ID: 905150258

View in Genome Browser
Species Human (GRCh38)
Location 1:35921543-35921565
Sequence TCCAGCTGGCCTCCAAGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905150258_905150264 -1 Left 905150258 1:35921543-35921565 CCCAGGCTTGGAGGCCAGCTGGA 0: 1
1: 0
2: 3
3: 34
4: 323
Right 905150264 1:35921565-35921587 AGGAAGAAGGGTCTAAATCCTGG 0: 1
1: 0
2: 1
3: 7
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905150258 Original CRISPR TCCAGCTGGCCTCCAAGCCT GGG (reversed) Exonic
900346454 1:2212743-2212765 TCCCGCTAGACTCCCAGCCTGGG - Intergenic
901807923 1:11749590-11749612 TCCAGATGGCCTCGGAGGCTGGG - Intronic
901853746 1:12031410-12031432 TCCAGATCGCATCCTAGCCTGGG + Intronic
901855444 1:12041669-12041691 CCCTGCGGGCCTCCAAGCCTGGG + Intergenic
902379386 1:16045482-16045504 CCCAGCAGGCCTCCAAGGATGGG + Intronic
902587255 1:17447635-17447657 TGCAGCTGGGCCCAAAGCCTTGG - Intergenic
902818914 1:18931760-18931782 TCCATATGGCTCCCAAGCCTGGG + Intronic
903185259 1:21625183-21625205 GCCATCTGCCCTCCCAGCCTAGG + Intronic
903190011 1:21651164-21651186 TCCTCCAGGCCTCCAAGCCCAGG + Intronic
903928750 1:26850167-26850189 ACCAGCTGGCTCCCAGGCCTTGG - Intronic
904270909 1:29349484-29349506 TCCATGTGGCCCCCAAGCCCAGG - Intergenic
904425391 1:30419459-30419481 TTCATGTGGCCTCCAAACCTGGG + Intergenic
904801183 1:33093940-33093962 TCAAGCTGGTCTCAAAGTCTTGG + Intronic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905166865 1:36088182-36088204 TCCTGCAGTCCTCCAAGGCTAGG - Exonic
905675868 1:39824683-39824705 TCCAGGTGGCCTGCATTCCTCGG - Intergenic
906212760 1:44021254-44021276 GCCAGGGTGCCTCCAAGCCTGGG - Intronic
906626997 1:47333718-47333740 GCCAGCTTTCCTCCAACCCTTGG - Intergenic
908500159 1:64734903-64734925 TCCAGCTGGCTTCCTGGCCTTGG - Intergenic
911278410 1:95893117-95893139 TTAAAATGGCCTCCAAGCCTGGG - Intergenic
912805919 1:112757080-112757102 TCCAGCTGGCCTCCTCCCCCTGG + Intergenic
914197071 1:145453058-145453080 TCCATCTGGGCTCTGAGCCTCGG + Intergenic
916306918 1:163346642-163346664 TCAAGCTGGTCTCCAACTCTTGG - Intronic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
917441316 1:175071382-175071404 GGCAGATGGCATCCAAGCCTTGG - Intronic
919866632 1:201787857-201787879 TCCATCTGACCTTCAAGCCGGGG + Intronic
920306196 1:205019713-205019735 TCCATCTGGTCACCAAGGCTGGG + Exonic
920580607 1:207103972-207103994 TCCAGCTAGCCTGGAAACCTTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923552364 1:234974036-234974058 GCCAGCTGGAGTCCAAGCCTTGG + Intergenic
924713997 1:246555376-246555398 TCAGGCTGGCCTCCAACTCTGGG - Intronic
1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG + Intergenic
1064055503 10:12093922-12093944 GCCAGCTGGTCTCCAAAGCTGGG + Intronic
1064559002 10:16577258-16577280 TCCAGCTTCCCTCCAGGCCAGGG - Intergenic
1065589605 10:27251631-27251653 TCCAGCTGACCTCTAACCCCCGG - Intergenic
1066453569 10:35553098-35553120 TCCTGCTGGCCTCCAAGGTGTGG + Exonic
1068228006 10:54132028-54132050 TGAAGCTGGCCTTAAAGCCTAGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069855753 10:71440090-71440112 ACCAGCTGTCCCCAAAGCCTGGG + Intronic
