ID: 905144161

View in Genome Browser
Species Human (GRCh38)
Location 1:35874115-35874137
Sequence TCTTATTTGGCCATGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 1, 2: 29, 3: 100, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905144161_905144168 30 Left 905144161 1:35874115-35874137 CCATGAACCATGGCCAAATAAGA 0: 1
1: 1
2: 29
3: 100
4: 383
Right 905144168 1:35874168-35874190 TTTGTTATTGTTTTAGAGACAGG 0: 1
1: 40
2: 687
3: 4290
4: 46331
905144161_905144166 6 Left 905144161 1:35874115-35874137 CCATGAACCATGGCCAAATAAGA 0: 1
1: 1
2: 29
3: 100
4: 383
Right 905144166 1:35874144-35874166 ATTTGATCTACCAATGTCATGGG 0: 1
1: 2
2: 0
3: 11
4: 134
905144161_905144165 5 Left 905144161 1:35874115-35874137 CCATGAACCATGGCCAAATAAGA 0: 1
1: 1
2: 29
3: 100
4: 383
Right 905144165 1:35874143-35874165 AATTTGATCTACCAATGTCATGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905144161 Original CRISPR TCTTATTTGGCCATGGTTCA TGG (reversed) Intronic
903895979 1:26604954-26604976 TCTTCTTTGTCCATTATTCAGGG + Intergenic
904665409 1:32116956-32116978 TCTTATATGACCATGGCTCATGG + Intronic
904862958 1:33553373-33553395 TTTTATGTGTGCATGGTTCATGG - Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906750154 1:48251653-48251675 TCTTTTTTGTCGCTGGTTCAGGG - Intergenic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
908222152 1:62018123-62018145 TCTTATTTGCTTATGTTTCATGG + Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909189098 1:72529811-72529833 TCTTATATGGCTATGTTTCATGG - Intergenic
909220357 1:72951435-72951457 TCTTATATGGCCACAGTTCATGG + Intergenic
909246661 1:73294107-73294129 GCTTATTTATCCATGGGTCAGGG - Intergenic
909527178 1:76638504-76638526 TCATTTTTGGCAAGGGTTCAGGG - Intergenic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910918322 1:92315305-92315327 TTTTATGTGGGCTTGGTTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911833907 1:102591536-102591558 TCTTATTTGGAACTTGTTCAAGG - Intergenic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
913097576 1:115534173-115534195 TCTTATCTTGTCATGCTTCAAGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913369406 1:118081678-118081700 TCTTATTAGCACATGGTACAGGG + Intronic
915666353 1:157448748-157448770 TATTATTTTGTCATGCTTCAAGG + Intergenic
917467774 1:175298118-175298140 TCTTTTTAAGCCAAGGTTCATGG + Intergenic
918386200 1:184010645-184010667 TGTTCTTTGGTCATGGTTCTAGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919147485 1:193654379-193654401 TCCTATTTGGTCATTTTTCATGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919487887 1:198166688-198166710 TTTTATTTGGACATGATTCATGG + Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
1063278435 10:4597405-4597427 TCTTATTTGTCTATGGCACATGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064276211 10:13907558-13907580 TCTTATTTGTTGAGGGTTCAAGG + Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1064851426 10:19713315-19713337 TCTTATCTGGATATGGTTCCAGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1066190860 10:33054806-33054828 TCTTGATTGGCCAAGGTACAGGG - Intergenic
1066955311 10:42163695-42163717 TCTTATTTGTCCCAAGTTCAAGG - Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1069128323 10:64666556-64666578 TCTCCTTTGGCCAAGGTACAGGG + Intergenic
1069467611 10:68655821-68655843 TCCTATTGGCCCATGGCTCAGGG - Intronic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1071151889 10:82645619-82645641 TCTTATTTTGCCATGGATTTGGG - Intronic
1072199607 10:93146335-93146357 TCATATTCTGCAATGGTTCATGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074535802 10:114328059-114328081 TGTTTGTTGGCCATGGTTGATGG - Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1079093057 11:17494177-17494199 CCTTATCTGGCCCTGGTTCAGGG + Intronic
1079357988 11:19745881-19745903 TGGTACTTGTCCATGGTTCAAGG + Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1079832449 11:25285333-25285355 TCTTATAAAGTCATGGTTCATGG + Intergenic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1081753641 11:45529568-45529590 TCTTCTCTGGCCATGAGTCATGG + Intergenic
1082653717 11:55826614-55826636 TCAATGTTGGCCATGGTTCAGGG - Intergenic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1094171486 12:27497432-27497454 TCTGATTTTACCATGGTTAATGG - Intronic
1094737983 12:33257006-33257028 TTTTATTTTGCCAAGGTTAAGGG + Intergenic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1097317995 12:58193657-58193679 TCTTGTTTGGCCTTGGTTACAGG + Intergenic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1100175702 12:92028536-92028558 GCTTTGTTGGCAATGGTTCAAGG - Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101791229 12:107929723-107929745 TCTGTTTTGGCCATGATACAAGG - Intergenic
1102297606 12:111749033-111749055 TCTTACTGGGACATGGTTAAAGG - Intronic
1103427446 12:120848930-120848952 TTTTTTTTGGCCATCTTTCAAGG + Intronic
1103925317 12:124420661-124420683 TCCCATTTGGCCGGGGTTCATGG - Intronic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104812812 12:131628742-131628764 TATTCTGTGGCCATGGTTCTGGG - Intergenic
1105747018 13:23386939-23386961 TCTTATTTGGGCACAGTTCGTGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106821293 13:33467503-33467525 TGGTATTTGTCCATGGTCCAGGG + Intergenic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107898026 13:44985659-44985681 TCTTATATGGCCACGATTCATGG - Intronic
1107982978 13:45751105-45751127 TCTTCTAGGGCCATGTTTCAGGG + Intergenic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1112978902 13:105356679-105356701 TCTTCTAAGGTCATGGTTCATGG - Intergenic
1113045146 13:106147408-106147430 TCTTATATGGCCAGGGCACAAGG + Intergenic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1116322239 14:43483001-43483023 TCTTTTTTGGACATGAGTCAGGG + Intergenic
1116963467 14:50990727-50990749 TCTTATTGGACCTGGGTTCAAGG - Intronic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1125038110 15:35150514-35150536 AACTATTTGGCCATGGATCATGG + Intergenic
1125419351 15:39488519-39488541 GCTCATTTGGCCATGGATAAAGG + Intergenic
1126391690 15:48162792-48162814 TTTTATTTGGGCACGGTTGATGG - Intronic
1128866360 15:71117605-71117627 TGTAATTTGGACATGGTTGAAGG - Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1131862898 15:96673757-96673779 TCTCATTTCTCCATGGGTCAGGG + Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132382940 15:101379214-101379236 TGGAATATGGCCATGGTTCAGGG - Intronic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1133600551 16:7336205-7336227 TGTCATTTGGCCATGGTCCATGG - Intronic
1135498283 16:22971655-22971677 TCATATTTGCCAATGGTCCATGG + Intergenic
1135654634 16:24237058-24237080 TTTTTTTTTGCCAGGGTTCAAGG - Intergenic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1137085653 16:36119271-36119293 TCTTATTTGTCCCAAGTTCAAGG - Intergenic
1138713386 16:58994358-58994380 TCTTATTTGGCCATCTTGGAGGG + Intergenic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141239280 16:82250115-82250137 TCTGATTTAGCCATGGTTGTGGG + Intergenic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1144514082 17:15903240-15903262 TTTTATTTGAGCATGGTCCAAGG - Intergenic
1144959685 17:19038211-19038233 ACATATTTGGCCTGGGTTCAGGG + Intronic
1144975475 17:19136313-19136335 ACATATTTGGCCTGGGTTCAGGG - Intronic
1145926394 17:28650270-28650292 TCGTCTTTTTCCATGGTTCATGG - Intronic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146115510 17:30134218-30134240 TTTTATCTGGGCATGGTACATGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1148934713 17:51155646-51155668 TCACAGTTGGCCATGGTTCTGGG - Exonic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1203182242 17_KI270729v1_random:70566-70588 TCTTATTTGTCCCAAGTTCAAGG + Intergenic
1203190181 17_KI270729v1_random:176070-176092 TCTTATTTGTCCCAAGTTCAAGG + Intergenic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1157609469 18:48947457-48947479 TTTTATTTTGCCAAGGTTCTGGG - Intronic
1159180607 18:64897869-64897891 TTTTATATGGTCATGATTCATGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160331491 18:77996140-77996162 TCATAGTTTGCCATGGCTCAAGG - Intergenic
1161359706 19:3841042-3841064 TCTAGGTTGGCCACGGTTCAGGG + Intronic
1162120075 19:8459421-8459443 AATTATTTTGCCATGTTTCAAGG + Intronic
1202668421 1_KI270709v1_random:22482-22504 TCTTATTTGTCCCAAGTTCAAGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925798946 2:7577588-7577610 TCTGATTTCCCCATGGTCCATGG + Intergenic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
930121889 2:47767423-47767445 TCTGCTTTGGCCATGGTGCCCGG - Intronic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932867637 2:75362511-75362533 TATAATTTTGCCATGGATCAAGG - Intergenic
933087193 2:78069118-78069140 TAATATTTGGCCAAGTTTCAAGG - Intergenic
933548935 2:83749566-83749588 TCTTATTTAGGCATGATTCATGG - Intergenic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
934702632 2:96454430-96454452 TCTTATTTGGCCATCTTGCCAGG - Intergenic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936481170 2:112886118-112886140 TTTTATTTTGCCAGGGGTCACGG + Intergenic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
940037474 2:149325967-149325989 TCTTATCTGGACACGGTCCATGG + Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
944879501 2:203997548-203997570 TCTGAAGTGGCCTTGGTTCAGGG + Intergenic
945189317 2:207169809-207169831 TCTTATTTGGGCACAGTTCATGG - Intergenic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1168736148 20:138610-138632 GGTTATTTGGCCTTGGTTCTGGG - Intergenic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1169666847 20:8047146-8047168 TTTTATTTTGCCAAGGTTGAGGG - Intergenic
1169746045 20:8943885-8943907 ACTTTTTTGTCCTTGGTTCAGGG + Intronic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170534161 20:17323920-17323942 TCCCACTTGGCCCTGGTTCAGGG + Intronic
1170575416 20:17658972-17658994 TCCTTTTTGGCCCTGGTTCTGGG + Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1171406234 20:24914002-24914024 TGTTATTTTGTCATGCTTCAAGG - Intergenic
1172176120 20:32972835-32972857 TCTTCATGGGCCATGGTGCAGGG + Intergenic
1173048102 20:39532041-39532063 TCTTATTTGGCTCTGGTCCCTGG - Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1174532134 20:51222447-51222469 TGTTAATGGGCCATGGATCATGG - Intergenic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1176939128 21:14902678-14902700 TGGTTTTTTGCCATGGTTCATGG + Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179731668 21:43371706-43371728 GCTTATTTTGCTATGGTTAAGGG - Intergenic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1181972289 22:26700110-26700132 TCTTAACAGGCCATGGTCCATGG - Intergenic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1184700777 22:46171229-46171251 TCTATTTTGGCCAGAGTTCAAGG + Intronic
1184825400 22:46947241-46947263 TGTTGTTTGGACATGGTTCTTGG + Intronic
1185177995 22:49341185-49341207 TCTTATGTGGTCATAGTACATGG - Intergenic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953515404 3:43586187-43586209 TCTTATCTGGCTATGGTGCCAGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
956040297 3:65138438-65138460 TCATATTTGGCCATCAGTCAGGG - Intergenic
958150507 3:89687365-89687387 ACATATTTTTCCATGGTTCAGGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959497792 3:107071688-107071710 TTTTATTTGTCAGTGGTTCATGG + Intergenic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962600969 3:136990631-136990653 TCTTATCAGGCCAAGCTTCAGGG + Intronic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
962899416 3:139746029-139746051 CCTGATTTGGCCATGACTCATGG - Intergenic
962991406 3:140580686-140580708 GCTTATTTGTTCATGGTTAAAGG - Intergenic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965996034 3:174884244-174884266 TCTTTCATGGCCAGGGTTCATGG - Intronic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
966736061 3:183188110-183188132 TCTTATCAGGCTATGGTTCTTGG - Intronic
967412259 3:189178804-189178826 TTTTACTTAGCCATGGTTTAAGG + Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
969195694 4:5562110-5562132 TGTTATGTGTCCATGGATCAAGG + Intronic
970390413 4:15604401-15604423 TCTTATTAGGGCACAGTTCATGG + Intergenic
970504234 4:16710822-16710844 TATTATTGGGAGATGGTTCAGGG - Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970724146 4:19023959-19023981 TCTTATGTGGCTGTGGTTCGCGG - Intergenic
971164191 4:24165722-24165744 TCTTATATGGTAATGGATCATGG - Intergenic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
974233772 4:59153134-59153156 TCTATTTTGGCAATGGTCCATGG + Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
975031592 4:69626339-69626361 TTTTTTTTTGCCATGGTTAAAGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975823133 4:78291642-78291664 TCTTTTTTGACCATTGTTCTAGG + Intronic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977597073 4:98895068-98895090 TCTTATATCGCCAATGTTCATGG + Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979846252 4:125516295-125516317 TCTTATTTGGGTGTGGTGCATGG + Intergenic
980065397 4:128182481-128182503 TCTTATCCTGGCATGGTTCATGG - Intronic
980961144 4:139477385-139477407 TCTTTTTTGGCCATTGGTCTTGG - Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
981489022 4:145320316-145320338 TCCTTTTTGGTCATAGTTCACGG - Intergenic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983154767 4:164333530-164333552 TCTTATGTGGGCACAGTTCATGG - Intronic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
986783958 5:11093978-11094000 TACTATTTTGCCATGTTTCATGG - Intronic
987349164 5:17006289-17006311 TCTTATTTGGCCAAGTTATAAGG - Intergenic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
987975145 5:25005723-25005745 TCTGATTTTCCCATGGTTAACGG + Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988704412 5:33710297-33710319 TCTTATATGGCAATGGTTGGAGG - Intronic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991183459 5:63781245-63781267 TCTTACTTGACCCTGGTTCAGGG - Intergenic
993281668 5:85933115-85933137 TTGTATTTGGAAATGGTTCAAGG + Intergenic
993385863 5:87262404-87262426 TCTCATTTGGCATTGGTTGAGGG - Intergenic
994296869 5:98100693-98100715 TATTATTTAGCCCTGGTTTATGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994900741 5:105765406-105765428 TCTTATATGGTCGCGGTTCATGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995366907 5:111372300-111372322 TCTCCTTTGACCATGGTTGAGGG - Intronic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
998786093 5:145710554-145710576 TCTGTTTTAGCCATAGTTCAGGG - Intronic
999440385 5:151595949-151595971 TCTGATGTGGCCATGGCCCAGGG + Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1003646689 6:7918399-7918421 TCTAATTTGGGCATTGTTCCTGG - Intronic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1005017224 6:21385793-21385815 TCTCCTTTAGCCATGGGTCAGGG + Intergenic
1006377987 6:33682440-33682462 TCTGATTGGGCCCTGGTTCCTGG + Intronic
1006816772 6:36856512-36856534 ACTCTTTTGGCCATGATTCAAGG - Intronic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1011644614 6:89445921-89445943 TCTTATTTGGGCACAATTCATGG - Intronic
1011709712 6:90040031-90040053 TTTTTTTTGGCCGTGGTTTATGG + Intronic
1013477565 6:110522954-110522976 TCTCATATGGCAATGTTTCATGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015173520 6:130280631-130280653 ACCCATTTGGCCATTGTTCATGG + Intronic
1015640710 6:135328486-135328508 TCTTCTATGGCTATGGTTTATGG - Intronic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1019084501 6:169462638-169462660 TCTTATTTGGCCTTGGTATTGGG - Intronic
1019507408 7:1399246-1399268 TCTGATCTGGTCTTGGTTCATGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020739120 7:11990653-11990675 TCTTTTTGGGCCGTGGTTCCAGG + Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1021657457 7:22886287-22886309 TCTTGTTTAGCCAAGGTTGAAGG + Intergenic
1021830303 7:24600423-24600445 TCTTCTTTGTCCTTGATTCAGGG - Intronic
1021845903 7:24762314-24762336 TATTGTTTGTCCATTGTTCATGG + Intergenic
1022214193 7:28242085-28242107 ACTTATTTGGATATGCTTCAGGG - Intergenic
1022340628 7:29464069-29464091 TCTTATGTGTGCATTGTTCAGGG + Intronic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1025318928 7:58069879-58069901 TCTTATTTGTCCCAAGTTCAAGG + Intergenic
1025477349 7:60940489-60940511 TCTTATTTGTCCCAAGTTCAAGG + Intergenic
1025554790 7:62293174-62293196 TCTTATTTGTCCCAAGTTCAAGG - Intergenic
1025559988 7:62360102-62360124 TCTTATTTGTCCCAAGTTCAAGG + Intergenic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1027995527 7:85421608-85421630 TGTCAGTTGGCCATGGCTCAAGG - Intergenic
