ID: 905159352

View in Genome Browser
Species Human (GRCh38)
Location 1:36017946-36017968
Sequence ATGCCCATCCAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 5, 1: 6, 2: 28, 3: 78, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905159351_905159352 2 Left 905159351 1:36017921-36017943 CCATAGAAAAATAAACTAACAAA 0: 1
1: 1
2: 12
3: 188
4: 2239
Right 905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG 0: 5
1: 6
2: 28
3: 78
4: 203
905159349_905159352 28 Left 905159349 1:36017895-36017917 CCTGTCTCCAAAAAGGAAAAAAC 0: 1
1: 15
2: 216
3: 3193
4: 24175
Right 905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG 0: 5
1: 6
2: 28
3: 78
4: 203
905159348_905159352 29 Left 905159348 1:36017894-36017916 CCCTGTCTCCAAAAAGGAAAAAA 0: 9
1: 125
2: 2477
3: 20941
4: 39892
Right 905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG 0: 5
1: 6
2: 28
3: 78
4: 203
905159350_905159352 21 Left 905159350 1:36017902-36017924 CCAAAAAGGAAAAAACACACCAT 0: 1
1: 0
2: 3
3: 82
4: 767
Right 905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG 0: 5
1: 6
2: 28
3: 78
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905159352 Original CRISPR ATGCCCATCCAGAAGAGTGA AGG Intronic
901630293 1:10644709-10644731 AAGCCCAGCAAGAAGAGTGGGGG - Intronic
902584289 1:17428547-17428569 AGGCCCATCCAGGAGAAGGAAGG - Intronic
903070648 1:20725546-20725568 GTGGCCATCCAGAGGAGTCAAGG + Intronic
904774161 1:32896487-32896509 ATCCACATCCAGAGCAGTGAGGG - Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908681708 1:66669009-66669031 ATGCCCATCCAGCAGATAGCAGG + Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
915792257 1:158686062-158686084 ATCCATATCCAGAAGAATGAAGG - Intronic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917873831 1:179267078-179267100 ATCCACATTCAAAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920539658 1:206768791-206768813 ATGCCCATCCATGAGCATGAGGG - Intronic
920830758 1:209463593-209463615 ATGCCCATCTTGCTGAGTGATGG - Intergenic
921571364 1:216783057-216783079 ATTCCCACTCAGAAGAGTTAGGG + Intronic
921593517 1:217030231-217030253 ATGGCCACAGAGAAGAGTGAAGG - Intronic
921637930 1:217519137-217519159 ATCCCCATACAGAAGAATAAAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923436207 1:233970193-233970215 ATGCCCATCCAGCAGACAGGAGG - Intronic
924478094 1:244399100-244399122 ATGCCCATCCACATTGGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1064304519 10:14153180-14153202 CTGCTCATCCAGAGAAGTGAGGG + Intronic
1064361944 10:14674041-14674063 ATCCACATGCAGAAGAATGAAGG + Intronic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067036003 10:42917576-42917598 ATGCCCATCCACATTGGTGAGGG + Intergenic
1067371752 10:45690441-45690463 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067388029 10:45835708-45835730 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067418092 10:46121572-46121594 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067446236 10:46348893-46348915 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067503451 10:46828135-46828157 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067591142 10:47511878-47511900 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067638260 10:48019970-48019992 ATGCCTCTCCATAAGAGTAAGGG + Intergenic
1067875234 10:50000391-50000413 ATGCCTCTCCATAAGAGTAAGGG - Intronic
1069055885 10:63844350-63844372 ATGCCCATCCACACTAATGAGGG - Intergenic
1070134865 10:73684396-73684418 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1075201076 10:120404699-120404721 ATGCCCATCCACATTAGTGAGGG - Intergenic
1075953054 10:126498567-126498589 ATGGCCATTCAGCAGTGTGATGG + Intronic
1076025988 10:127113861-127113883 ATGTCCATCCTGCAGAGTGTGGG - Intronic
1076483641 10:130801618-130801640 ATTTCCAGCCAGGAGAGTGAGGG + Intergenic
1077036792 11:499278-499300 ATGCCCAGGCAGAAGACTGAGGG - Intronic
1077798160 11:5512784-5512806 ATGGCCATCGGTAAGAGTGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080907716 11:36563266-36563288 ATGCCCATCCACATTGGTGAGGG - Intronic
1081617743 11:44600553-44600575 TTGCCCATCCAGCAGAATGTAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089164795 11:116467527-116467549 ATGCCCATCCACTTGAGTGAAGG + Intergenic
1089556068 11:119316577-119316599 ATGCCCAGGCAGAAGGGGGAAGG + Intronic
1089728193 11:120501594-120501616 ATGCAAATCCAGATGTGTGATGG + Intergenic
1089789115 11:120929725-120929747 ACGCCCAACCAGAAGAGGAAGGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092955675 12:13547369-13547391 ATGGCCACCCAGAAGAGGAAAGG + Exonic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093359882 12:18210935-18210957 AATCACATCCAGAATAGTGAGGG + Intronic
1093683084 12:22024918-22024940 ATGCCCACCCACATTAGTGAGGG - Intergenic
1094239593 12:28206886-28206908 ATGCCCTTCCAGGGAAGTGAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097670499 12:62531414-62531436 ATTCACATGCAGAAGAGTGATGG - Intronic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098468803 12:70820885-70820907 ATACCCAGCAAGGAGAGTGAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099774501 12:87107536-87107558 ATGCCTATCCACAATGGTGAAGG + Intergenic
1100083933 12:90884445-90884467 ATGCACATTCATAAGAGGGAGGG - Intergenic
1100116804 12:91315619-91315641 AGTCCCATTCAGAAGAGAGAAGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100906110 12:99301200-99301222 ATGCCCATCCACACTGGTGAGGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1104815455 12:131642986-131643008 ATGCCCATCGAGGAGACTCAGGG - Intergenic
1105449808 13:20489359-20489381 ATGCACATTCAGGTGAGTGAAGG - Exonic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1110023427 13:70506016-70506038 ATGGCCAACCAGTACAGTGAGGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116556880 14:46322371-46322393 ATGCTCATCCACATAAGTGAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1117605186 14:57421658-57421680 ATGCCCCTTCAGAATTGTGAGGG - Intergenic
1117774522 14:59169071-59169093 ATTCACATTCAGAAGAATGAAGG + Intergenic
1119389967 14:74284528-74284550 AGAACCCTCCAGAAGAGTGATGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122186860 14:100005898-100005920 ATGCCAAACCAAAAGAGTGATGG - Intronic
1122209662 14:100166222-100166244 AAGCCCATCCAGGAGAGTGGGGG + Intergenic
1124373610 15:29116936-29116958 ATGCCCATCTCCTAGAGTGAAGG - Intronic
1126265845 15:46753060-46753082 ATGCCCATCCACAGTGGTGAGGG + Intergenic
1127572991 15:60262322-60262344 ATCAGCATCCAGGAGAGTGAAGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130049734 15:80473847-80473869 ATGGACAGCCAGCAGAGTGAAGG - Intronic
1130997004 15:88909520-88909542 ATGCTGATGCAGAGGAGTGAGGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1135972143 16:27080165-27080187 AGGCCCAACCAGAAATGTGATGG - Intergenic
1136638917 16:31545542-31545564 ATGCCCATCGACAAGCGTGAAGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1137040235 16:35604327-35604349 GTGCCCATTCAGAAAAGTCAAGG + Intergenic
1140629633 16:76835692-76835714 ATTCCCCTCCTGATGAGTGAGGG - Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145786336 17:27596232-27596254 TTGCCCATTCAACAGAGTGAGGG - Intronic
1147365329 17:39955153-39955175 CTGCCCATCCACAAGTGTGGGGG - Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1147635359 17:41960686-41960708 TTGCCAATCCAGGAGGGTGAGGG - Intronic
1148070188 17:44904241-44904263 GTGGACATCCAGAACAGTGAGGG + Exonic
1150316369 17:64172479-64172501 ATGCCCAACCAGAAGCTGGAGGG - Intronic
1150387724 17:64774358-64774380 ATCCCCACCCAGAAGTGGGAAGG - Intergenic
1150641782 17:66954207-66954229 ATGCCCATCAGGGAGAATGAGGG - Intergenic
1153452428 18:5244511-5244533 ATGCCCATCCACATTAGTGAGGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1158190121 18:54818215-54818237 ATGCCCTTCCTAAAGAGTTAGGG + Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160488205 18:79312505-79312527 ATGCCCACCCAGAAGACACATGG - Intronic
1161940677 19:7401579-7401601 GTGCCCATCCCTAAGAGAGATGG + Intronic
1162933440 19:13968654-13968676 AAGCCCATCCAGAAGATGGAAGG - Exonic
1163982790 19:20916987-20917009 ATGACCACTCAGAAGAGTAATGG - Intergenic
1164042091 19:21502033-21502055 ATACCCATTCAGAAGAGTAATGG - Intronic
1164138702 19:22438094-22438116 ATGCCCATTCAGAAGAGTAATGG - Intronic
1164181948 19:22827018-22827040 ATGCCCATTCAGAAGAGTAATGG - Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164245421 19:23424237-23424259 ATGGCCATTCAGAAGAGTAAGGG - Intergenic