1069928079 10:71865197-71865219 TCCTGCTGGGCACCAACCCTTGG + Intergenic
1069961816 10:72083648-72083670 CCCAGCGAGACTCCAAGCCTGGG - Intronic
1070803418 10:79256471-79256493 TCCAGCTGGTCTGGAAGGCTGGG - Intronic
1073006792 10:100330670-100330692 TTCAGCTTTCCTCCCAGCCTTGG - Intergenic
1073124221 10:101139912-101139934 CCAAGCTGGCTCCCAAGCCTGGG + Intergenic
1073301844 10:102475666-102475688 GCCCACTGTCCTCCAAGCCTTGG - Intronic
1075018226 10:118926927-118926949 TCCAGCTTACCTCCAATCCTGGG + Intergenic
1075265399 10:120996560-120996582 TCGTGCTATCCTCCAAGCCTGGG - Intergenic
1075746991 10:124734910-124734932 TCCCTCTGTCCTCCAAGCCAAGG + Intronic
1076159787 10:128234898-128234920 GCCATCTGGCCTCCAGGCCCAGG - Intergenic
1076817110 10:132920478-132920500 TCCAGCTGCCCTCCAAGCAGAGG + Intronic
1076876349 10:133218085-133218107 TCCAGCTGGACGCCATGCCCCGG - Intronic
1077219862 11:1411100-1411122 CCCAGCTGGTCTCCAAACCTGGG - Intronic
1077340723 11:2025215-2025237 TCCAGCTGACATCCAGGCCGGGG + Intergenic
1077482782 11:2824341-2824363 TCCAGCTCGTCCCCAAGTCTGGG - Intronic
1078797438 11:14606930-14606952 TCCAGCTGGTCTGTATGCCTGGG - Intronic
1079393558 11:20042853-20042875 TCCAACTGGCCTCAAACCCCAGG + Intronic
1080721999 11:34858922-34858944 TCCAGCTGGTCTCGAACCCCTGG + Intronic
1081692797 11:45089487-45089509 CCCAGCTGGCCTCCAAGGCCAGG + Intergenic
1082079375 11:48000353-48000375 CACAGCTGGCCTCCAAGTCCTGG + Intronic
1083008275 11:59368938-59368960 TCCAGCTGTCCTGTAAGCCTAGG + Intergenic
1083318739 11:61832363-61832385 TGGAGCTGCCCTCCAGGCCTGGG - Intronic
1083852463 11:65376350-65376372 TCAAACTGGCCTCCAGGCCGTGG + Exonic
1084440033 11:69167551-69167573 TCCAGCTGGTCTTCGGGCCTGGG - Intergenic
1084586371 11:70065166-70065188 TCCTGTTTGGCTCCAAGCCTAGG + Intergenic
1084647220 11:70465510-70465532 GCCAGCTGCCCTCCTGGCCTTGG - Intergenic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1085738429 11:79059268-79059290 TTCTGCGTGCCTCCAAGCCTTGG + Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1086768801 11:90734183-90734205 TCCAGCTGGTATCTAAGGCTAGG - Intergenic
1088720145 11:112585017-112585039 GCCAGGTGGCCTCCAGGCCTAGG + Intergenic
1090381176 11:126328643-126328665 CCCAGCCGGGCTCCCAGCCTGGG - Intronic
1090402464 11:126458002-126458024 TCCTGGTGGCCCCCAGGCCTCGG + Intronic
1202823708 11_KI270721v1_random:80404-80426 TCCAGCTGACATCCAGGCCGGGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096513531 12:52144681-52144703 CCCAGCTGGTCTCCCTGCCTGGG - Intergenic
1096513558 12:52144749-52144771 TCCAGCTGCCATCCAGGCCCAGG - Intergenic
1096684977 12:53282313-53282335 TCCAGAAGTCCTCCAAGGCTTGG + Exonic
1097209301 12:57353622-57353644 TCAAGCTGGCCTCAAACTCTTGG + Intronic
1098337012 12:69414776-69414798 TCCATCTGGCTTCAAAGTCTAGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099436813 12:82655925-82655947 GCCAGCTGGTCAGCAAGCCTGGG - Intergenic
1100379351 12:94047223-94047245 TCCAGCTGGTTTCCCAGGCTGGG + Intergenic
1100509315 12:95253888-95253910 CCCAGCTGGTCTCCAACACTTGG - Intronic
1102170858 12:110841572-110841594 TGAAGCTGGACCCCAAGCCTTGG + Intergenic
1102589714 12:113948052-113948074 TTGACCTGACCTCCAAGCCTGGG - Intronic
1103713500 12:122929817-122929839 CCCAGCTGCCCTCCGAGCCCAGG - Exonic
1104048898 12:125183622-125183644 GCCTGCTGGCCTCATAGCCTGGG - Intergenic
1106675428 13:31953114-31953136 TCCTGCTGGACTTCAAGCCTTGG + Intergenic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1108072449 13:46642057-46642079 TCCTGCTGGAATCCCAGCCTAGG - Intronic
1110702218 13:78562304-78562326 ACCTGCTGGCCTCTGAGCCTGGG - Intergenic
1113097299 13:106679542-106679564 CCCAGCAGGGCTCCAGGCCTAGG - Intergenic
1113675538 13:112204536-112204558 CGCAGCTGGCCTCCAAGCTGTGG + Intergenic
1114007601 14:18331901-18331923 TGCTGCTGCACTCCAAGCCTGGG - Intergenic
1114168640 14:20248410-20248432 TCCAGCTGGTCTCCAACTCCTGG - Intergenic
1114565834 14:23632161-23632183 TCCTGCTGTCCTCCCAGCCAAGG + Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1119338127 14:73851858-73851880 CCCAGCTCGCCCCCAGGCCTCGG - Exonic
1121221397 14:92288266-92288288 TCCAGCTTTGCTCCAAGCCTGGG + Intergenic
1121407171 14:93726110-93726132 GCCTGCTGCCCTCCAAGCCCAGG - Intronic
1121951035 14:98171442-98171464 TCCAGGTGGCTTCCAAGGCAAGG + Intergenic
1122280713 14:100620688-100620710 TCCTGCTGGCCTCCAAAGCCCGG - Intergenic
1122904252 14:104794874-104794896 CCCAGCTGCCCTCCAAGCCTTGG + Intronic
1123948166 15:25248856-25248878 CCCTGCTGGCCACCAAACCTTGG - Intergenic
1124464660 15:29925991-29926013 TCCTGGTGGCCAGCAAGCCTTGG + Intronic
1127610981 15:60636228-60636250 TTCACCTGTCTTCCAAGCCTGGG - Intronic
1127927018 15:63556572-63556594 TCCAGCTGCCCTCAACACCTAGG - Intronic
1129151532 15:73691593-73691615 TGGAGCTGTCCTCCCAGCCTAGG - Intronic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1129219613 15:74123928-74123950 TCCAGCTGGCCTCAAATCCTGGG - Intronic
1129233307 15:74208766-74208788 CCCACCTGGCCTCCCAGACTTGG + Intronic
1129709748 15:77814727-77814749 TCCATCTGGCATCCAAGCCCAGG + Intronic
1131291458 15:91110590-91110612 GCCAGCTGGGCTCCATTCCTCGG - Intronic
1132693645 16:1192670-1192692 TCCAGGTAGCCCCCTAGCCTAGG + Intronic
1133216232 16:4294151-4294173 TACAGCTGGCCCTCCAGCCTCGG + Intergenic
1133321803 16:4918813-4918835 TCCTGCTGGCTTCCTAGCATGGG - Intronic
1133360099 16:5167298-5167320 CCCAGCAGCCCACCAAGCCTTGG - Intergenic
1134246891 16:12546883-12546905 TCCAGCTGCACTCCTAGCCCTGG - Intronic
1134915810 16:18069939-18069961 TCAAGCTGGCCTCCAGGCCTGGG - Intergenic
1135659093 16:24278993-24279015 TCCATCTAGCCTCCAGACCTTGG - Intronic
1138398986 16:56730388-56730410 TGCAGCCCGACTCCAAGCCTCGG - Intronic
1138602261 16:58063097-58063119 TCCACTTGCCCTCTAAGCCTGGG + Intergenic
1138607846 16:58100050-58100072 ACCCGCCTGCCTCCAAGCCTGGG + Intergenic
1141177295 16:81729559-81729581 TCCAGCTGCTCTCCAGGCCTAGG - Intergenic
1141606932 16:85159078-85159100 TCCCACTGGGCGCCAAGCCTGGG + Intergenic
1142398588 16:89847392-89847414 GCCAGCCGGCCTCCCAGCCCTGG - Intronic
1142539632 17:648065-648087 ACCAGGGAGCCTCCAAGCCTAGG + Intronic
1144966374 17:19079169-19079191 CCCAGCTGGACTCCAGGGCTTGG - Intergenic
1144981544 17:19172888-19172910 CCCAGCTGGACTCCAGGGCTTGG + Intergenic
1144986680 17:19205351-19205373 CCCAGCTGGACTCCAGGGCTTGG - Intergenic
1145302921 17:21653496-21653518 TCCAGGTGGACATCAAGCCTCGG + Intergenic
1146224097 17:31050880-31050902 TCCAGCTGACCTCTAACCCCTGG - Intergenic
1146225183 17:31059773-31059795 TGCAGCTGGCCTACAGGCATAGG + Intergenic
1148342448 17:46881324-46881346 GCCAGCTGGTCTCCAGGCCCAGG - Intronic
1148463619 17:47851640-47851662 TCCAGTTCGCCTCTAGGCCTAGG + Intronic
1148759829 17:49993883-49993905 CCCGGCTCGCCTCCCAGCCTCGG + Intronic
1148927821 17:51102853-51102875 CCCAGCTGGCCTTGAATCCTGGG + Intronic
1150229083 17:63540065-63540087 CCCAGTTGTCCTCCAAGGCTGGG + Intronic
1150241441 17:63636860-63636882 TCCCGCTGGACATCAAGCCTTGG + Intronic
1150784602 17:68152307-68152329 TCCAGCTGACCTCTAACCCCCGG - Intergenic
1151054048 17:71011572-71011594 TTCAGATGGCCCCCAAGCTTTGG + Intergenic
1154529865 18:15332063-15332085 TGCCGCTGCACTCCAAGCCTGGG + Intergenic
1155183635 18:23369335-23369357 GCCAGCTGGCCTCCAGGTTTTGG - Intronic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1157570747 18:48710436-48710458 TCCCACTTGACTCCAAGCCTTGG + Intronic
1158120603 18:54044013-54044035 TCCAGCTGGTACTCAAGCCTGGG - Intergenic
1158546610 18:58403179-58403201 CCCAGCTGGGCTGCAAGTCTCGG + Intergenic
1160144041 18:76349515-76349537 TCCTGCTGGCCTGCACGCCAAGG + Intergenic
1160512687 18:79461306-79461328 TCCAGATGGCCACCATGTCTGGG + Exonic
1160912581 19:1481765-1481787 TCCAGCTGGCAGCCAGACCTGGG + Exonic
1160963766 19:1736614-1736636 ACCAGCCTGGCTCCAAGCCTGGG - Intergenic
1161285099 19:3464542-3464564 CCCAACTGACCTCCATGCCTAGG + Intronic
1161607234 19:5221926-5221948 TCCAGCTGATCTCCAATCCTAGG + Intronic
1162469354 19:10863124-10863146 TACAACTGGCCCCCAATCCTGGG + Intronic
1163293186 19:16394147-16394169 TCCACCTGCCCTCAAAACCTTGG + Intronic
1163421395 19:17215558-17215580 GCCAGGTGGCTTCCAACCCTAGG - Intronic
1164921781 19:32093790-32093812 TCCAGCTGTCTTCCATGCATGGG - Intergenic
1165385944 19:35510776-35510798 TCCAGCTCGACTCCAAGACACGG + Intronic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1165894210 19:39131723-39131745 AGCAGATGGCCTCCCAGCCTGGG - Intronic
1167876647 19:52419573-52419595 CCCAGCTGGTCTCCAACTCTTGG + Intergenic
1168384346 19:55950592-55950614 TCGAGCTGACCTCCTAGCCGAGG + Intronic
925288578 2:2731357-2731379 TCCAGCTGGCTCCCAAGGCCTGG - Intergenic
925411633 2:3643063-3643085 GCCAGCAGGCCTCCATGGCTTGG - Intronic
926794244 2:16605963-16605985 TCCATCTGGCCTTTAAGTCTTGG + Intronic
928238361 2:29564913-29564935 TATAACTGGCCTGCAAGCCTGGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931018230 2:58011025-58011047 ACTAGCTGGCCTCCATACCTTGG + Intronic
931802377 2:65771209-65771231 TCCAGCTGTGCTCCCAGCTTGGG + Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
933554061 2:83809955-83809977 TCTAGCTGGCCTCCAACTCTTGG - Intergenic
933633541 2:84682565-84682587 TCCAGCTGGCCTGCTAAACTTGG + Intronic
934490675 2:94760430-94760452 ACCCGCTGGGCTCCAAGCCCTGG - Intergenic
934734910 2:96685272-96685294 TCCAGCTGGGCTCCATGCTGAGG + Intergenic
935983942 2:108654316-108654338 TCCAGCTAACCTCAAAGCTTAGG - Intronic
936136377 2:109897969-109897991 TCCAGCTAACCTCAAAGCTTAGG - Intergenic
936208320 2:110473516-110473538 TCCAGCTAACCTCAAAGCTTAGG + Intergenic
937867591 2:126765587-126765609 TGCAGATGCCCACCAAGCCTGGG + Intergenic
938278599 2:130049575-130049597 ACCTGCTGGGCTCCAAGCCCTGG - Intergenic
938329576 2:130440434-130440456 ACCTGCTGGGCTCCAAGCCCTGG - Intergenic
938360372 2:130681069-130681091 ACCTGCTGGGCTCCAAGCCCTGG + Intergenic
938436775 2:131287777-131287799 ACCTGCTGGGCTCCAAGCCCTGG + Intronic
938528960 2:132163503-132163525 TGCCGCTGCACTCCAAGCCTGGG + Intronic
938936698 2:136133540-136133562 TCCAGATGGCTTCCAAGCGAGGG + Intergenic
939818063 2:146921078-146921100 CCCAGCTGGACTCAAAGCCTAGG - Intergenic
940156589 2:150663039-150663061 TCTACCTGGCCTCCAGGTCTTGG + Intergenic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
943124735 2:183782534-183782556 TCCACTAGGCCTCCAGGCCTGGG - Intergenic
945380563 2:209134838-209134860 TCCCCCAGGCCTCAAAGCCTAGG + Intergenic
946309941 2:218877892-218877914 TCCAGCTGGGCACCAGGACTGGG + Intergenic
946390752 2:219415657-219415679 TTCACCTGCCTTCCAAGCCTCGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947626714 2:231623778-231623800 CCCACCTGCCCACCAAGCCTTGG + Intergenic
948225626 2:236307309-236307331 TCCCGCGGGCCTCTAAGCCTGGG - Intergenic
1168795164 20:606349-606371 TCCAGCTGACCTCCAGACTTGGG - Intronic
1171055755 20:21904639-21904661 TGCAGCTGTCCTTCAAGGCTGGG - Intergenic
1173521169 20:43701356-43701378 CCCAGCTGGCCTCCACCCTTAGG + Intronic
1175763069 20:61574102-61574124 CCCAGCTGGCCTCGTGGCCTGGG + Intronic
1175900947 20:62359731-62359753 GCCAGCTGGGCTCCTGGCCTGGG - Intronic
1176108119 20:63399090-63399112 CCCAGCTGGTGGCCAAGCCTAGG - Intergenic
1176220340 20:63966653-63966675 CCCTGCCTGCCTCCAAGCCTGGG - Exonic
1176390586 21:6161112-6161134 TCCAGATGGCCCCCAGGCCGTGG - Intergenic
1177182129 21:17755920-17755942 TCCAGCTGGTCTCCAACTCCTGG + Intergenic
1179654938 21:42839058-42839080 TCAGGCTGGCCTCCAACTCTTGG - Intergenic
1179732881 21:43377127-43377149 TCCAGATGGCCCCCAGGCCGTGG + Intergenic
1180025342 21:45158006-45158028 TCCAGCTGGTGTCCAGACCTCGG + Intronic
1180432108 22:15262711-15262733 TGCTGCTGCACTCCAAGCCTGGG - Intergenic
1180965687 22:19786985-19787007 GCCAGGTGGTCTCCAAGCTTGGG + Exonic
1181604230 22:23970800-23970822 CCCAGCTGTCCTCCCAGCCTGGG + Intronic
1183186271 22:36293311-36293333 TCCCCCAGGCCTCCAAACCTGGG + Exonic
1183481939 22:38070026-38070048 ACCCGGTGGCCTCCAGGCCTGGG - Intronic
1184017076 22:41794374-41794396 TCCACGTGGCCTCCCAGCCTTGG + Exonic
1184355786 22:43978737-43978759 GCCAGGTGCCCTCCCAGCCTGGG - Intronic
1184644206 22:45887670-45887692 TCCAGGTGGCCTGCAGACCTCGG + Intergenic
1185385189 22:50528679-50528701 TCCAGCTGCACTCCTAGCCAGGG - Intronic
949261624 3:2108101-2108123 TACAGTTGGTCTGCAAGCCTGGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
952338421 3:32424743-32424765 TCCAGCAATCCTCCCAGCCTCGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954321944 3:49838287-49838309 TCCTGCTGGCCTGAAAGCCAAGG + Intronic
954640232 3:52093455-52093477 TCCCCCTGGCCCCCAAGCCTTGG + Intronic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
957072824 3:75579735-75579757 TCCAGCTGGTCTCCCGGCCAGGG + Intergenic
957190823 3:77007146-77007168 TCCAACTGGCATCAAAGCCTGGG + Intronic
960101292 3:113746048-113746070 GCAAGCCGGCCTCCTAGCCTGGG + Exonic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961557470 3:127706469-127706491 TCCTGCCGGCCACCAAGGCTGGG - Intronic
961668154 3:128506886-128506908 TCCAGCTGGCCTCACACCTTGGG + Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
964660838 3:159118620-159118642 ACCAGTTGGCTTCCAAGCCTAGG + Intronic
964769794 3:160212220-160212242 TCCAGTTGACTTCCAAGGCTAGG - Intergenic
968297972 3:197592084-197592106 ACCACCTGGCCTCTATGCCTGGG + Intergenic
968702519 4:2063643-2063665 TCCAGCTGGACACCAAGCCAGGG - Intronic
969657578 4:8507079-8507101 GCCTGCTGGCCTCCAGGCCCAGG - Intergenic
969737519 4:9001279-9001301 TCCAGCGGGTCTCCAGGCCAGGG - Intergenic
969796723 4:9532842-9532864 TCCAGCGGGTCTCCCAGCCAGGG - Intergenic
970436542 4:16041038-16041060 ACCAGCGGGTCTCCAAGCATGGG + Intronic
972393842 4:38640208-38640230 CCCAGCTGGTCTCAAACCCTAGG + Intergenic
973144285 4:46805121-46805143 TCGCGCTGGCCTCCAAGCACCGG + Intronic
973294558 4:48502501-48502523 TGCCACTGCCCTCCAAGCCTGGG + Intronic
973912118 4:55592035-55592057 TCCAGCTGGGCCCGAAGCCAAGG - Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
977586303 4:98779114-98779136 CCCAGCTGTGCTCCCAGCCTAGG - Intergenic
979364675 4:119806932-119806954 CCCAGCTGGTCTCCAACTCTTGG + Intergenic
980259996 4:130436250-130436272 TACAGATGGCCTCAAAGCCCTGG + Intergenic
980822468 4:138035744-138035766 TTCAGCTGGCCTGCCAGCATTGG - Intergenic
980981786 4:139660581-139660603 TCCTGATGCCCTCCAACCCTGGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981286766 4:143026745-143026767 TTCTGCTGGCCTGCAAACCTAGG - Intergenic
985143012 4:186862463-186862485 TCAAGCTGGCATACAAGACTGGG - Intergenic
985770943 5:1810320-1810342 CCCAGCAGGCCTCTAAGCCCAGG - Intronic
985785063 5:1889015-1889037 TCCAGCTTGCTTCAAAGCGTGGG + Intergenic
986536319 5:8791485-8791507 TCCATCTGACTTCCAAGGCTAGG - Intergenic
986600106 5:9464653-9464675 GGCAGATGGCATCCAAGCCTGGG - Intronic
986671939 5:10150402-10150424 TCCATCTGGACACCAAGCCCGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987196400 5:15530810-15530832 CCCAGCTGGCCCCAAAGCATGGG - Intronic
990042071 5:51388046-51388068 TCGCTCTGGCCTCCAAACCTTGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
993857764 5:93097268-93097290 TCCAGCTGGTGTCCAATGCTTGG - Intergenic
996727673 5:126686905-126686927 TCCAGCTGGGCTCCCTTCCTAGG + Intergenic
996985998 5:129565277-129565299 TCCAGATGGCCACAAAGCATTGG + Intronic
997424778 5:133795856-133795878 TCCACTTGGGCTCCAAGCTTTGG - Intergenic
999325434 5:150640791-150640813 TCCTGCCGGCCTTCAAGCCTTGG - Intronic
999739772 5:154541548-154541570 TCCAGCAAGCCTCTAAGCCACGG - Intergenic
1000359324 5:160432946-160432968 TCCAGCCGTCCTCCCAGGCTTGG - Intergenic
1001134388 5:169090369-169090391 GCCAGCTGACATGCAAGCCTGGG + Intronic
1001443106 5:171761230-171761252 TTCATCTGCCCTCCAAGGCTGGG + Intergenic
1001765516 5:174242839-174242861 TCCAGGTGGCCTCCTTCCCTAGG - Intronic
1001840887 5:174875806-174875828 TCCAGCTTTCCTCCCACCCTAGG - Intergenic
1002343949 5:178535347-178535369 TCCAACAGGCTGCCAAGCCTCGG + Intronic
1002388906 5:178893844-178893866 TGCTGCTAACCTCCAAGCCTTGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1003624806 6:7730980-7731002 TCCGGCTGGCTTACAAGGCTCGG - Intronic
1004800883 6:19145984-19146006 TTCAGATGTCCTCCAAGCCCTGG + Intergenic
1005126595 6:22453174-22453196 TCAAGCTGGCCTCTGAGCATAGG - Intergenic
1006522719 6:34581319-34581341 TCCAGCTGGCTCCCATCCCTAGG - Intergenic
1007233672 6:40373341-40373363 TCAAGCTGGCCTCAAACTCTTGG + Intergenic
1009807241 6:68616256-68616278 TACATCTTGCCTCCAAGTCTAGG - Intergenic
1010569905 6:77463872-77463894 TCTCGCTGGCCTGCAAGCTTTGG - Intergenic
1010570225 6:77465688-77465710 TCCCACTGGCCTCCATACCTCGG - Intergenic
1012624860 6:101393231-101393253 ACCAGCAGCCCTCCAAGCCCTGG + Intergenic
1013471656 6:110471948-110471970 TCCAGCTGGACTGCAGCCCTGGG + Intronic
1014784207 6:125599211-125599233 TGGTGCTGGCCTCCAATCCTTGG - Intergenic
1015029713 6:128580344-128580366 TCCTGCTGGACATCAAGCCTTGG - Intergenic
1018576604 6:165266339-165266361 AGCAGATGGCCTCCAAGCATGGG + Intergenic
1018808177 6:167277347-167277369 TCCAGCTGGCCTCTGACCATGGG + Intronic
1019551039 7:1602652-1602674 GCCATCTGACCTCCAAGGCTGGG - Intergenic
1019589777 7:1825216-1825238 TCCACCTGGCCTGCAACCCTCGG + Intronic
1019902336 7:4030716-4030738 TCCAGCTTGCGTCCATGCCTTGG + Intronic
1022091448 7:27110384-27110406 CCTAGCCAGCCTCCAAGCCTGGG - Exonic
1022652598 7:32290641-32290663 TCCACCTGGCATCCTGGCCTAGG + Intronic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1024603566 7:51007671-51007693 TCCAGCTTGGCTCCCAACCTTGG - Intergenic
1025107557 7:56184846-56184868 CCCAGCTGGCCTCCAACTCCTGG - Intergenic
1025148081 7:56522479-56522501 CCCAGCTGGTCTCCAACTCTTGG - Intergenic
1026730752 7:72909940-72909962 TCAAACTGGCCTCCAGGGCTGGG - Intronic
1026777644 7:73240675-73240697 TCCAACTGGGCTCCTGGCCTGGG + Intergenic
1027018499 7:74794047-74794069 TCCAACTGGGCTCCTGGCCTGGG + Intergenic
1027050773 7:75019934-75019956 CCCAGGTGGCATCAAAGCCTGGG + Intronic
1027069530 7:75151871-75151893 TCCAACTGGGCTCCTGGCCTGGG - Intergenic
1027113342 7:75458232-75458254 TCAAACTGGCCTCCAGGGCTGGG + Intronic
1027285592 7:76642827-76642849 TCAAACTGGCCTCCAGGGCTGGG + Intergenic
1028534334 7:91875290-91875312 TGCTGCTGCACTCCAAGCCTGGG - Intronic
1029974138 7:104816811-104816833 CCCTGCTGGCCTCCTAGCCTCGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034803586 7:154068514-154068536 ACCAGCTGCCCTCCAAGGCCGGG - Intronic
1035764335 8:2093581-2093603 TCCATCTGACTTCCAAGTCTTGG + Intronic
1036359304 8:8066019-8066041 TCCAGCGGGTCTCCCAGCCAGGG - Intergenic
1036695012 8:10968534-10968556 TCCTCCTGTCCTCCAGGCCTAGG + Intronic
1036891653 8:12600933-12600955 TCCAGCGGGTCTCCCAGCCAGGG + Intergenic
1037338469 8:17815068-17815090 TGCTGCTGGCCTCAAAGCCCTGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1038788841 8:30648718-30648740 TCCAGCTGCTCTGCCAGCCTGGG + Intronic
1039579336 8:38651114-38651136 CCGAGCTGGGCCCCAAGCCTCGG + Intergenic
1041204743 8:55487506-55487528 TTCCGCTGTGCTCCAAGCCTGGG - Intronic
1042904370 8:73758102-73758124 ACCTGCTGGCCTCTATGCCTAGG + Intronic
1043705726 8:83347571-83347593 GCTAGCTGGCCTCCAAGCCCTGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047424378 8:124731841-124731863 ACCAGCTGTCCCCCAGGCCTAGG - Intergenic
1049008004 8:139868506-139868528 TCCATCTGGATTTCAAGCCTTGG - Intronic
1049400664 8:142425573-142425595 TTCAGCTGGCCTGTGAGCCTGGG + Intergenic
1049420790 8:142515653-142515675 TCCAGCTGGTTTCCTAGCCCTGG + Intronic
1049473645 8:142787170-142787192 CCCAGCTGCCCTCCCTGCCTCGG - Intergenic
1049758081 8:144319657-144319679 TCCTGCCGCCCTCTAAGCCTTGG + Intronic
1052399710 9:27985446-27985468 TCAAGCTAGCCTTCAAGCCAAGG - Intronic
1052881440 9:33603092-33603114 ACCTGCTGGGCTCCAAGCCCTGG + Intergenic
1053707563 9:40769814-40769836 TGCCGCTGCACTCCAAGCCTGGG + Intergenic
1054417476 9:64890600-64890622 TGCCGCTGCACTCCAAGCCTGGG + Intergenic
1055876529 9:80949419-80949441 TCCAGCGTGCCTTCAAGACTTGG + Intergenic
1055949789 9:81719935-81719957 CCCTGCTAGCCTCCTAGCCTAGG + Intergenic
1056402771 9:86244281-86244303 CCCAGCTGGTCTCCAACTCTTGG + Intronic
1056633058 9:88309206-88309228 TGGAGCTTGCCTCCAGGCCTGGG - Intergenic
1056852482 9:90096224-90096246 TGCAGATGCCCTCCAAGCCCTGG + Intergenic
1057155676 9:92837054-92837076 TCCTGCTGGATTTCAAGCCTTGG - Intergenic
1057259084 9:93574324-93574346 CTCAGCTGGTCTCCAAGTCTTGG - Intergenic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1059215742 9:112560397-112560419 TCCAGCTGGTCTCAAACTCTTGG + Intronic
1060586078 9:124786872-124786894 GCCAGCTGGCCAGCCAGCCTTGG - Intronic
1060665413 9:125429629-125429651 GCGAGCTGGCCTCCATGTCTGGG + Intergenic
1060939685 9:127536222-127536244 TCCCTCTGGCCTCCACACCTGGG - Intronic
1060991523 9:127852377-127852399 CCCAGCTGGCTTCCAGGCCCTGG + Intronic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1062473212 9:136715171-136715193 GGAAGCTGGCCCCCAAGCCTGGG + Intronic
1062587561 9:137256104-137256126 TGCAGCCGGCCTCTCAGCCTTGG + Intronic
1062697663 9:137883784-137883806 TCCATCTGGGCTCTGAGCCTCGG - Intronic
1186274736 X:7927200-7927222 CCCTGCCGGCCTCCAAGCCGCGG - Intronic
1187338801 X:18403319-18403341 ACCAGCTGGCCTCTAGACCTGGG - Intergenic
1192593914 X:72386747-72386769 TGAAGCTGGACTCCAAACCTGGG + Intronic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1195751258 X:108163436-108163458 TTCAGTTGGCATCCCAGCCTAGG + Intronic
1197064356 X:122220844-122220866 CCCAGCTGGACTCCAAGGCTGGG - Intergenic
1197759225 X:130015884-130015906 TCCACCTGGCTTCCAAGCTGTGG - Exonic
1201797369 Y:17912156-17912178 TCAGGCTGGCCTCAAATCCTAGG + Intergenic
1201804184 Y:17993805-17993827 TCAGGCTGGCCTCAAATCCTAGG - Intergenic
1202358739 Y:24081162-24081184 TCAGGCTGGCCTCAAATCCTAGG + Intergenic
1202512039 Y:25588951-25588973 TCAGGCTGGCCTCAAATCCTAGG - Intergenic
1202605561 Y:26636933-26636955 TACAGCTGACCTCCACCCCTGGG - Intergenic