1028344842 7:89767042-89767064 TCTTATTTGGGCACAGCTCATGG - Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031954760 7:127931038-127931060 TCTTATATGACTGTGGTTCATGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1033849318 7:145475539-145475561 TCCTGCTTGGCCATGGTACATGG + Intergenic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1037526300 8:19727676-19727698 TCCTTTTTGGTCATGGTTGATGG + Intronic
1038887849 8:31685197-31685219 TCATATTTAACCATGGTTAATGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039602146 8:38848575-38848597 TCTTACTTGACTATGCTTCAGGG - Exonic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040441259 8:47445355-47445377 TCCTATATGGCCACGGTTCATGG - Intronic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1041592059 8:59599270-59599292 CCTTATTTAGCCTTGTTTCATGG - Intergenic
1042060445 8:64811201-64811223 TCTCATGAGGCCATTGTTCAAGG + Intergenic
1042100817 8:65273165-65273187 TCTTATTTATCCTTGTTTCAGGG - Intergenic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043430263 8:80187509-80187531 TAGGATTTGGCCATGGTTCAAGG - Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1046460339 8:114525683-114525705 TATTTTTGGGCCATGGTTGATGG - Intergenic
1047792207 8:128215334-128215356 TTTTATTTGGCTATAATTCATGG - Intergenic
1048462246 8:134630797-134630819 TTTTAACTTGCCATGGTTCAGGG + Intronic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051454435 9:17238424-17238446 TCTTTTATGACCATGCTTCATGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052467659 9:28850510-28850532 TCTTTTTTGTCCATAGTTCATGG - Intergenic
1053438829 9:38096556-38096578 TCTTCTTTGGCCCTGCTTCAGGG - Intergenic
1053558141 9:39159726-39159748 TTTTTTTTGGCCATTGTCCAAGG + Intronic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1053822259 9:41979962-41979984 TTTTTTTTGGCCATTGTCCAAGG + Intronic
1054138973 9:61459200-61459222 TTTTTTTTGGCCATTGTCCAAGG - Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1054608315 9:67207416-67207438 TTTTTTTTGGCCATTGTCCAAGG - Intergenic
1054742314 9:68819739-68819761 TCTTATTTGTCCCTGCTACATGG + Intronic
1054907165 9:70421238-70421260 TCTTTTTTGGCCAGGATTCTGGG + Intergenic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1055542899 9:77332521-77332543 TCATATTTGTTCATTGTTCAGGG + Intronic
1055569715 9:77604231-77604253 TCTTATTTGGCTGTGGTTTTGGG - Intronic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056979237 9:91293040-91293062 TCCTATGTGGGCGTGGTTCATGG - Intronic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1057636022 9:96767887-96767909 TTTTATCTGGCTTTGGTTCAAGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058164543 9:101605151-101605173 TCTTTGCTGGCCATGGTACATGG + Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058260871 9:102829716-102829738 TGTTATGTGGGCATGGCTCATGG - Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061768983 9:132902933-132902955 TCTTACTTGGCCTTAGGTCAAGG + Intronic
1061920711 9:133780840-133780862 TCTGTTTTGGACATGGATCATGG + Intronic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185523260 X:757719-757741 ACTTATTTTGCCATGGTTCATGG + Intergenic
1186127145 X:6426276-6426298 TCTCTTTGGGCCATGGTTCCAGG + Intergenic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186942727 X:14528787-14528809 TCTTTTCTTGCCATGGTTAAAGG - Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188432648 X:30122507-30122529 TCTTATGTAGGCATAGTTCATGG - Intergenic
1188654725 X:32678703-32678725 TCTTTTTTGGTCATGGGGCAGGG - Intronic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189263715 X:39697294-39697316 TCTTATGTGGTCACAGTTCATGG + Intergenic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193652203 X:84150641-84150663 TCTTATGTGTGCGTGGTTCATGG + Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198676101 X:139132903-139132925 TCTTCTATGGCCATAGGTCAAGG + Intronic
1198764203 X:140064323-140064345 TCTTTTTTGGTCCTTGTTCATGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic