ID: 905149580

View in Genome Browser
Species Human (GRCh38)
Location 1:35917195-35917217
Sequence CTCCAAGAGCAGACAGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905149580_905149587 30 Left 905149580 1:35917195-35917217 CCACAACCTGTCTGCTCTTGGAG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 905149587 1:35917248-35917270 TCCTGTGTGAAACTAACTTTGGG 0: 1
1: 0
2: 1
3: 13
4: 171
905149580_905149586 29 Left 905149580 1:35917195-35917217 CCACAACCTGTCTGCTCTTGGAG 0: 1
1: 0
2: 0
3: 12
4: 180
Right 905149586 1:35917247-35917269 ATCCTGTGTGAAACTAACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905149580 Original CRISPR CTCCAAGAGCAGACAGGTTG TGG (reversed) Intronic
900559150 1:3295103-3295125 CTCCCAGGGCACCCAGGTTGTGG + Intronic
900918102 1:5652402-5652424 CGGCAAGAGCTGACACGTTGTGG + Intergenic
904315426 1:29656914-29656936 CTTCAGCAGCAGACAGGTGGAGG + Intergenic
905149580 1:35917195-35917217 CTCCAAGAGCAGACAGGTTGTGG - Intronic
905207503 1:36351285-36351307 CTCAAGGAGCAGACAGGGGGAGG - Intronic
906891802 1:49724645-49724667 CTCCAAGTACAGACAAATTGGGG - Intronic
907308582 1:53526979-53527001 CTCCAAGTGCAGACGGGCAGGGG - Intronic
911804417 1:102187416-102187438 CTCCAAGAGCAGAAACATTAGGG - Intergenic
912214401 1:107591134-107591156 CTACAAGAGCTGACAGGGTGTGG - Intronic
914004834 1:143723387-143723409 CTCCAAGATCCCACAGGGTGTGG - Intergenic
916496815 1:165354782-165354804 CTCCAAGGGCAGAGTGGGTGGGG + Intronic
919551627 1:198996616-198996638 CCTCAAGAGCAGACACGTTTTGG + Intergenic
920201478 1:204262315-204262337 CTGCAACTGCAGACAAGTTGTGG + Intronic
922246460 1:223803150-223803172 CTTAAAGAGAAGGCAGGTTGTGG - Intronic
922566877 1:226606810-226606832 CTCAATGAGCAGCCAGGTAGTGG + Exonic
922802085 1:228369026-228369048 CTGCAGGAGGAGACAGGTTCAGG - Intronic
1065925534 10:30431871-30431893 CTCCAAGATCAGAAAGGCGGAGG + Intergenic
1067178463 10:43967018-43967040 CTCTGAGGGCAGACAGGTTCAGG + Intergenic
1068398287 10:56493554-56493576 CTCCAAGAGCTAAGAGGATGAGG - Intergenic
1069294262 10:66824655-66824677 CTTCAAAAGCAGACAGTATGTGG + Intronic
1071978961 10:90984311-90984333 CTCCGGGAGCACACAGGTAGGGG - Intergenic
1075466520 10:122655561-122655583 CTCCAAGAGGACACTGCTTGGGG + Intergenic
1075831960 10:125419418-125419440 CTCCAGGAGGAGACAGGGGGCGG + Intergenic
1083230432 11:61314369-61314391 CTGCAATAGCAGCCAGGTGGTGG - Exonic
1084006248 11:66325094-66325116 ATCCAGAAGCACACAGGTTGGGG - Intergenic
1084218514 11:67664389-67664411 CTCCAACAGCAGCCAGGTGGGGG - Exonic
1084269795 11:68022746-68022768 CTCCAACAGCAGCCAGGTGGGGG + Exonic
1084501151 11:69536180-69536202 CTCAGTGAGCAGACAGGATGCGG - Intergenic
1084941728 11:72616749-72616771 CTCCACGTGCAGACCGGGTGGGG + Intronic
1088846810 11:113675194-113675216 CCCCAGGAGCTGACAGTTTGAGG + Intergenic
1089031303 11:115332244-115332266 ATGGAAGAGAAGACAGGTTGAGG + Intronic
1090414134 11:126529134-126529156 CTCCAAGAGGACACAGGACGGGG - Intronic
1091999329 12:5019577-5019599 CACCAAGGGCAGGCAGGATGGGG + Intergenic
1092312028 12:7368022-7368044 CACCAAGGGCACACAGGATGGGG - Intronic
1092699949 12:11217383-11217405 CACCAGCAGGAGACAGGTTGGGG + Intergenic
1096655604 12:53089544-53089566 CTCCAAAAGAAGATATGTTGCGG + Intergenic
1097989053 12:65815373-65815395 CTCCAACTGCATCCAGGTTGTGG - Intergenic
1100649942 12:96574252-96574274 CTCCTACAGAAGACATGTTGAGG - Intronic
1100997710 12:100320600-100320622 CCCGAAGAGGAGACAGGATGAGG - Intronic
1103261855 12:119594878-119594900 CACCAAGAGAAGAGAGGTTAGGG - Intronic
1104433096 12:128732688-128732710 CTCCTAGAGCAGGCAGTTGGGGG - Intergenic
1104642065 12:130473727-130473749 CTCCAGGAGCACACAGGATTAGG + Intronic
1106203766 13:27569138-27569160 CTCCAGAAGCAGACTGTTTGGGG - Exonic
1106807448 13:33325303-33325325 CTCCAAAAGGAAACAGGATGAGG + Intronic
1106940448 13:34772363-34772385 ATCAAAGAGCAGAAAGGTTTAGG - Intergenic
1112458526 13:99583259-99583281 CTCCAAGACCAGAGGGGTTTGGG + Intergenic
1113885708 13:113657420-113657442 CTCCAAGGCCACACAGGTGGTGG - Intronic
1114766517 14:25377378-25377400 CTCCAAATGCAGTCACGTTGGGG + Intergenic
1117458798 14:55924496-55924518 CACCAAGAAAAGAAAGGTTGAGG - Intergenic
1118685322 14:68285051-68285073 CTACCACAGCAGACAGGTTGGGG + Intronic
1118768666 14:68927348-68927370 CTCCAAGAGCTCCCAGGCTGGGG - Intronic
1202833399 14_GL000009v2_random:59582-59604 CTCCATCAGCTGTCAGGTTGTGG - Intergenic
1124399596 15:29336656-29336678 CTCCAAGTGCAGGCAGATTCAGG - Intronic
1125759990 15:42089710-42089732 CTCCAAGACAAGACAGGTGAAGG + Intronic
1129238150 15:74236145-74236167 CACCAAGAGCAGGAAGGGTGGGG + Intergenic
1129880449 15:79003294-79003316 CTCCAGGGGCACAGAGGTTGGGG - Intronic
1130919500 15:88332404-88332426 CTCCCAGAGAAGAGAGATTGGGG + Intergenic
1135592069 16:23712008-23712030 CTCCTTGAGCAAACAGGGTGAGG + Intronic
1136300409 16:29330238-29330260 CTCAAGGCACAGACAGGTTGGGG + Intergenic
1137309891 16:47244721-47244743 CTCCAAGAACAGCCACATTGGGG - Intronic
1137549579 16:49428025-49428047 CTCCAAGAGCAGGCTGGGTGGGG - Intergenic
1138563368 16:57815483-57815505 GTCCCAGATCAGCCAGGTTGGGG - Intronic
1143132851 17:4691424-4691446 CCCCAAGAGCTGAAAGGTTCTGG + Exonic
1144891084 17:18494717-18494739 CACCAGGAGCAGACAGCTGGTGG - Exonic
1144992745 17:19245084-19245106 CTCCAAAATCAGACAGGTGTGGG - Intronic
1145141139 17:20449601-20449623 CACCAGGAGCAGACAGCTGGTGG + Intronic
1145794787 17:27649332-27649354 CACCAGGAGCAGACAGCTGGTGG - Exonic
1145903852 17:28505949-28505971 CTCCATGAGCATACATGTGGCGG + Intronic
1146063773 17:29620390-29620412 CTGAAAGAGCAGACATATTGGGG + Intronic
1146460660 17:33043738-33043760 CTTCACAAGCAGGCAGGTTGTGG - Intronic