1164308644 19:24027300-24027322 ATGGCCATTCAGAAAAGTAAGGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926687138 2:15706788-15706810 ATGCCCATCCACATTGGTGAAGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG + Intergenic
929860545 2:45673399-45673421 ATTGCCATCCAGAAAACTGATGG - Intronic
930086158 2:47498733-47498755 ATCCCCCTCCAAAAAAGTGAAGG + Intronic
931041637 2:58307126-58307148 ATGCCCATCCAGAAAAATAAAGG - Intergenic
932178035 2:69620531-69620553 AAGAGCATTCAGAAGAGTGATGG - Intronic
932652665 2:73576018-73576040 ATTCACATGCAGAAGAATGAAGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933736246 2:85497068-85497090 ATGCCCATTCAGAAGGGTGAAGG - Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
940656530 2:156493839-156493861 ATGGCCATTCAGATGAGGGAGGG - Intronic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171231029 20:23485288-23485310 ATGCCCATCCACACTGGTGAGGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173114555 20:40228381-40228403 CTGCCCATGGAGAAGACTGAGGG - Intergenic
1173490328 20:43474499-43474521 ATAGCCAACAAGAAGAGTGAGGG + Intergenic
1175056787 20:56205968-56205990 ATGCCCACCCAGATTAGGGATGG + Intergenic
1175372921 20:58504674-58504696 AGCCCCATCCACAAGACTGAGGG + Intronic
1175510054 20:59518079-59518101 TGGACCATCCAGAAGAATGACGG - Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177801700 21:25834490-25834512 AAGCCCTTCCAGCTGAGTGACGG + Intergenic
1178633348 21:34281367-34281389 ATGCCCATCGACAAGGGAGATGG + Intergenic
1178702381 21:34844648-34844670 ATGCTCATCCAGCAGTGTGGAGG + Intronic
1180184199 21:46131430-46131452 ATGGCCAATCAGAAGAGTCAGGG + Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183825668 22:40384915-40384937 ATCCCCATTCAGAATAGGGATGG + Intronic
1184142281 22:42584937-42584959 AGGCCCAACCAGAAGAGAGCTGG + Exonic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951445508 3:22775122-22775144 ATTCACATCCAGAAAAATGATGG - Intergenic
953135474 3:40177933-40177955 ATGGCCATTCAAAAGAGAGAAGG - Intronic
953473590 3:43186918-43186940 ATGGCCCTCCAGAACAGGGAGGG - Intergenic
954287358 3:49628588-49628610 CTGCCCATCCAGCAGAGAGCAGG + Intronic
954305281 3:49722343-49722365 ATGTCCATCCAGAAGCCTGTAGG + Exonic
956097901 3:65736738-65736760 ATGCCCATCCACATTGGTGATGG + Intronic
957630305 3:82709492-82709514 ATGCCCACCCACAATAGTGAAGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958856387 3:99391139-99391161 CTGCCCACCCAGTAGAGTGATGG - Intergenic
961406697 3:126684772-126684794 ATGCCACTCCAGAAGATTGTTGG + Intergenic
963928765 3:150979581-150979603 ATGCGCATCTAGAACAGTTATGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965315405 3:167183785-167183807 ATGCCCATCCTGAAGGTTGTTGG - Intergenic
965422628 3:168480886-168480908 ATGCCCATCCACATTGGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG + Intergenic
967514036 3:190346031-190346053 ATGAACATTCAGAAGTGTGATGG + Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969435524 4:7187012-7187034 ATGTCCAACCAGAAGACGGAGGG - Intergenic
969948054 4:10805180-10805202 ATGCCCACCCACATTAGTGAGGG - Intergenic
970554713 4:17219793-17219815 AAGCCCAGCCTGAAAAGTGATGG - Intergenic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973970362 4:56207398-56207420 CTGCCTATCCAGGAGAGTGAAGG + Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
977051239 4:92130101-92130123 AAGCCTATCCAAAAAAGTGAAGG + Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978052578 4:104220557-104220579 ATGCCCATCCACATTGGTGAGGG - Intergenic
978344460 4:107752485-107752507 ATGCCCACCCACATGGGTGAAGG + Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980592200 4:134904829-134904851 AAGCCCACCCACAATAGTGAGGG + Intergenic
980844722 4:138310787-138310809 ATGCACATCATGATGAGTGACGG - Intergenic
980874930 4:138652107-138652129 ATGGCCAACAAAAAGAGTGAGGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981080986 4:140639043-140639065 ATGCCCATTCAAAGGAGTAAAGG - Intronic
982731723 4:158963457-158963479 ATGCCCAGCTAGTAGAGAGAGGG + Intronic
984429514 4:179629818-179629840 AAGCCCAGCCAGAAGCCTGAGGG + Intergenic
987376288 5:17238043-17238065 ATATCCATCCAAAAGAGAGAAGG - Intronic
987574582 5:19708562-19708584 ATGCCCATGCTGAAGATTGTTGG + Intronic
988103951 5:26718911-26718933 ATGCCCATCTACATAAGTGAGGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989413106 5:41142652-41142674 ATGCCCAAACAGGAGAGTCAGGG + Exonic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990939965 5:61192134-61192156 ATGCCAATCCAAAAGTGTGAGGG + Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
997572779 5:134944827-134944849 ATGCCCTTGCTGAAGAGAGAAGG + Intronic
998550357 5:143071418-143071440 ATCCACATGCAGAAGAATGAAGG + Intronic
999092658 5:148951086-148951108 AGGCCCTTCCACAAGACTGAAGG - Intronic
999486666 5:152004084-152004106 GTTCCCATCCAGAAAAGTGGGGG + Intergenic
999522066 5:152361007-152361029 ATGCCTGTCCACAATAGTGAGGG - Intergenic
999833778 5:155347189-155347211 AAGCCCATGCAGAAGATGGAGGG - Intergenic
1002882993 6:1269280-1269302 GTGCCCACCAAGAAGTGTGATGG + Intergenic
1003142695 6:3484957-3484979 ATTCCCATCCTGAACAGTGGTGG + Intergenic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1005049197 6:21667530-21667552 ACGCCCGTCCAAAAGAGGGATGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1005998545 6:30947521-30947543 ATACCTAGCCAAAAGAGTGAAGG - Intronic
1006234436 6:32616187-32616209 ATGCCCACCCATATTAGTGAGGG + Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011357282 6:86484989-86485011 ATACTCATCTGGAAGAGTGAAGG - Intergenic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1017386442 6:153890225-153890247 ATGCCCACCCAGAAGGGTGAAGG - Intergenic
1017878373 6:158542578-158542600 TTGCCCATACAGCAGAGTGTGGG + Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1018870944 6:167781669-167781691 GTGAACATCCAGAAGAGAGAAGG + Intergenic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020650458 7:10868797-10868819 ATGCCCATCTGTAAAAGTGAGGG - Intergenic
1021808871 7:24383246-24383268 ATGCCCATCCAGAAGGGACTGGG + Intergenic
1024403578 7:48951915-48951937 ATTCCCATACAAAAGACTGAAGG - Intergenic
1025864612 7:65369271-65369293 ATGCCCATTCAGAGGAGTAATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028676757 7:93473178-93473200 ATGCCAATCCAGCTGAGTTAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031752175 7:125589596-125589618 ATGCGCATGAAGATGAGTGAGGG - Intergenic
1032166315 7:129547776-129547798 ATGCCCATCCACATTGGTGACGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1042962490 8:74319437-74319459 ATGCCCATTCAGAACATTTAAGG + Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1044751587 8:95421779-95421801 GTGCCCAGCCAGGAGGGTGATGG + Intergenic
1045165114 8:99595418-99595440 ATTCCCATGCAAAAGAATGAAGG + Intronic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047376361 8:124301071-124301093 ATACCCATCCACAAGAGAGTGGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051783247 9:20713268-20713290 ATGTGCATACAGCAGAGTGAAGG - Intronic
1052593233 9:30526075-30526097 ATGGCCATCAAGAAGAGAGCGGG - Intergenic
1054832249 9:69638788-69638810 GTGCCCATTCAGAAGATTGATGG + Intronic
1055555441 9:77468808-77468830 ATGTCCAGCCAGAGGGGTGAGGG - Intronic
1055743671 9:79418204-79418226 AGGCCCATCCAGATTAGGGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056543811 9:87596423-87596445 CTGCCCAGCCAGAACACTGAAGG + Intronic
1057015216 9:91645124-91645146 AGGCACCTCCAGAAGAGTAAGGG + Intronic
1057073549 9:92121378-92121400 ATGCCCACCCACATTAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1185983712 X:4807378-4807400 ATACCCATCCACATGGGTGAGGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187731681 X:22261890-22261912 ATGCCCATCAACAACAGAGAAGG + Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193644144 X:84046729-84046751 AAGCCCATCCTGAGGTGTGAGGG - Intergenic
1193695699 X:84705220-84705242 ATGCCAGTCCAGAATAGTGAAGG + Intergenic
1193939521 X:87663512-87663534 ATGCCCATGCAGAAAAGTCTTGG + Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1195770143 X:108342128-108342150 ATCCCCATCCTGAAGACGGATGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196517906 X:116634822-116634844 ATCCATATGCAGAAGAGTGAAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198921695 X:141735926-141735948 ATGCCCATCCACATCAGGGAGGG - Intergenic
1199715572 X:150505338-150505360 ATGACCACCCAGTAGGGTGAAGG - Intronic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic