ID: 905152704

View in Genome Browser
Species Human (GRCh38)
Location 1:35944307-35944329
Sequence GCCTGTAATCCCAGACACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552277
Summary {0: 32, 1: 2185, 2: 82344, 3: 217868, 4: 249848}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905152704_905152705 -5 Left 905152704 1:35944307-35944329 CCTGAGTGTCTGGGATTACAGGC 0: 32
1: 2185
2: 82344
3: 217868
4: 249848
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905152704 Original CRISPR GCCTGTAATCCCAGACACTC AGG (reversed) Intronic
Too many off-targets to display for this crispr