1147314598 17:39613621-39613643 CTCCTAAAGCAGAAAGGCTGAGG + Intergenic
1148478673 17:47945926-47945948 CCCCAAGAGCAGCCAGATTGGGG + Exonic
1148962241 17:51402946-51402968 CTGCAAGTGGTGACAGGTTGTGG + Intergenic
1151657685 17:75503318-75503340 CTCCAAGAGAAGACAGTATGGGG - Intronic
1152275255 17:79352834-79352856 TTCCCAGTGCAGACAGGGTGGGG - Intronic
1154492693 18:14933619-14933641 CTCCAGGTGCAGACAGGGAGGGG + Intergenic
1156574329 18:38297041-38297063 TTCCAAGAGCAAACAGCTGGTGG - Intergenic
1160246913 18:77166460-77166482 CTCCAAGAAAAGGCAGGTGGAGG + Intergenic
1160620668 18:80168192-80168214 CTCCCACTGCAGACAGGCTGAGG - Intronic
1160828369 19:1091155-1091177 CTCGATGAGCAGAGAGGCTGGGG - Intronic
1161256669 19:3313690-3313712 CTCCAAGCAGAGACAAGTTGGGG - Intergenic
1162967410 19:14162498-14162520 CCCCAAGAGCTCACAGGATGGGG + Intronic
1165170812 19:33890388-33890410 CACCTAGAGCACACAGGGTGAGG + Intergenic
1168613702 19:57820964-57820986 CTGGAAGAGCACACAGGCTGAGG + Intronic
926051627 2:9748761-9748783 CTCCAAGAACAGAGAGCCTGGGG - Intergenic
929992879 2:46804281-46804303 CTCCAAGAGCAGTCAGGCCGGGG + Intergenic
930743847 2:54860887-54860909 CTCCCAGAGCAAAGAGGTTTAGG - Intronic
932666836 2:73705036-73705058 CACCAACAGCAGAAAGGTGGGGG + Intergenic
934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
936462467 2:112723203-112723225 AACCAAGAGCAGACAGGTCAGGG - Intronic
937160755 2:119759410-119759432 CTCCAGGAGCACTGAGGTTGGGG + Intergenic
937236068 2:120432553-120432575 CACCAATAGCAAACATGTTGGGG + Intergenic
937885185 2:126894753-126894775 CTCCATGAGAAGACAGGCAGCGG + Intergenic
938083936 2:128385901-128385923 GTCCAAGAGCAGACAAAATGAGG - Intergenic
938127703 2:128686368-128686390 CTCCGGGAGCAGAGAGGGTGTGG - Intergenic
939707058 2:145468175-145468197 CTGGTAGAGCAGGCAGGTTGTGG - Intergenic
939722140 2:145667161-145667183 TGCCAAGAGGAGACAGCTTGTGG + Intergenic
939829367 2:147053851-147053873 CGCCAAGAGGAGTCAGGCTGGGG + Intergenic
940988463 2:160073750-160073772 CTCTTGTAGCAGACAGGTTGAGG + Intergenic
941714934 2:168754046-168754068 CCCCTAGAGCAGACAGCATGAGG + Intronic
942127720 2:172844227-172844249 TTCCAAGAGAGGACAGGGTGAGG - Intronic
943064466 2:183071660-183071682 CACCAACCGCAGCCAGGTTGAGG - Intergenic
944449469 2:199826239-199826261 CTCCAATTGCAGACAGCTGGGGG - Intronic
948161937 2:235831954-235831976 CACCAAGTGCTGACAGGATGTGG - Intronic
949030498 2:241794633-241794655 CTCCAACAGCAGGAAGTTTGAGG + Intronic
1168867027 20:1095374-1095396 CTCAAGGGGCAGACAGGATGGGG + Intergenic
1170133027 20:13043284-13043306 CTACAAGGGCAGGAAGGTTGGGG - Intronic
1170603568 20:17859716-17859738 CTCCAGCAGCAGAGAGGATGTGG - Intergenic
1171207415 20:23291977-23291999 CACCAGGAGCCGACAGGCTGAGG + Intergenic
1173734154 20:45347935-45347957 CGCCCAGAGCAGACAGCTTTAGG - Intronic
1175196173 20:57244749-57244771 CCCCAAGAGCAGCCAGGTGGGGG + Intronic
1175995360 20:62809858-62809880 CACCAAGAGCCCACAGATTGGGG - Intronic
1177080568 21:16633975-16633997 CCCCAAGTGCAGGGAGGTTGGGG + Intergenic
1178239036 21:30877916-30877938 ATCTGAGAGTAGACAGGTTGGGG - Intergenic
1180709557 22:17830674-17830696 CTCCTAAGGCAGACAGGGTGTGG + Intronic
1181148824 22:20867973-20867995 CACTCAGAGCAGCCAGGTTGGGG - Intronic
1183017347 22:34999960-34999982 TCCCAAGAGGAGACAGGATGTGG + Intergenic
1183689069 22:39377952-39377974 CTCCAGGAGCCCACAGGCTGGGG + Intronic
1185169668 22:49285509-49285531 CTGCAGGAGCAGACAGGCTCAGG + Intergenic
950224244 3:11220700-11220722 CTTAAAGAACAGACAAGTTGAGG + Intronic
950914810 3:16633701-16633723 CTCAAAGAGAAAACAGGCTGAGG + Intronic
952851585 3:37734061-37734083 CGCCAAGATCACACAGTTTGTGG - Intronic
953906709 3:46872098-46872120 CTCCCAGTGCAGCCAGGGTGGGG + Intronic
954225280 3:49177212-49177234 TTCCCAGAGGAGAAAGGTTGTGG + Intergenic
959621047 3:108398701-108398723 CTGCAAGAGCAGACAGAGCGTGG - Exonic
960438367 3:117655659-117655681 CTGCAAGAGCAGAGAGGATGAGG + Intergenic
960902607 3:122567060-122567082 CCCCAAGAGCTGACATTTTGAGG + Intronic
961007072 3:123412294-123412316 CCCCAACAGGAGACAGGGTGTGG + Intronic
961216403 3:125163852-125163874 CTCCTGGAGCACACAGGGTGAGG - Intronic
961657819 3:128453061-128453083 CTCCAGGACCACACAGGTTGGGG + Intergenic
964237784 3:154554176-154554198 TTCCAGGACTAGACAGGTTGGGG + Intergenic
968169448 3:196498092-196498114 CACCAACAGCATACAGGTTCTGG - Intronic
969568889 4:7996357-7996379 CTCCAGGGGCAGGCAGGTAGAGG - Intronic
969715664 4:8867137-8867159 TTCCAGGAGCAGGCAGGCTGGGG - Exonic
971202981 4:24530134-24530156 CTCCAAGAGCAGGCAGTGTTAGG + Intronic
973293792 4:48493772-48493794 CACCAAGAGCAGAGTGGTTAAGG - Intronic
975083336 4:70306918-70306940 CTCCAAGTGCAGTCACATTGAGG + Intergenic
980021161 4:127711785-127711807 CTCCAATGCCAGAAAGGTTGGGG + Intronic
983871828 4:172832653-172832675 CCCCAGGAGCAGACAGCCTGAGG + Intronic
985533526 5:448149-448171 ATCCCAGAGCAGAAGGGTTGAGG + Intronic
985871921 5:2564037-2564059 CTCCAGGTGGAGACAGGTGGGGG - Intergenic
986104036 5:4642960-4642982 AACCAAGAGCTGACAGGTGGTGG + Intergenic
994066168 5:95545237-95545259 TTCCAAGTGGGGACAGGTTGTGG - Intronic
999188966 5:149732210-149732232 CCCCCAGAGCCGACAGCTTGGGG + Intronic
1003089392 6:3088760-3088782 TTCCAAGATCAGACAAGTTTGGG + Intronic
1003307535 6:4943203-4943225 CTTCGAGGGAAGACAGGTTGGGG + Intronic
1004424163 6:15496542-15496564 CTCCAAGAGGAGACTGGAAGAGG + Exonic
1006613353 6:35309060-35309082 CTCCCAGAGCAGACACGCTTAGG + Intronic
1007208362 6:40171050-40171072 CTGCAAGAACAGACAAGTTATGG - Intergenic
1007745674 6:44041607-44041629 CTGCAAGGGCAGGGAGGTTGAGG + Intergenic
1011984115 6:93420142-93420164 CTCCAAGAGCCGTCAGTTTTAGG + Intergenic
1012071949 6:94632905-94632927 CTCCAAGAACAGGGAGGTTAGGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013863996 6:114672783-114672805 CTGCAAGAGCAGATAGGTAATGG - Intergenic
1014312890 6:119827661-119827683 CTCCAATTGCATCCAGGTTGTGG + Intergenic
1014481710 6:121947097-121947119 CACCAACAGCAAACAAGTTGAGG - Intergenic
1014618358 6:123633243-123633265 CTCAAACAGCACACAGGTTTAGG - Intronic
1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG + Intergenic
1018804761 6:167249924-167249946 CTCCAAGTGGAGACATGTCGAGG - Intergenic
1018979165 6:168589332-168589354 TTCCCAGAGCAGACTGGATGTGG + Intronic
1019730006 7:2624338-2624360 CTCCAAGAGCAGAGACCTTTCGG - Intergenic
1021555293 7:21912695-21912717 CTCCATGAGCAGACACCATGGGG + Intronic
1023611253 7:41973246-41973268 TTCAAAGAGCAGAAAGGTTCTGG - Intronic
1024596283 7:50940465-50940487 GTCCATGGGCAGACAGGTGGGGG + Intergenic
1025035796 7:55591880-55591902 CTCCAGGAGCAAAGAGATTGGGG - Intergenic
1025992675 7:66507375-66507397 CTGCAAGAACACACAGGTTCTGG - Intergenic
1026570122 7:71522124-71522146 CTCCAAGAGAAGACAAAGTGTGG - Intronic
1027239651 7:76318606-76318628 CTGCAAGAGCCCCCAGGTTGGGG + Intergenic
1027515653 7:79138605-79138627 CTCCAAGACCAGTCACATTGGGG - Intronic
1031059459 7:117034023-117034045 CACCAAGAGCCCAGAGGTTGAGG - Intronic
1031335125 7:120519462-120519484 TCCCAAGCTCAGACAGGTTGTGG - Intronic
1032257242 7:130306950-130306972 CTCCAAGATCAGACAATTAGTGG - Intronic
1033582718 7:142751680-142751702 GTCCATGAGCAGAGAGCTTGAGG + Intronic
1035073205 7:156159717-156159739 AAGCAAGAGCAGACAGGCTGGGG + Intergenic
1037599423 8:20381476-20381498 CTGCAAGGGCTGCCAGGTTGGGG + Intergenic
1037753872 8:21699256-21699278 ATCCAGGAGCAGACAGGAGGAGG + Intronic
1039254893 8:35708197-35708219 CTCCATGAGCAGGCAGGCAGAGG + Intronic
1051061708 9:13052991-13053013 CTCCAAGAGGAGACAAAATGTGG - Intergenic
1051497956 9:17745825-17745847 CTTCAATAGCAGCTAGGTTGAGG - Intronic
1056786906 9:89599286-89599308 CCTCCAGAGCAGTCAGGTTGAGG + Intergenic
1057526973 9:95811469-95811491 CTCCAAGAACTCACAGCTTGGGG - Intergenic
1059179356 9:112197388-112197410 CTCCAAATGCAGTCACGTTGTGG - Intergenic
1059493947 9:114694057-114694079 CTGCAAGTGCAGACAGGTTTGGG - Intergenic
1062295778 9:135825742-135825764 CGCCAGGTGCAGACAGGCTGGGG + Intronic
1185547414 X:956475-956497 CTCCCAGAACAGAAAGGTGGAGG - Intergenic
1186253341 X:7692924-7692946 ATCCCAGAGCAGAAAGGCTGAGG + Intergenic
1186999742 X:15163977-15163999 CTCTGAGAGCAGACAGCTAGAGG + Intergenic
1194217426 X:91148131-91148153 CTCCAATGGCAGAAGGGTTGCGG + Intergenic
1195246971 X:103003622-103003644 TTCCTAGAGGAGAGAGGTTGAGG - Intergenic
1197711519 X:129674052-129674074 CTACAATAGCACAGAGGTTGTGG - Intergenic
1200083260 X:153589885-153589907 CTCCAGGAGCACACAGGTCATGG - Intronic
1200553939 Y:4611923-4611945 CTCCAATGGCAGAAGGGTTGCGG + Intergenic