intronic
1056596978 9:88015723-88015745 TTTCCTGGGCTGGAGAGCAGTGG + Intergenic
1058873637 9:109223394-109223416 TTGCCTAAGCTGGAGAACAGTGG - Intronic
1059468606 9:114485972-114485994 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1059713372 9:116889889-116889911 TTGCCTAGGCTGGAGAGCAGTGG - Intronic
1059812721 9:117873949-117873971 TTCACTAAGCCCGAGACCAGTGG - Intergenic
1059876315 9:118639342-118639364 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1059904162 9:118963163-118963185 TTGCCTAGGCTGGAGAGCAGTGG - Intergenic
1060154878 9:121312665-121312687 TTGCCTGAGCTGGAGTGCAGGGG + Intronic
1060162202 9:121374228-121374250 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1060469629 9:123937308-123937330 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
1060697976 9:125725547-125725569 TTGCCTACGCTGGAGAGCAGTGG - Intergenic
1060948504 9:127585649-127585671 TCCCCTAGGCTGGAGAGCAGTGG + Intergenic
1061018761 9:128000086-128000108 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
1061047014 9:128171082-128171104 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1061138355 9:128749701-128749723 TTGCCCAAGCTGGAGAGCAGTGG - Intronic
1061233676 9:129329527-129329549 TTCCCTGGGCTGGAGTGCAGTGG - Intergenic
1061289798 9:129644168-129644190 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1061448333 9:130654713-130654735 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
1061539629 9:131271043-131271065 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1203730888 Un_GL000216v2:88445-88467 TTCCCTGGGCTGGAGTGCAGTGG - Intergenic
1203750758 Un_GL000218v1:77470-77492 TTTCCTAAGCTGGAGCGCAGTGG - Intergenic
1203483232 Un_GL000224v1:26870-26892 TTTCCTAAGCTGGAGCGCAGTGG + Intergenic
1203541631 Un_KI270743v1:93992-94014 TTTCCTAAGCTGGAGTGCAGTGG + Intergenic
1185523360 X:758486-758508 GTCCCCCAGCTGGAGTGCAGTGG + Intergenic
1185534754 X:852072-852094 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1185578743 X:1193919-1193941 TTGCCCCAGCTGGAGTGCAGTGG - Intronic
1185595951 X:1307096-1307118 GTCCCTGAGCCGGAGAGAGGTGG - Intronic
1185674623 X:1839314-1839336 TTGCCCAAGCCGGAGTGCAGTGG + Intergenic
1185818687 X:3181218-3181240 TCCCCTAAGCAGGAGTGCAGTGG - Intergenic
1186803439 X:13116294-13116316 TTCCCCAAGCTGGAGTGCAGTGG + Intergenic
1186816665 X:13244331-13244353 TTTCCCCAGCTGGAGTGCAGTGG - Intergenic
1187152644 X:16694954-16694976 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1187215395 X:17271116-17271138 TTGCCTAGGCCGGAGTGCAGTGG + Intergenic
1187886626 X:23894754-23894776 TTGCCTAAGCTGGAGTGCAGTGG - Intronic
1187901172 X:24027925-24027947 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
1188265245 X:28065679-28065701 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1188430627 X:30102810-30102832 TTCCTTCAGCCCCAGATCAGGGG + Intergenic
1188593205 X:31864527-31864549 TTCCCCATGCCGGAGTGCAGTGG + Intronic
1188646946 X:32580864-32580886 TCCCCTAGGCTGGAGAGCAGTGG + Intronic
1189169068 X:38891473-38891495 TTCCCCAGGCTGGAGAGCAGTGG - Intergenic
1189176063 X:38958682-38958704 CTCCCCCAGCCAGTGAGCAGTGG + Intergenic
1189478854 X:41377591-41377613 TTGCCCAAGCCGGAGTGCAGTGG - Intergenic
1189481068 X:41392686-41392708 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1190018953 X:46854802-46854824 GTCACCCAGCCGGAGTGCAGTGG + Intronic
1190074338 X:47305084-47305106 TTGCCCCAGCTGGAGTGCAGTGG - Intergenic
1190111339 X:47590930-47590952 TTGCCCCAGCTGGAGTGCAGTGG + Intronic
1190113136 X:47608160-47608182 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
1190274030 X:48888792-48888814 TTCCCTGGGCTGGAGTGCAGTGG - Intergenic
1190365142 X:49685863-49685885 TTGCCCAAGCTGGAGAGCAGTGG - Intergenic
1190585504 X:51936107-51936129 TTTCCTCAGCCCTAGAGCTGAGG + Intergenic
1190850416 X:54234784-54234806 TTGCCTCAGCTGGAGTGCAGTGG - Intronic
1190892639 X:54584121-54584143 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1190910996 X:54772808-54772830 TTGCCCCAGCTTGAGAGCAGTGG + Intronic
1191636993 X:63389915-63389937 TTGCCCCAGGCGGAGTGCAGTGG + Intergenic
1192048700 X:67703036-67703058 GTCACCCAGCTGGAGAGCAGTGG - Intronic
1192371086 X:70513528-70513550 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1192744145 X:73921926-73921948 TTGCCTAAGCCGGAGTGCAGTGG - Intergenic
1192779094 X:74276190-74276212 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
1193114316 X:77761495-77761517 TTGCCTCAGCTGGAGTGCAGAGG - Intronic
1193488564 X:82118673-82118695 TTGCCTGAGCTGGAGTGCAGTGG + Intergenic
1193847968 X:86497952-86497974 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1194383245 X:93221496-93221518 TTTCCTAAGCCAGAGTGCAGTGG - Intergenic
1194669856 X:96718391-96718413 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1195022533 X:100844470-100844492 GTCCCCCAGCTGGAGTGCAGTGG + Intronic
1195693506 X:107649122-107649144 TTGCCTAAGCTGGAGTGCAGTGG + Intronic
1196908511 X:120462480-120462502 TTCCCCCAGCTGGAGTGCAGTGG - Intronic
1197700237 X:129594283-129594305 TTGCCTCAGCTGGAGTGCAGTGG + Intergenic
1197797878 X:130317566-130317588 TTCCCCAAGCTGGAGTGCAGTGG - Intergenic
1198318676 X:135496457-135496479 TTGCCTAAGCTGGAGTGCAGTGG - Intergenic
1198519728 X:137440722-137440744 TTGCCTGAGCTGGAGTGCAGTGG + Intergenic
1198755549 X:139978559-139978581 TTGCCTAGGCCGGAGTGCAGTGG - Intergenic
1198862204 X:141083363-141083385 TTGCCACAGCTGGAGTGCAGTGG - Intergenic
1198900486 X:141504009-141504031 TTGCCACAGCTGGAGTGCAGTGG + Intergenic
1199040026 X:143102556-143102578 TTCCCCAGGCCGGAGTGCAGTGG + Intergenic
1199367816 X:147007478-147007500 TTGCCTGAGCTGGAGTGCAGTGG - Intergenic
1199725813 X:150579533-150579555 TTACCTAAGCTGGAGTGCAGTGG + Intronic
1199767370 X:150951035-150951057 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1199813814 X:151378370-151378392 TTCCCCAAGCCAGAGTGCAGTGG - Intergenic
1200122293 X:153796918-153796940 TTGCCTCAGCTGGAGTGCATTGG + Intronic
1200139164 X:153889710-153889732 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1200144167 X:153917709-153917731 TCCCCTCGGCTGGAGTGCAGGGG - Intronic
1200254155 X:154570557-154570579 TTCCACCAGAGGGAGAGCAGAGG + Intergenic
1200263614 X:154633851-154633873 TTCCACCAGAGGGAGAGCAGAGG - Intergenic
1200746148 Y:6905632-6905654 TTGCCCCAGCTGGAGTGCAGTGG + Intergenic
1200747415 Y:6914652-6914674 TTCCCCAAGCTGGAGTGCAGTGG - Intronic
1201164410 Y:11195094-11195116 TTTCCTAAGCTGGAGCGCAGTGG - Intergenic
1201255269 Y:12101952-12101974 TTGCCTAAGCTGGAGTGCAGTGG + Intergenic
1201426148 Y:13852794-13852816 ATCACCCAGCCGGAGTGCAGTGG + Intergenic
1201856439 Y:18549701-18549723 TTACCCCCGCTGGAGAGCAGTGG + Intronic
1201876882 Y:18770683-18770705 TTACCCCCGCTGGAGAGCAGTGG - Intronic
1202252233 Y:22885207-22885229 TTGCCTCACCCTGACAGCAGGGG - Intergenic
1202405222 Y:24518956-24518978 TTGCCTCACCCTGACAGCAGGGG - Intergenic
1202465558 Y:25151126-25151148 TTGCCTCACCCTGACAGCAGGGG + Intergenic