ID: 905143684

View in Genome Browser
Species Human (GRCh38)
Location 1:35869762-35869784
Sequence GAGCCAAATGTGGACCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905143677_905143684 11 Left 905143677 1:35869728-35869750 CCAATCAGATGCCAGTTGCGTGA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 905143684 1:35869762-35869784 GAGCCAAATGTGGACCTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 141
905143681_905143684 0 Left 905143681 1:35869739-35869761 CCAGTTGCGTGATGGCGTGGGTG 0: 1
1: 0
2: 0
3: 0
4: 64
Right 905143684 1:35869762-35869784 GAGCCAAATGTGGACCTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 141
905143676_905143684 23 Left 905143676 1:35869716-35869738 CCTCTACGTTCACCAATCAGATG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 905143684 1:35869762-35869784 GAGCCAAATGTGGACCTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 141
905143675_905143684 27 Left 905143675 1:35869712-35869734 CCTTCCTCTACGTTCACCAATCA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 905143684 1:35869762-35869784 GAGCCAAATGTGGACCTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905143684 Original CRISPR GAGCCAAATGTGGACCTGTG AGG Intergenic
900086383 1:899828-899850 GAGCCATCAGTGGACCTGTCTGG - Intergenic
901157413 1:7149834-7149856 AAGACAAATGTGTGCCTGTGGGG + Intronic
902564826 1:17304561-17304583 GAGCCCAAAGGGGACCTTTGGGG - Intergenic
902689780 1:18103403-18103425 GAGAGAAATGTGGACCCCTGGGG + Intergenic
903018269 1:20375876-20375898 GAGGCAACTGAGGACCTCTGCGG + Intergenic
904486083 1:30825201-30825223 GAGCCAGATGAGGAACGGTGGGG + Intergenic
905143684 1:35869762-35869784 GAGCCAAATGTGGACCTGTGAGG + Intergenic
908178949 1:61585149-61585171 GAGGCAACTGTGCAACTGTGTGG - Intergenic
909882111 1:80892549-80892571 GAGCCAAATGAAGACCTGCTAGG + Intergenic
914319265 1:146543975-146543997 GACACAGATGTGGACTTGTGTGG - Intergenic
915276802 1:154794672-154794694 GGACCAAAGGTGGACCTCTGTGG + Intronic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
919738397 1:200968009-200968031 ATGCAAAATATGGACCTGTGGGG + Intergenic
919887304 1:201944210-201944232 GAACCAAGTGTGGACCTGGCAGG + Intronic
922744164 1:228034980-228035002 GCGCCACATGTATACCTGTGTGG - Intronic
924924938 1:248671329-248671351 GAGCCTCAGGTGGACCAGTGGGG - Intergenic
924924953 1:248671380-248671402 GAACCTAAGGTGGACCAGTGGGG - Intergenic
1065408321 10:25392326-25392348 AAGCCAAGTGTGGAGCAGTGGGG - Intronic
1068225949 10:54107538-54107560 GAGGCAAATGTGGCCATGTTTGG + Intronic
1070650963 10:78236081-78236103 GACCCAAATGAGAACCTTTGTGG - Intergenic
1075196485 10:120364025-120364047 GAGAAAAATGTGGAGCAGTGAGG - Intergenic
1077195021 11:1275223-1275245 GAGCCACATGTGCACGCGTGTGG + Exonic
1077393815 11:2311569-2311591 GAGCCAGCTCTGTACCTGTGGGG + Intronic
1079020315 11:16905552-16905574 GAGCAAAATGAGGCCCTCTGGGG + Intronic
1081494937 11:43598830-43598852 CAGCCATATATGTACCTGTGTGG + Intronic
