ID: 905152700

View in Genome Browser
Species Human (GRCh38)
Location 1:35944298-35944320
Sequence CCCAGACACTCAGGAGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327775
Summary {0: 1, 1: 72, 2: 3647, 3: 109005, 4: 215050}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905152700_905152705 4 Left 905152700 1:35944298-35944320 CCTAAGCCTCCTGAGTGTCTGGG 0: 1
1: 72
2: 3647
3: 109005
4: 215050
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905152700 Original CRISPR CCCAGACACTCAGGAGGCTT AGG (reversed) Intronic
Too many off-targets to display for this crispr