ID: 905152697

View in Genome Browser
Species Human (GRCh38)
Location 1:35944272-35944294
Sequence TTAGGAGTTTGAGACTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384992
Summary {0: 85, 1: 4229, 2: 57661, 3: 135462, 4: 187555}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905152697_905152699 2 Left 905152697 1:35944272-35944294 CCAGGCTAGTCTCAAACTCCTAA 0: 85
1: 4229
2: 57661
3: 135462
4: 187555
Right 905152699 1:35944297-35944319 TCCTAAGCCTCCTGAGTGTCTGG 0: 1
1: 1
2: 149
3: 5665
4: 119411
905152697_905152703 11 Left 905152697 1:35944272-35944294 CCAGGCTAGTCTCAAACTCCTAA 0: 85
1: 4229
2: 57661
3: 135462
4: 187555
Right 905152703 1:35944306-35944328 TCCTGAGTGTCTGGGATTACAGG 0: 25
1: 1670
2: 60617
3: 150688
4: 239079
905152697_905152705 30 Left 905152697 1:35944272-35944294 CCAGGCTAGTCTCAAACTCCTAA 0: 85
1: 4229
2: 57661
3: 135462
4: 187555
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353
905152697_905152701 3 Left 905152697 1:35944272-35944294 CCAGGCTAGTCTCAAACTCCTAA 0: 85
1: 4229
2: 57661
3: 135462
4: 187555
Right 905152701 1:35944298-35944320 CCTAAGCCTCCTGAGTGTCTGGG 0: 1
1: 76
2: 3778
3: 113924
4: 218970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905152697 Original CRISPR TTAGGAGTTTGAGACTAGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr