ID: 905152705

View in Genome Browser
Species Human (GRCh38)
Location 1:35944325-35944347
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2646
Summary {0: 1, 1: 0, 2: 19, 3: 273, 4: 2353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905152702_905152705 -2 Left 905152702 1:35944304-35944326 CCTCCTGAGTGTCTGGGATTACA 0: 30
1: 1660
2: 61088
3: 150861
4: 238929
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353
905152700_905152705 4 Left 905152700 1:35944298-35944320 CCTAAGCCTCCTGAGTGTCTGGG 0: 1
1: 72
2: 3647
3: 109005
4: 215050
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353
905152698_905152705 12 Left 905152698 1:35944290-35944312 CCTAAGCTCCTAAGCCTCCTGAG 0: 1
1: 0
2: 1
3: 25
4: 256
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353
905152697_905152705 30 Left 905152697 1:35944272-35944294 CCAGGCTAGTCTCAAACTCCTAA 0: 85
1: 4229
2: 57661
3: 135462
4: 187555
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353
905152704_905152705 -5 Left 905152704 1:35944307-35944329 CCTGAGTGTCTGGGATTACAGGC 0: 32
1: 2185
2: 82344
3: 217868
4: 249848
Right 905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG 0: 1
1: 0
2: 19
3: 273
4: 2353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type