1084571874 11:69964852-69964874 GAGCCCAGAGTGGACCTCTGGGG + Intergenic
1088884513 11:113996514-113996536 GAGCCAGGTGTGGACCTGGCTGG - Intergenic
1091360610 11:134976146-134976168 GAGGGAAATGTGGCCCAGTGGGG + Intergenic
1092810625 12:12268191-12268213 GAGCAAAATGAGAACCTGAGAGG + Intergenic
1095336650 12:41036426-41036448 AAGCCAAATGTGGACTTTTTAGG + Intronic
1096774831 12:53957436-53957458 GAGCCAGCTGGGGACCTCTGGGG - Exonic
1097446399 12:59678031-59678053 GAGCCAGGTGTGGAGCAGTGAGG + Intronic
1103173817 12:118844482-118844504 GAACCAGATGTGGAACTGCGAGG - Intergenic
1104091582 12:125522062-125522084 GAGCCAAAAGGAGACCTGAGAGG - Intronic
1105204057 13:18205104-18205126 GCCCCAAATATGGTCCTGTGTGG - Intergenic
1105251113 13:18698708-18698730 AAGCAAAATCTGCACCTGTGTGG - Intergenic
1106876248 13:34077020-34077042 GTCCCAAATGTGGACAAGTGTGG + Intergenic
1107900396 13:45007161-45007183 GAGCCACATGTGGGTCTCTGTGG - Intronic
1108841412 13:54621142-54621164 GAACCCAGTTTGGACCTGTGTGG - Intergenic
1112926932 13:104687829-104687851 CAGCCACATGTGCACCTGGGTGG - Intergenic
1114271569 14:21103494-21103516 GAGGCAAATGTGAAGCTGTATGG - Exonic
1121010550 14:90517697-90517719 CAGCCATGTGGGGACCTGTGGGG + Intergenic
1124217269 15:27817667-27817689 GCGCCAAATGAGGAGCTGGGAGG - Intronic
1124681791 15:31738271-31738293 GGGCCAGATGAGGACCTCTGTGG + Intronic
1126383820 15:48074027-48074049 GAGGCAAATGTAGACCTGGGAGG - Intergenic
1126445023 15:48732820-48732842 GAGCCAAATGTGGCCAGGTCTGG + Intronic
1126486842 15:49190783-49190805 AAGGCAAATGTGGAACTGTAAGG + Intronic
1128074508 15:64817930-64817952 GAGCCAAGTGAGCACCGGTGTGG - Exonic
1131268384 15:90932181-90932203 GAGCCAGATGTGGCCCCTTGTGG + Intronic
1136074288 16:27806235-27806257 GAGCCCAATTTTGGCCTGTGAGG - Intronic
1136990469 16:35148564-35148586 GAGCCCAAAGTGGATATGTGCGG + Intergenic
1137334190 16:47532495-47532517 GAGCCAGATGTGGAGTGGTGAGG + Intronic
1138528388 16:57621657-57621679 GAGCCAAATGAGGCCCAGAGAGG - Intronic
1140014259 16:71166109-71166131 GACACAGATGTGGACTTGTGTGG + Intronic
1140592643 16:76371914-76371936 GGGGCAAAAGTGGACCTGAGAGG - Intronic
1142500089 17:327451-327473 GAGCCAAGTGAGTACCTCTGGGG - Exonic
1143784017 17:9243591-9243613 GATCAAAATGTGTACTTGTGGGG + Exonic
1143974300 17:10818926-10818948 TAGCCAGATGGGGACATGTGGGG + Intergenic
1144529185 17:16019622-16019644 AAGCTAAAGGTGGCCCTGTGTGG + Intronic
1144739287 17:17572234-17572256 GAGACAAAGGTGGAGCTGAGAGG - Intronic
1144851306 17:18245405-18245427 CACCCACATGTAGACCTGTGGGG + Exonic
1147898259 17:43766689-43766711 GAGCCAAAAGGGGACCTTAGAGG + Exonic
1151781638 17:76250534-76250556 TAGCCATCTGTGGACGTGTGTGG + Intergenic
1157332645 18:46714716-46714738 GAGCCCTATGGGGACCTGTGAGG + Intronic
1158190586 18:54823947-54823969 GAGTCAAATGTTTGCCTGTGGGG - Intronic
1160801288 19:970912-970934 AATCCATTTGTGGACCTGTGAGG - Intronic
1160952182 19:1672911-1672933 GAGGCACACGTGGTCCTGTGTGG + Intergenic
1161361043 19:3849970-3849992 GAGCAGACTGAGGACCTGTGAGG + Intronic
1162161807 19:8723703-8723725 GACCCAAATGTCAACCTGTGTGG + Intergenic
1163242863 19:16075194-16075216 GAGCCAACTCTAGACCGGTGTGG + Intronic
1168614024 19:57823295-57823317 AAGCCATATGTGGTTCTGTGTGG + Intronic
1168618043 19:57854300-57854322 AAGCCATATGTGGTTCTGTGTGG + Intronic
1168625303 19:57913348-57913370 AAGCCATATGTGGTTCTGTGTGG - Intronic
1168692109 19:58383449-58383471 GAGCCAGAGGGGGACCTCTGCGG - Intergenic
926153940 2:10440193-10440215 CAGCCAACTCTGGACATGTGGGG + Exonic
926327201 2:11795575-11795597 GAGCCAGAGTTGGAACTGTGTGG - Intronic
927888642 2:26734319-26734341 GAGCTAAATGTGGGAATGTGAGG - Intergenic
932214806 2:69959652-69959674 GAGACAAGTGTTGACCTGTGTGG - Intergenic
933296297 2:80495065-80495087 TAGCCAAATGATGACCTGTTGGG + Intronic
937991547 2:127664864-127664886 AAGCAGAATGTGGGCCTGTGTGG - Intronic
939062273 2:137436918-137436940 GAGCCAAATTTCTACCTGTGTGG + Intronic
942460069 2:176162547-176162569 GAGCCAAAGTTGGACCCGCGTGG + Intronic
942627004 2:177912125-177912147 GCCCCAAATTTGGACCAGTGAGG - Intronic
945384378 2:209179747-209179769 GAAGCAAATGCGGGCCTGTGAGG + Intergenic
948686040 2:239670272-239670294 GAGCCGGATGTGGAACTGGGCGG + Intergenic
948900627 2:240955269-240955291 GAGACACGTGTGCACCTGTGTGG - Intronic
1168909778 20:1438525-1438547 CAGCCAAATGTGGACCCATGAGG - Intergenic
1169934633 20:10870410-10870432 CAGCATAATGGGGACCTGTGTGG + Intergenic
1170687427 20:18582035-18582057 GAGGAAAATCTGGACCTGGGAGG - Intronic
1173935379 20:46857588-46857610 GAGCCAGATGTGGAAAGGTGAGG + Intergenic
1175234138 20:57497667-57497689 AAGGCAAATGTGTACCTGTAAGG - Intronic
1176155548 20:63618317-63618339 GAGCAAGACATGGACCTGTGTGG - Intronic
1176458457 21:6933499-6933521 AAGCAAAATCTGCACCTGTGTGG - Intergenic
1176713917 21:10332976-10332998 GCCCCAAATATGGTCCTGTGTGG + Intergenic
1176836630 21:13798592-13798614 AAGCAAAATCTGCACCTGTGTGG - Intergenic
1177115016 21:17074732-17074754 GAACCAAATGTGGATGTATGAGG + Intergenic
1179486284 21:41712613-41712635 CAGCCAGAGGTGGGCCTGTGGGG + Intergenic
1182867035 22:33612839-33612861 GAGCAGAAGGTGGACCAGTGTGG + Intronic
949383138 3:3468093-3468115 GAGCCATATGTTTAGCTGTGCGG - Intergenic
950207738 3:11093403-11093425 GAGCCAGGTGTGGAACGGTGAGG - Intergenic
952570356 3:34708675-34708697 GAGTCAAATGTGGATCAGTGGGG - Intergenic
954605261 3:51904513-51904535 GAGGCCAATGTGGATCTGTAGGG + Intergenic
955857456 3:63288508-63288530 GAGCCAAAGGTGTACCTCTTTGG - Intronic
956311856 3:67889517-67889539 GAGCCAAATGTTTAACTTTGTGG + Intergenic
956630330 3:71310887-71310909 GAGCCAGATGTGGCCATGAGAGG - Intronic
956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG + Intergenic
957788101 3:84906245-84906267 GAGTCAAGTGTGGAGCAGTGAGG - Intergenic
958977541 3:100683595-100683617 GAGCCAGGTGTGGAGCGGTGAGG - Intronic
965665641 3:171090743-171090765 GAGTAAAAAGTGGTCCTGTGGGG + Intronic
967671320 3:192238752-192238774 GAGTAAACTTTGGACCTGTGAGG - Intronic
970503114 4:16698424-16698446 GATCATAATGGGGACCTGTGAGG - Intronic
975474347 4:74805764-74805786 GGCCCAATTGTGGATCTGTGAGG + Intergenic
978332528 4:107629973-107629995 GAGCCAAATTAGGACCTTAGAGG - Intronic
982083282 4:151810553-151810575 GAGCCCAAAGTGGAGCAGTGGGG - Intergenic
984959311 4:185079203-185079225 GACCCAAATGTGAACTTGGGAGG - Intergenic
985836745 5:2277327-2277349 GACTGAAATGTGGACCTGAGAGG - Intergenic
986149072 5:5110335-5110357 GAGCCAACCCTGCACCTGTGAGG - Intergenic
995612094 5:113921800-113921822 AAGCCAAATGTGCATTTGTGGGG - Intergenic
996078032 5:119220542-119220564 TACCCAAGTGTAGACCTGTGTGG - Exonic
997279361 5:132629403-132629425 GAGCAGAATGAGGACCTATGAGG + Intronic
1000881515 5:166703406-166703428 GTGCCATATTTGGCCCTGTGTGG + Intergenic
1003113768 6:3269813-3269835 GTGCCATAAGTGGGCCTGTGAGG - Exonic
1006203025 6:32313821-32313843 GATCTAACTCTGGACCTGTGTGG + Intronic
1006203682 6:32320308-32320330 GATCCAACTCTGGACCTGTGTGG + Intronic
1006437189 6:34031916-34031938 GATGCAAATGTGCAGCTGTGAGG - Intronic
1014912384 6:127110607-127110629 AAGCCAAATGTGGAGCTCTTTGG - Intergenic
1015103142 6:129504915-129504937 TTGCCAAATGTGGATATGTGTGG - Intronic
1018583382 6:165328515-165328537 GGGCCAGGTGTGGCCCTGTGAGG - Intronic
1022475299 7:30705995-30706017 GGACCAAGTGAGGACCTGTGTGG + Intronic
1023090890 7:36616273-36616295 GAGGGAAATTTGCACCTGTGTGG + Intronic
1030211380 7:106999428-106999450 TAGTGATATGTGGACCTGTGGGG - Intergenic
1033036455 7:137880145-137880167 TTGCCTAATGTGCACCTGTGAGG - Exonic
1034829045 7:154293422-154293444 GAGATAAAAGTGGAGCTGTGTGG + Intronic
1037615914 8:20519003-20519025 GTGTAAAATGTGGACGTGTGTGG + Intergenic
1037716301 8:21403896-21403918 GATCCTAATGTACACCTGTGTGG - Intergenic
1040328588 8:46374659-46374681 GTGCCAGATGTGGGCCTGTGTGG - Intergenic
1049839822 8:144763769-144763791 GAGCCAGAGGTGACCCTGTGTGG + Intergenic
1050154692 9:2653874-2653896 GTGACAAATGTTGACCTTTGAGG + Exonic
1053253373 9:36594016-36594038 TAACTAAATGTGGAACTGTGAGG + Intronic
1061046643 9:128168824-128168846 GACTGAAATTTGGACCTGTGTGG - Intronic
1061330309 9:129888386-129888408 GAGCCCATTGTGGAGCTGTGGGG + Exonic
1062479546 9:136744975-136744997 GGGCCACATGGGGAGCTGTGTGG - Intronic
1186565955 X:10662803-10662825 GAGCCAAAGCTGGACCTCTTTGG - Intronic
1186566031 X:10663658-10663680 GAGCCAAAGCTGGACCTCTTTGG + Intronic
1186568291 X:10687495-10687517 CAGCCAAATGTAGTCCTGTCTGG + Intronic
1186943190 X:14535160-14535182 GAGCCAAATATGGGCCACTGAGG + Intronic
1189203051 X:39214498-39214520 GAGACAATTGTGGGCTTGTGGGG - Intergenic
1190118568 X:47641707-47641729 GAAACAAATGTGAATCTGTGGGG + Intronic
1195333880 X:103831060-103831082 GAGCCATGGTTGGACCTGTGGGG + Intronic
1195744105 X:108096891-108096913 GAGACAAATGGGGCCCTGTTAGG + Intronic
1197185903 X:123587264-123587286 GACCCAAATGTGGCCAGGTGCGG - Intergenic
1198140147 X:133794493-133794515 AAGCCAAATGTGTGCCTTTGAGG - Intronic