ID: 905136926

View in Genome Browser
Species Human (GRCh38)
Location 1:35807628-35807650
Sequence GCCGGAAGGCACCACGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905136926_905136936 10 Left 905136926 1:35807628-35807650 CCATTCCCGTGGTGCCTTCCGGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 905136936 1:35807661-35807683 GGGACGCGCAGTTGGGTGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
905136926_905136935 3 Left 905136926 1:35807628-35807650 CCATTCCCGTGGTGCCTTCCGGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 905136935 1:35807654-35807676 ACGGAGAGGGACGCGCAGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 37
905136926_905136938 24 Left 905136926 1:35807628-35807650 CCATTCCCGTGGTGCCTTCCGGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 905136938 1:35807675-35807697 GGTGTGTGGTGCTGAATGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 232
905136926_905136931 -10 Left 905136926 1:35807628-35807650 CCATTCCCGTGGTGCCTTCCGGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 905136931 1:35807641-35807663 GCCTTCCGGCTATACGGAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 22
905136926_905136934 2 Left 905136926 1:35807628-35807650 CCATTCCCGTGGTGCCTTCCGGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 905136934 1:35807653-35807675 TACGGAGAGGGACGCGCAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 90
905136926_905136937 23 Left 905136926 1:35807628-35807650 CCATTCCCGTGGTGCCTTCCGGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 905136937 1:35807674-35807696 GGGTGTGTGGTGCTGAATGAAGG 0: 1
1: 0
2: 2
3: 31
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905136926 Original CRISPR GCCGGAAGGCACCACGGGAA TGG (reversed) Intergenic
901303684 1:8217364-8217386 GCCGGAGGGCGCCGCAGGAAGGG + Intergenic
903417525 1:23194079-23194101 GACGGAAAGGACCACGGCAAGGG + Exonic
904031649 1:27536952-27536974 GGCCGCAGGCACCGCGGGAATGG - Intronic
904128783 1:28260389-28260411 GCCGGGAGGCACCCCAGGAAGGG - Intronic
905136926 1:35807628-35807650 GCCGGAAGGCACCACGGGAATGG - Intergenic
906635902 1:47410374-47410396 GCTGGCAGGCACCACAGGACTGG - Intergenic
913249551 1:116901176-116901198 GCAGGAAGGCAGCACAGGAAAGG + Intergenic
917003744 1:170388646-170388668 GCCTGAGGGCAGCAGGGGAAGGG + Intergenic
918250368 1:182698114-182698136 GCCAGAAGGTAGCAGGGGAAGGG - Intergenic
1063940767 10:11126575-11126597 GCCAGAGTGAACCACGGGAAAGG - Intronic
1064434490 10:15299364-15299386 GTTGGAAGGCACCAGTGGAACGG + Intronic
1066049913 10:31623641-31623663 GCTGGAATGCACCACAGCAAGGG + Intergenic
1067352390 10:45488189-45488211 GCTGGAAGGCAGCTAGGGAAAGG - Intronic
1067776550 10:49168441-49168463 GCCGGCAAGCACCACGGCTACGG - Intronic
1070507559 10:77127638-77127660 GCAGGAAGGCAGGAGGGGAAAGG + Intronic
1071544734 10:86521092-86521114 GGCGGATGAAACCACGGGAAAGG + Intronic
1075271592 10:121056636-121056658 GCCACCAGGCACCAGGGGAAAGG - Intergenic
1079621923 11:22566374-22566396 GCTGGGAGGCAGCAGGGGAAGGG + Intergenic
1084955096 11:72686945-72686967 GCTGGAAGTCAGCACAGGAAAGG - Intronic
1085751658 11:79167638-79167660 GCCAGAAGGCTCCAGGTGAAGGG + Intronic
1087962957 11:104374686-104374708 ACTGGAGGGGACCACGGGAAAGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089754758 11:120678533-120678555 TCAGGAAAGCACCAAGGGAAGGG + Intronic
1089842955 11:121434773-121434795 GCCTGAAGGGACCAGAGGAAGGG + Intergenic
1091344300 11:134842695-134842717 GCCAGAAGCTACCACAGGAATGG - Intergenic
1096572506 12:52531737-52531759 GCCGGGAGGCACCAGAGAAATGG + Intergenic
1102258544 12:111429842-111429864 GCCGGGGGGCACCAGGGGCAGGG + Intronic
1106167613 13:27262696-27262718 GGAGGAAGGCACAACAGGAAGGG - Intergenic
1106248852 13:27969066-27969088 GCCGGGGGGCACGAAGGGAAAGG + Exonic
1106599572 13:31175991-31176013 GGCTGAAGGCCCCACGGGATAGG - Intergenic
1107225795 13:38045741-38045763 GCTTGAAGGCAACAGGGGAAGGG - Intergenic
1107288709 13:38826544-38826566 GCCTGCAGGCAGCACAGGAAGGG - Intronic
1108731634 13:53241567-53241589 GGCTGAAGGCACCATGGTAAGGG + Intergenic
1114484920 14:23056772-23056794 GCAGGGAGGGGCCACGGGAAGGG + Intronic
1122248846 14:100424143-100424165 GGAGGAAGGCACCACGGGCGAGG + Intronic
1122317622 14:100835330-100835352 GGAGGAAGGCATCACGGCAAGGG - Intergenic
1122971128 14:105152646-105152668 GCCGGGAGGCACCAGGGGCTGGG + Intronic
1127402873 15:58608254-58608276 GCCACCAGGCACCACTGGAAAGG + Intronic
1128462885 15:67884642-67884664 GCCAGAAGGCACCCTGGGAACGG + Intergenic
1129079106 15:73023860-73023882 GCAGGAAGGCACCAGGGGCTAGG + Intergenic
1135406493 16:22201857-22201879 GGCCGCAGGCACCACAGGAAGGG - Intergenic
1135539943 16:23322092-23322114 TCTGGAAGGCTCCAAGGGAATGG - Intronic
1137399448 16:48141459-48141481 GCTGGAAGGCACCACTGCCAGGG - Intronic
1139517823 16:67462164-67462186 GCCTGAAGGCTCCATGGGACTGG + Intronic
1143187550 17:5019824-5019846 GGTGGCAGGCAGCACGGGAAAGG - Intronic
1147687388 17:42294770-42294792 GCCAGCAGACACCATGGGAAGGG + Intronic
1153121846 18:1738273-1738295 GCCTGAAGCCACCTCGAGAAAGG + Intergenic
1157134407 18:45039964-45039986 GCAGGAAGGAACCAGGGGTAAGG - Intronic
1160208566 18:76857688-76857710 GCAGGAAGGCAGCCCGGGAAAGG - Intronic
1160988035 19:1848502-1848524 GCCGCAAGGGACCCCGGGAGGGG + Intergenic
1165720778 19:38078189-38078211 GCCGGGAGGCAGCACAGGGATGG - Intronic
1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG + Intronic
1166739235 19:45104140-45104162 CCCAGAAGGCAGCACGGGAGGGG - Intronic
1167960962 19:53103640-53103662 GCGGGGAGGAACCGCGGGAAGGG + Intergenic
930745472 2:54878465-54878487 GCAGGAAGGCAGCAAAGGAAAGG + Intronic
935064586 2:99636734-99636756 GCCGGGAGCCAGCACAGGAAAGG + Intronic
935856008 2:107274723-107274745 GCAGGAAGGCATCACTGGGAGGG - Intergenic
936027779 2:109046756-109046778 GCAGGAAGGGACCAAGGGCACGG - Intergenic
944413764 2:199464233-199464255 GAGGGAAGGCACCACGGGGTGGG - Intronic
945314512 2:208357420-208357442 GCAGGAATGCTCCACAGGAATGG + Exonic
948811834 2:240482338-240482360 GCAGGCAGGCACCACAGGGAGGG - Intronic
1173547301 20:43908704-43908726 GCCAGAGGGCACCATGGCAAGGG + Intergenic
1180615234 22:17121813-17121835 GGCGGATGGCCCCATGGGAAGGG - Exonic
1184581693 22:45422348-45422370 GCTGGAAAGCACCACCAGAAAGG + Exonic
1185104040 22:48857405-48857427 GGCGGAAGGCAGCGCGGGCATGG - Intergenic
950032874 3:9863553-9863575 GCGGGAAGGGACCACGGGTGGGG - Intergenic
950054187 3:10011865-10011887 GCAGGAAGGGACCACGGGTGGGG - Intergenic
952273070 3:31851519-31851541 GCCAGAAGGCACCAGGGCCAAGG + Intronic
959398287 3:105868721-105868743 GCCGAAAGGCAAGAAGGGAAGGG - Exonic
961785608 3:129344885-129344907 GTGGGAAGGGACCACGGGTAGGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
969412035 4:7034647-7034669 GCAGGAAGGCACAAAGAGAACGG + Intergenic
969542982 4:7805318-7805340 GCTGGAAGGGACCCTGGGAATGG + Intronic
969582877 4:8076105-8076127 GCTGGATGCCCCCACGGGAAGGG - Intronic
978608041 4:110504093-110504115 GCCTGGAGGCAGCAGGGGAAGGG + Intronic
980529295 4:134030136-134030158 GCCTTAAGGCAGCACGAGAAAGG + Intergenic
984859871 4:184228443-184228465 GCTGGAAGTCACCACGAGATAGG - Intergenic
985883281 5:2657059-2657081 CCCGGGAGTCACCACAGGAAGGG - Intergenic
985883290 5:2657086-2657108 CCTGGGAGTCACCACGGGAAGGG - Intergenic
991198448 5:63961781-63961803 GGCGGAAGACCCCAGGGGAAGGG - Exonic
991536408 5:67673729-67673751 TCCTGAAGGCACCACTGGAGTGG - Intergenic
997658685 5:135574012-135574034 GCTGGAAGGCACCACAGGTTTGG - Intronic
1001648716 5:173300594-173300616 GCCTGAGAGCACCACAGGAAGGG - Intergenic
1009275994 6:61681008-61681030 GCTTGAAGGCACCACCGCAAAGG - Exonic
1017713636 6:157191574-157191596 GTCGGCAGGCATCAAGGGAAGGG - Intronic
1018017651 6:159727057-159727079 GCCCCAGGGCATCACGGGAAGGG - Exonic
1018345838 6:162898407-162898429 ACCGGAATGCACCACAGGACTGG + Intronic
1034111837 7:148544697-148544719 TTGGGAAGACACCACGGGAAGGG + Intergenic
1035324064 7:158053344-158053366 GCCTGCAGGCACCACTGGAAGGG + Intronic
1036725256 8:11214810-11214832 GTGTGAAGTCACCACGGGAATGG - Intergenic
1037982439 8:23263849-23263871 GCCAGAAGGAGCCACGAGAAGGG + Intergenic
1040476305 8:47781130-47781152 GCAGGCAGGTACCACAGGAAAGG + Intronic
1044089271 8:87979033-87979055 GGAGGAAGGCACCAAGTGAATGG + Intergenic
1044867041 8:96581728-96581750 GACAGAAGGCAGCACGGGAGTGG + Intronic
1044878684 8:96699967-96699989 GCAGGAAGCCCCCACGGGAAAGG - Intronic
1044959232 8:97514138-97514160 GGCGGAAGGCACCAAGTAAAAGG + Intergenic
1049592331 8:143468312-143468334 GCCGGCAGGGACCAAGGGCAGGG + Intronic
1051483137 9:17579802-17579824 GCCCGCAGGCTCCAGGGGAATGG + Intronic
1052830564 9:33211993-33212015 GCAGGAAGTCTCCAGGGGAAAGG + Intergenic
1057312842 9:93952527-93952549 GCCTGAAGGTGCCGCGGGAAAGG + Intronic
1061940284 9:133880258-133880280 GCCGGCAGGCAGCACGGGGAGGG + Intronic
1191717453 X:64203653-64203675 GCAGAAAGGCACCAAGGAAAAGG + Intronic
1195703541 X:107722640-107722662 GCTGGAAGGCATAAGGGGAAGGG - Intronic