ID: 905152698

View in Genome Browser
Species Human (GRCh38)
Location 1:35944290-35944312
Sequence CTCAGGAGGCTTAGGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905152698_905152703 -7 Left 905152698 1:35944290-35944312 CCTAAGCTCCTAAGCCTCCTGAG 0: 1
1: 0
2: 1
3: 25
4: 256
Right 905152703 1:35944306-35944328 TCCTGAGTGTCTGGGATTACAGG 0: 25
1: 1670
2: 60617
3: 150688
4: 239079
905152698_905152705 12 Left 905152698 1:35944290-35944312 CCTAAGCTCCTAAGCCTCCTGAG 0: 1
1: 0
2: 1
3: 25
4: 256
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905152698 Original CRISPR CTCAGGAGGCTTAGGAGCTT AGG (reversed) Intronic
900179923 1:1306558-1306580 ACCAGGAGGCTCAGGAGCCTTGG - Intronic
900399260 1:2466350-2466372 CTCAGGTGGCCTAGGACCCTCGG - Intronic
901850272 1:12010693-12010715 CACAGGAGAGTTAAGAGCTTGGG - Intronic
901985557 1:13072975-13072997 CTGAGGAGGCTTGGGAGGCTGGG + Intronic
901996252 1:13153792-13153814 CTGAGGAGGCTTGGGAGGCTGGG - Intergenic
902373822 1:16020894-16020916 CTCAGGAGCTGGAGGAGCTTTGG + Intronic
902378746 1:16042729-16042751 CTCAGGAGCTGGAGGAGCTTTGG + Intergenic
902596305 1:17511864-17511886 GGCAGGTGGCTTAGGAGGTTGGG + Intergenic
904268296 1:29330797-29330819 CTCAGGATGCTGGGGAGATTAGG - Intergenic
905152698 1:35944290-35944312 CTCAGGAGGCTTAGGAGCTTAGG - Intronic
905340301 1:37273473-37273495 CTCAGGTGGCTTGGGAGGTTGGG - Intergenic
905719505 1:40185132-40185154 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
906439402 1:45827937-45827959 CTCAGGAGGCTGAGGAGAAGCGG - Intronic
907385974 1:54125541-54125563 CTCAGCAAGCTTAGGGGCTTAGG - Intergenic
908220362 1:61999994-62000016 CTCAGGAGGCTGAGAGGCTGAGG - Intronic
908553825 1:65237121-65237143 CTCTGGAGGCTGAGGCACTTGGG - Intergenic
911903635 1:103537379-103537401 CTCAGGTGGCTGAGGAGATGTGG - Exonic
912970032 1:114272446-114272468 CTCAGGTGGCTAATGTGCTTAGG - Intergenic
913272144 1:117104825-117104847 CTCATGAGGCTTAGCATCTAAGG + Exonic
913343389 1:117782587-117782609 CTCTGGAGGCTTAGCAGATTGGG + Intergenic
913353733 1:117894233-117894255 CACAGGAGGCTGAGGAGCCCAGG - Intronic
914428408 1:147599617-147599639 CTCAGGAGGCTCTGGAGTTGGGG + Intronic
915561325 1:156689958-156689980 CATAGGAGGCTGGGGAGCTTGGG - Intergenic
916266047 1:162890834-162890856 CTCAGGAGGCTGAGAGGCTGAGG - Intergenic
916761408 1:167820825-167820847 CTCAGGAAGCTGAGGTGTTTGGG + Intronic
916762030 1:167825675-167825697 CTCAGGAAGCTGAGGTGTTTGGG + Intronic
918465970 1:184822012-184822034 CTCAGGAGGCTTAGAGTCTCGGG - Intronic
919072068 1:192768410-192768432 CTCAGGAGTCTTGGGACCTAGGG + Intergenic
921061654 1:211590347-211590369 CTCAGGAGGCTGAGGATCGCTGG - Intergenic
921184022 1:212654962-212654984 CTCATGGTGGTTAGGAGCTTTGG - Intergenic
921900807 1:220448677-220448699 CTCAGGAGACAAAGGAGCTTTGG + Intergenic
923876600 1:238056181-238056203 CTCAGGAGGCTGAGGAGGTAGGG - Intergenic
923908204 1:238409447-238409469 CACAGAAGGCTCAGGAGGTTAGG - Intergenic
1064301869 10:14130076-14130098 CTCAGGAGGCTGGGAACCTTGGG - Intronic
1065145384 10:22763035-22763057 CTCAGGAGGCTGAGGAGGGGAGG + Intergenic
1066355922 10:34683733-34683755 CTCACGAGCAGTAGGAGCTTTGG - Intronic
1066377426 10:34869973-34869995 CTCAGCATCCTTAGGAGCTGGGG + Intergenic
1067305564 10:45060710-45060732 CTTGGGAGGCTGAGGTGCTTGGG + Intergenic
1069998443 10:72357854-72357876 CCCAGGAGGATTATGAGCCTGGG + Intergenic
1072974226 10:100043749-100043771 CTCAGGAGGCTGAGAGGCTGAGG - Intronic
1075489101 10:122850895-122850917 CTCAGGAGGCCCAGGTGCTGGGG - Intronic
1076073662 10:127514377-127514399 CTAAGGAGGATAAGGAGCTGTGG - Intergenic
1076747414 10:132521389-132521411 CAGAGGAGGCTGAGGAGATTTGG - Intergenic
1077091345 11:779732-779754 CTCGGGACGCCTAGGAACTTCGG - Intronic
1077241258 11:1511614-1511636 CTCAGGAGGCTGAGGCTCCTGGG + Intergenic
1077412968 11:2412007-2412029 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
1078565149 11:12408239-12408261 CACAGGAGGCATATGAGCCTGGG - Intronic
1079030688 11:16983970-16983992 CTCAGGAGGCTTAGGTGAGAGGG + Intronic
1079256507 11:18835629-18835651 CTCAGGAGGCTTAGGTGGGATGG - Intergenic
1083269860 11:61566557-61566579 CTCAGGTGGCTCATCAGCTTTGG - Intronic
1083980202 11:66161342-66161364 CTCAGGAGGCTGAGGGAGTTAGG + Intronic
1084040600 11:66540309-66540331 CTCAGGAGGCTGGGGGGCTCAGG + Intronic
1084420065 11:69056024-69056046 CTGACGAGGCTCAGAAGCTTAGG - Intronic
1084744610 11:71160873-71160895 CTCAGGAGGCTCAGCAGCCCAGG - Intronic
1085266288 11:75240027-75240049 CCCAGGAGTCTTAAGAGGTTTGG + Intergenic
1089442616 11:118529841-118529863 CTCCGGAGGCTCAGGCTCTTTGG + Intronic
1089777136 11:120846037-120846059 TACAGGAGGGTTAGCAGCTTTGG - Intronic
1089975024 11:122724831-122724853 CTTATGAGTCTTAGGATCTTAGG - Intronic
1090481435 11:127072081-127072103 CCCAGGAGACTGTGGAGCTTAGG + Intergenic
1091647598 12:2285504-2285526 CTCAGGAGCTTTTGGAACTTAGG + Intronic
1092247441 12:6871590-6871612 CTCCAGAGGCTTGGGAGCTGGGG + Intronic
1095449352 12:42313567-42313589 CTCCTAAGGCTTAGGAGGTTAGG + Intronic
1096028459 12:48389056-48389078 CTGAGGAGACTTAGGAGTCTAGG + Intergenic
1096292275 12:50352464-50352486 CTCAGCAGGCTCAGGAGCTGGGG - Exonic
1096292312 12:50352608-50352630 CTCAGCAGGCTCAGGAACTGGGG - Exonic
1096292330 12:50352680-50352702 CTCAGCAGGCTCAGGAACTGGGG - Exonic
1096292347 12:50352752-50352774 CTCAGCAGGCTCAGGAACTGGGG - Exonic
1098947008 12:76600293-76600315 CTCAGAAGACAAAGGAGCTTTGG + Intergenic
1101453103 12:104799685-104799707 CTCAGGAGCCTTAGGACTGTAGG + Intergenic
1102281749 12:111624093-111624115 CTCTGGAGGCTGAGGAGGGTAGG - Intergenic
1102322455 12:111948986-111949008 CTCAGGAGGCTGAGGTGGTGGGG + Intronic
1102416053 12:112763837-112763859 CTCAGGTGGTTGAGGGGCTTCGG + Intronic
1103765217 12:123274985-123275007 CTCTGGAGGCTGAGGTGCTGAGG + Intergenic
1103936502 12:124480239-124480261 CTGAGGCTGCTAAGGAGCTTAGG + Intronic
1106449728 13:29869373-29869395 CTCAGGAGGCTGAGGTGGTTGGG + Intergenic
1107349868 13:39502511-39502533 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1108350711 13:49588525-49588547 CTCAGGAGGCTGAGGTGCTGAGG - Intergenic
1108711515 13:53037313-53037335 CTCTGGAGGCTTATGGTCTTTGG + Intronic
1114292906 14:21303522-21303544 CTCAGAAGGCTGCAGAGCTTCGG + Exonic
1115103801 14:29735637-29735659 CTCAAGAGGCTTAGGAGGCAAGG + Intronic
1115562604 14:34596774-34596796 CTCGGGAGGCTGAGGAACCTAGG - Intronic
1115591738 14:34872481-34872503 CTCAGGAGGCTAAGGTGGTAAGG + Intronic
1116169571 14:41382642-41382664 CTCAGGAGGCTGAGGAGTGCAGG + Intergenic
1116608810 14:47038832-47038854 CTCTGGAGGCTTAGGGGCTCAGG + Intronic
1117941833 14:60975632-60975654 CTCAGCAGGGTTAGCATCTTTGG + Exonic
1118362327 14:65066744-65066766 CTCGGGAGGCTTAGAGGCTTAGG + Intronic
1118861235 14:69665354-69665376 CTCAGGAGGCTAAGGTGGTGAGG - Intronic
1121683913 14:95817485-95817507 CACTGGAGGCTTAGGAGTGTGGG - Intergenic
1122543617 14:102510610-102510632 CCTAGGGGGCTTAGGAGCCTGGG + Intergenic
1124431402 15:29611721-29611743 GTCAGAAGGCTTGGGAGGTTTGG - Intergenic
1125738560 15:41945350-41945372 GTCAGGAGGCCTGGGAGCTGTGG - Intronic
1127249253 15:57212808-57212830 CTCAGGAGGCAAGAGAGCTTAGG - Intronic
1127260747 15:57324444-57324466 CTGAGGAGGGATAGGAGGTTGGG - Intergenic
1127406607 15:58655335-58655357 CTCAGGAAGCTTATAAGCATGGG + Intronic
1129160533 15:73745215-73745237 TTTGGGAGGCTTAGGAGTTTGGG - Intronic
1130096813 15:80862219-80862241 ATAAGGAGGCTGAGGAGCCTGGG + Intronic
1131317826 15:91356068-91356090 CTAAGGAGGATTGGGAGCTGTGG - Intergenic
1132299231 15:100766132-100766154 CTCTGGAAGCTTAGGGGCGTAGG + Intergenic
1135551449 16:23401303-23401325 CGCAGGTGGCTTTGGAGATTAGG - Intronic
1136172709 16:28498211-28498233 CTCAGGAGGGTTGGGGGCTGGGG - Exonic
1137732050 16:50696612-50696634 CTCAGGAAGCTCACCAGCTTGGG - Intronic
1138381788 16:56607782-56607804 CTCAGGAAGCTCAGGGGCTGGGG - Intergenic
1138382351 16:56611354-56611376 CTCAGGAAGCTCAGGGGCTGGGG - Intergenic
1138816123 16:60204862-60204884 CTCAGGAGGCTGAGAGGCTGAGG - Intergenic
1139640321 16:68287083-68287105 CTCAGGAGGCTGAGGAGGGAGGG - Intronic
1140881072 16:79198615-79198637 CTCAGGATGCTTAGTAGCAGTGG + Intronic
1141105097 16:81226992-81227014 CTCAGGAGGCTGAGGCGGGTGGG - Intergenic
1141636152 16:85314955-85314977 CCCAGGATGCTTAGATGCTTGGG + Intergenic
1141895021 16:86953787-86953809 CACAGGAGGCCCAGGAGCTTAGG - Intergenic
1142115630 16:88354745-88354767 GCCAGGAGGCTTGGGAGCCTTGG - Intergenic
1142535016 17:608721-608743 CTCAGGAGGCTGAGGTGCAAGGG - Intronic
1142578664 17:926750-926772 CTCAGGAGTTTGAGCAGCTTGGG - Intronic
1144496624 17:15749873-15749895 CTGAGGAGGCTGAGGGGCTGAGG + Intergenic
1144496632 17:15749898-15749920 CTGAGGAGGCTGAGGGGCTGAGG + Intergenic
1144496642 17:15749932-15749954 CTGAGGAGGCTGAGGGGCTGAGG + Intergenic
1144606223 17:16667332-16667354 CTGAGGCGGCTGAGGAGCTGAGG + Intergenic
1144904955 17:18634825-18634847 CTGAGGAGGCTGAGGGGCTGAGG - Intergenic
1145102421 17:20088111-20088133 GCCAGGAAGCCTAGGAGCTTGGG + Intronic
1145891082 17:28416230-28416252 CACAGGGGGCTTAGGAGCATCGG - Intergenic
1146547353 17:33750433-33750455 CTCAGGAGGCCCTGGAGCCTGGG + Intronic
1146912701 17:36658530-36658552 CACAGGAGGCTCAGGGGCCTGGG - Intergenic
1147538527 17:41336223-41336245 CCCAGGAAGCTTGTGAGCTTGGG + Intergenic
1147913245 17:43870546-43870568 CTGAGGATTCTCAGGAGCTTTGG - Intergenic
1148224895 17:45892472-45892494 TTTGGGAGGCTGAGGAGCTTGGG + Intergenic
1148614265 17:48987625-48987647 CTCAGGAGGCTGAGGAGGGAGGG - Intergenic
1149623089 17:58060635-58060657 ACCAGGAGCCTTGGGAGCTTGGG + Intergenic
1149786574 17:59440536-59440558 CTTAGGAGGCTGAGGTGCTTGGG + Intergenic
1150482792 17:65523364-65523386 CTCAGGAGGCTGAGGTGAGTTGG + Intergenic
1152104878 17:78323096-78323118 CTCAGGAGGTTTCTGAGGTTGGG + Intergenic
1152899071 17:82929666-82929688 CCCAGGAGGCTTAGGGCCTGTGG + Intronic
1153680435 18:7495520-7495542 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
1154244371 18:12682727-12682749 CTCAGGAGGCTGAGAATCATTGG - Intronic
1161688815 19:5718942-5718964 GACAGGAGGCTTAGGAGGGTGGG - Intronic
1162518189 19:11162806-11162828 CTCAGGAGGCTGAGGCGGGTGGG - Intergenic
1165578641 19:36843307-36843329 GTCAGGAGGCTCAGGAACTTAGG + Intronic
1166312058 19:41968566-41968588 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1166798493 19:45442206-45442228 CTCAGGAGGCTGAGGTGGGTGGG + Intronic
1167419410 19:49394394-49394416 CCCAGGAGGCTGAGGACCTGGGG + Intronic
1168465271 19:56596464-56596486 CTCTGGAGGCGTAGGGGCCTGGG + Intronic
925215024 2:2087014-2087036 CTCAGAGGGCATTGGAGCTTGGG - Intronic
928614165 2:33019808-33019830 CTCAGGAGGCTCTTGAGCTCAGG - Intronic
930302176 2:49630288-49630310 CTCAGAAGACTTTGGAGCATGGG + Intergenic
931790772 2:65662101-65662123 CTCTGGGAGCTGAGGAGCTTGGG - Intergenic
932228600 2:70063447-70063469 CTCAGCAGCCTTAGGAGTTCAGG - Intergenic
933214024 2:79605811-79605833 CTCAGAAGGCTGAGGGGCTGAGG + Intronic
933316417 2:80720668-80720690 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
933852879 2:86385230-86385252 CTCTGGAGTTTTAGCAGCTTGGG + Intergenic
934091155 2:88551852-88551874 CCCAGGAGGAAGAGGAGCTTGGG - Intergenic
938161458 2:128988145-128988167 CCCAGGAGGCTGAGGAGGTGCGG + Intergenic
939041108 2:137190443-137190465 CTGAGGAGGGTTGGGAGCATGGG + Intronic
939939736 2:148335271-148335293 CTCAGGAGGCTTAGGTGAGAGGG + Intronic
940657213 2:156502532-156502554 CTCAGGAGGCTGAGGTGGTAGGG - Intronic
941609275 2:167640821-167640843 CTCTGTAGGCTTTTGAGCTTTGG + Intergenic
941726111 2:168862340-168862362 CACAGGAAGGTTAGGTGCTTTGG + Intronic
944162568 2:196680407-196680429 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
946744681 2:222833750-222833772 TTCAGGAGACTTAGCGGCTTTGG - Intergenic
947326386 2:228983081-228983103 CTCAGCAGCATTAGAAGCTTGGG + Intronic
948424376 2:237877994-237878016 CTCTGGAGGCAGAGGAGCCTGGG - Intronic
948736012 2:240005462-240005484 CTCGGGAGGCTGAGGTGCTGAGG - Intronic
1169324495 20:4664360-4664382 CTCAGGAGGCTGAGGCACTGAGG + Intergenic
1169365682 20:4990477-4990499 CTCAGGAGGCTGAGTAGCATGGG - Intronic
1169688189 20:8300692-8300714 CTCATGAGGCTTACAAGTTTGGG - Intronic
1171340602 20:24424181-24424203 CTCAGGATGCTGAGGTGCTGAGG + Intergenic
1172028587 20:31966582-31966604 CTCAGCATGCTTAGGAGGTTGGG - Intergenic
1172333706 20:34096126-34096148 CTCAGGAGCCTTGGGAGCCCAGG - Intronic
1173505272 20:43582170-43582192 CTCAGGAGGCTGAGGTACTCAGG - Intronic
1174730035 20:52907124-52907146 CTCAGGAGGCTGAGAGGCTGAGG + Intergenic
1177041330 21:16114789-16114811 CTCAGGAGGCTGAGGAGGGAGGG + Intergenic
1177193707 21:17880284-17880306 CTCAGGAGGCTGAGGTGGTAGGG + Intergenic
1177835945 21:26186269-26186291 CTCGGGAGGCTGAGGCGCTCAGG - Intergenic
1179611498 21:42554797-42554819 CACAGGAGGCTCAGGTGCTAGGG - Intronic
1180132451 21:45835310-45835332 CTCCGGAGGCTTAGCAGCACCGG + Intronic
1181888895 22:26043873-26043895 CTCAGGAGGCTGAGGAGCTCAGG - Intergenic
1183790987 22:40069207-40069229 CTCAGGAGGCTGAGGTGCGAGGG - Intronic
1185130888 22:49037988-49038010 CTCAGCAGGCCCAGGAGCTGAGG + Intergenic
950360952 3:12448964-12448986 CTGAGGAGGCTTAGGAGGAAAGG + Intergenic
950943128 3:16914835-16914857 CTCAGGAGGCTGAGGAGGGAGGG - Intronic
953228248 3:41040624-41040646 CTCAGAAGGCTGAGGCTCTTAGG + Intergenic
953595994 3:44314652-44314674 CTCAGGAGGCTGACTATCTTAGG - Intronic
954270778 3:49506867-49506889 CTCAGGAGGCTGAGGTGGTGGGG + Intronic
954965717 3:54608974-54608996 GTCAGGAGGCATAGGTTCTTGGG - Intronic
955473626 3:59313067-59313089 CTCCAGAGGCTGAGGAGGTTGGG - Intergenic
956457484 3:69437178-69437200 CTCAGGAGGCTGAGGTGGGTGGG - Intronic
956522972 3:70125934-70125956 CTCAGGTGGCTGAGGAGATGTGG + Intergenic
958066387 3:88549295-88549317 CTCAGGAGGCTGAGGCGCGGTGG - Intergenic
958601117 3:96298380-96298402 CTCTTGAGGGTTGGGAGCTTTGG + Intergenic
959518613 3:107300275-107300297 CTGAGGATCCTTAGGAACTTAGG + Intergenic
959852699 3:111108672-111108694 CTCAGGAAGCTTAGAATCATGGG + Intronic
965089337 3:164143121-164143143 CTCAGGAGGACTAAGAGCTTAGG - Intergenic
965516309 3:169624978-169625000 CTCAGAAGGGTTGGGAGCTTTGG - Intronic
965978544 3:174657253-174657275 CTCAGGAGGCTGAGGATCCCAGG - Intronic
967715604 3:192758425-192758447 CTAAGGAGGCTAAGGAGGCTGGG + Intronic
968221096 3:196940966-196940988 CTCAGGAGGCTGAGGTGGGTAGG + Intronic
969894979 4:10295256-10295278 TTCAGGTGGCTCAGGAGGTTTGG + Intergenic
971249252 4:24958915-24958937 CTCATGAGGCTGAGGCGCTGAGG + Intronic
973814575 4:54607360-54607382 CCCAGGAGGCTTTGGAGGCTGGG - Intergenic
973902251 4:55487807-55487829 CACAGCAGGCTTAGGATCCTGGG + Intronic
974061666 4:57041421-57041443 CTCAAGAAGCTTAGGATCTAAGG + Intronic
976286157 4:83373272-83373294 CTCAGGATGCTTAGGTTCTCAGG + Intergenic
982234074 4:153235932-153235954 CTCAGGAGACTTAGAATCTAGGG - Intronic
983517114 4:168669481-168669503 TTCAGGAGGCTGAGGAGGTAAGG + Intronic
985378970 4:189372424-189372446 CTCAGGAGGCTTTGGGGTCTGGG - Intergenic
985763056 5:1761511-1761533 CACAGGAGGCTTTGGGGGTTGGG - Intergenic
986126190 5:4884302-4884324 CACAGGAAGCTCAGGTGCTTAGG - Intergenic
988863533 5:35309389-35309411 CTCATGTGGCTTGGCAGCTTAGG + Intergenic
989274460 5:39570976-39570998 CTCAGGAGCACTTGGAGCTTTGG - Intergenic
990492345 5:56314831-56314853 CTCAGGACGGTTTGGAACTTTGG - Intergenic
991590865 5:68250186-68250208 CTCTGGGGTCTAAGGAGCTTAGG + Intronic
993498337 5:88633683-88633705 CTGTGGAGGCTTTGGAGCATGGG - Intergenic
993572192 5:89555067-89555089 CTCAGGAGGCTGAGATGCTCAGG + Intergenic
998999237 5:147901686-147901708 CCCAGGAGGCTTAGGAATTTGGG + Exonic
999386611 5:151157972-151157994 CTGAGAAGGATTAGGGGCTTTGG + Intergenic
999792083 5:154950080-154950102 CTCAGGAGACTTAGAATCATAGG + Intronic
999927625 5:156396461-156396483 ATCAGGAGGGTTTGGGGCTTAGG + Intronic
1000463509 5:161548759-161548781 CTCAGGAGACTTCGGAGTGTAGG - Intronic
1001216121 5:169857565-169857587 CTCAGGAGAGTTAGAAGCCTTGG + Intronic
1002434303 5:179221634-179221656 CTCAGGAGGCGCAGGGGCATGGG - Intronic
1003560145 6:7173271-7173293 CTCAGGAGGCTGGGGCGGTTTGG + Intronic
1004447580 6:15714339-15714361 CCCAGCAGGGTTAGGAGTTTGGG + Intergenic
1007215516 6:40234574-40234596 CCCAGGAGCCTTAGAAACTTGGG + Intergenic
1009541318 6:64962630-64962652 CTCATGAGGCTGAGGGGCTGAGG + Intronic
1011813915 6:91166154-91166176 CTCAGGAGGCTGTGGATCTAAGG - Intergenic
1012077505 6:94710159-94710181 CTAAAAAGGCTCAGGAGCTTAGG + Intergenic
1013463707 6:110399598-110399620 CTCAGGAGGCTTTGCAGCACGGG - Intronic
1016516126 6:144894714-144894736 CTCAGAAGGGTCAGGAGCTCAGG - Intergenic
1017067284 6:150540758-150540780 CTCAGGGGGCTGGGGAGCTCTGG - Intergenic
1017614748 6:156233249-156233271 GCCAGGAGGTTTAGGAGATTTGG + Intergenic
1019966541 7:4503738-4503760 CTCATGAGGCTTAATAGCTGTGG - Intergenic
1023022004 7:36019127-36019149 CTCAGGAGTCCTTGGGGCTTAGG + Intergenic
1024620418 7:51152406-51152428 TTCATGAGGCTTAGGAGGATGGG - Intronic
1027332637 7:77115554-77115576 CTCAGAAGACAAAGGAGCTTTGG - Intergenic
1028174628 7:87640449-87640471 CTCAGGAGGCTGAGGATCACTGG - Intronic
1029783144 7:102755762-102755784 CTCAGAAGACAAAGGAGCTTTGG + Intronic
1030036900 7:105415685-105415707 CTCAGGAGGATCATGAGCCTGGG + Intergenic
1031805207 7:126299670-126299692 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
1032169831 7:129575599-129575621 CTCGGGAGGCTGAGGGGCTGAGG - Intergenic
1032301373 7:130690596-130690618 CTCAGGAGGCTGAGGTGGGTGGG - Intergenic
1032985411 7:137331693-137331715 CTCAAGAGCCTGAGAAGCTTTGG - Intronic
1033219987 7:139521372-139521394 CACAGGAGGCTTAGGAGGCAGGG + Intergenic
1033236332 7:139640755-139640777 CTCAGGAGGCTGAGGAGGGAGGG - Intronic
1034402868 7:150877259-150877281 CTCAGGCGACTCAGGAGGTTTGG - Intergenic
1037319316 8:17629023-17629045 CTCAGGAGGCTAAGGAGGGAGGG - Intronic
1037376055 8:18230224-18230246 CTCAGGATGCTGAGGAGCCTAGG + Intergenic
1037831736 8:22193969-22193991 TCCAGGAGGCTTGGGTGCTTGGG - Intronic
1037834205 8:22206792-22206814 CACAGGAGGCATCGGAGCTTGGG + Intronic
1040422225 8:47251440-47251462 CTCTGGAGGCTTAGGTCCTGGGG + Intergenic
1040551600 8:48442092-48442114 CACAGGAGACAGAGGAGCTTGGG + Intergenic
1042432487 8:68724973-68724995 CCCAGGAGGCTGAGGTGCTGAGG - Intronic
1043344947 8:79287779-79287801 CTCTGGAGGATTTGGGGCTTGGG + Intergenic
1043830350 8:84980949-84980971 CTCAGAACGCTAAGGAGTTTGGG - Intergenic
1045365369 8:101470771-101470793 CTCAGGAGGAACAGGAGCTGGGG - Intergenic
1046516388 8:115267494-115267516 CTCATGAGTCTTAGGAGGTGGGG - Intergenic
1047458810 8:125042131-125042153 CTGAAGAGGCTAAGGAGCCTGGG + Intronic
1047777120 8:128081619-128081641 CTCAGAAAGCTTAGAGGCTTAGG - Intergenic
1049786195 8:144451988-144452010 CTCAGGGGGCCTGGGAGCTAGGG - Intronic
1050978380 9:11972774-11972796 CTGATGATGCTTAGGAGTTTGGG + Intergenic
1051148888 9:14059571-14059593 CTCAGGAGGCTTAGGAAGGAGGG - Intergenic
1052824635 9:33166439-33166461 CTCAGGAAGTTTTGGAGTTTGGG - Intronic
1053088694 9:35252410-35252432 CTCAGGAGGCTGAGGAACTCAGG - Intronic
1053245788 9:36533663-36533685 CTCGGGAGGCTGAGGGGCTGAGG - Intergenic
1056809926 9:89756447-89756469 CTCTGGAGGCTAAGAAGCTGGGG + Intergenic
1057246721 9:93462143-93462165 CTCAGAAGGCCTAGGTGCTTTGG - Intronic
1057453456 9:95186740-95186762 CTGAGGAGGCTTTTGAGGTTAGG + Intronic
1057474808 9:95389445-95389467 CTGAGGAGGCTTTTGAGGTTAGG - Intergenic
1058567344 9:106300464-106300486 CTCAGGAGGTTTATTAACTTTGG + Intergenic
1059323698 9:113488748-113488770 CTCAGGAGGATCAGGGCCTTGGG + Intronic
1059786859 9:117595887-117595909 AGCACCAGGCTTAGGAGCTTTGG + Intergenic
1061947831 9:133918721-133918743 CTTGGGAGGCTTAGGAGCCCAGG - Intronic
1062420081 9:136476499-136476521 CTCAGGAGCTTCAGGAGCTCTGG - Exonic
1185888787 X:3806057-3806079 CTCAGGAGGCTGAGGAGTTCAGG + Intergenic
1187043876 X:15626047-15626069 TTCAGGAAGCTCAGGAGCTGGGG - Intergenic
1188001790 X:24989337-24989359 CTCAGGGGGGTTAGGGGGTTGGG - Intronic
1189853632 X:45200964-45200986 TTGAGGATGCTGAGGAGCTTGGG + Intergenic
1191200208 X:57772651-57772673 CTCAAAAGGCTAAGAAGCTTAGG + Intergenic
1192047783 X:67694794-67694816 CGTCTGAGGCTTAGGAGCTTAGG + Intronic
1192256885 X:69468866-69468888 CTCAGGAAGCTTACAATCTTGGG - Intergenic
1193237722 X:79129896-79129918 TTCAGGAAGCTTACAAGCTTGGG - Intergenic
1193902581 X:87200453-87200475 CTCAGTAGACTTAGGAGCAGGGG + Intergenic
1197030134 X:121803095-121803117 CTCAGGAAGCTTAGCATGTTAGG + Intergenic
1198772509 X:140145747-140145769 CTCAAGAGGCCTGGCAGCTTCGG + Intergenic
1199698229 X:150358799-150358821 CGCAGGAGGCTTTTGAGCATGGG + Intergenic
1200237631 X:154476058-154476080 CTCAGGAGGCTGAGGTGCTGGGG + Intergenic
1201148254 Y:11078542-11078564 CTCAGGAGGCTCAGCAGCCCAGG - Intergenic