ID: 905152699

View in Genome Browser
Species Human (GRCh38)
Location 1:35944297-35944319
Sequence TCCTAAGCCTCCTGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125227
Summary {0: 1, 1: 1, 2: 149, 3: 5665, 4: 119411}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905152696_905152699 3 Left 905152696 1:35944271-35944293 CCCAGGCTAGTCTCAAACTCCTA 0: 142
1: 3403
2: 26842
3: 46275
4: 59849
Right 905152699 1:35944297-35944319 TCCTAAGCCTCCTGAGTGTCTGG 0: 1
1: 1
2: 149
3: 5665
4: 119411
905152695_905152699 11 Left 905152695 1:35944263-35944285 CCATTTTGCCCAGGCTAGTCTCA 0: 18
1: 826
2: 13022
3: 67847
4: 140860
Right 905152699 1:35944297-35944319 TCCTAAGCCTCCTGAGTGTCTGG 0: 1
1: 1
2: 149
3: 5665
4: 119411
905152697_905152699 2 Left 905152697 1:35944272-35944294 CCAGGCTAGTCTCAAACTCCTAA 0: 85
1: 4229
2: 57661
3: 135462
4: 187555
Right 905152699 1:35944297-35944319 TCCTAAGCCTCCTGAGTGTCTGG 0: 1
1: 1
2: 149
3: 5665
4: 119411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905152699 Original CRISPR TCCTAAGCCTCCTGAGTGTC TGG Intronic
Too many off-targets to display for this crispr