ID: 905152702

View in Genome Browser
Species Human (GRCh38)
Location 1:35944304-35944326
Sequence TGTAATCCCAGACACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452568
Summary {0: 30, 1: 1660, 2: 61088, 3: 150861, 4: 238929}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905152702_905152705 -2 Left 905152702 1:35944304-35944326 CCTCCTGAGTGTCTGGGATTACA 0: 30
1: 1660
2: 61088
3: 150861
4: 238929
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905152702 Original CRISPR TGTAATCCCAGACACTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr