ID: 905160217

View in Genome Browser
Species Human (GRCh38)
Location 1:36026401-36026423
Sequence ATTTAAAAACAGATGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1052
Summary {0: 1, 1: 0, 2: 11, 3: 118, 4: 922}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905160217_905160220 10 Left 905160217 1:36026401-36026423 CCCAGCCTCATCTGTTTTTAAAT 0: 1
1: 0
2: 11
3: 118
4: 922
Right 905160220 1:36026434-36026456 TATTTTAAAAAAATCCTCTGAGG 0: 1
1: 1
2: 9
3: 131
4: 970
905160217_905160221 11 Left 905160217 1:36026401-36026423 CCCAGCCTCATCTGTTTTTAAAT 0: 1
1: 0
2: 11
3: 118
4: 922
Right 905160221 1:36026435-36026457 ATTTTAAAAAAATCCTCTGAGGG 0: 1
1: 0
2: 7
3: 91
4: 860

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905160217 Original CRISPR ATTTAAAAACAGATGAGGCT GGG (reversed) Intronic
900988847 1:6088676-6088698 AATTAAGAACACATCAGGCTGGG - Intronic
901111951 1:6804311-6804333 ATTAAAAAACAAATCAGGCTGGG - Intronic
901313504 1:8288860-8288882 AATAAAAAACAGAGTAGGCTGGG - Intergenic
901340909 1:8498398-8498420 ATTTATATATAGTTGAGGCTGGG + Intronic
901552404 1:10005356-10005378 AAATAAAAACAGCTGAGGCTGGG - Intronic
901707786 1:11089312-11089334 ATTTAAGAAAACATGGGGCTGGG + Intronic
902059199 1:13627934-13627956 ATTTGAAAAAAGAAAAGGCTGGG - Intergenic
902078973 1:13808189-13808211 TTCTAAAAACAGTTGATGCTGGG + Intronic
902537538 1:17129172-17129194 ATTTAAAAAGAGTTTAGGCCAGG - Intergenic
903019539 1:20384500-20384522 ATCTATAGACAGATGAGGCCAGG + Intergenic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903204141 1:21767915-21767937 ATCTAAAAACAGGTCAGGCATGG + Intronic
903831243 1:26176567-26176589 ATTTAAAAACAAATTTGGCCGGG - Intergenic
904145371 1:28386643-28386665 ATTTAAAAAAACACAAGGCTGGG - Intronic
904154389 1:28470726-28470748 ATTTAAAAAGAAAAGAGGCTGGG + Intronic
904214910 1:28911745-28911767 ATTTAAGAACAGGTGTGGCCAGG + Intronic
904746242 1:32713011-32713033 ATTTGAAAACAAAGGAGGCTGGG - Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905423084 1:37861428-37861450 ATTTAAAAACATTTTAGGCCAGG + Intronic
905485139 1:38290839-38290861 ATTTAAAAAATAATAAGGCTGGG - Intergenic
906074845 1:43044447-43044469 AATTAAGCCCAGATGAGGCTGGG + Intergenic
906586185 1:46980890-46980912 ATTTAAAAATAAATGGTGCTGGG + Intergenic
907079108 1:51604950-51604972 ATTTATAAAAACATGAAGCTAGG - Intronic
907301855 1:53491952-53491974 TTTTAAAAACTAATGTGGCTGGG + Intergenic
907492804 1:54819664-54819686 CTTCAAAAACAGGTGAGGCCGGG - Intronic
907572249 1:55493988-55494010 AACTAAAAAGAGATGTGGCTGGG + Intergenic
908242918 1:62202976-62202998 TTTAAAAAACAAATTAGGCTGGG - Intronic
908245333 1:62223372-62223394 TTTTAAAAATAAATGAGGCCGGG - Intergenic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
909441927 1:75705971-75705993 AGTCAAAAGCTGATGAGGCTGGG - Intergenic
909819938 1:80049509-80049531 ATTTAATAAAAGATGAGCATAGG + Intergenic
910002057 1:82353227-82353249 ATTTAAAACCATAGGAGGCCAGG - Intergenic
910625705 1:89304019-89304041 ATTTAAATGCATTTGAGGCTGGG + Intergenic
910977814 1:92925792-92925814 ATTTAAAAACTGAATAGTCTTGG - Intronic
910999215 1:93144808-93144830 ATTTAAAACCACTTGAAGCTGGG - Intergenic
911150143 1:94590535-94590557 ATTCAGAAACAGATAAAGCTGGG + Intergenic
911896252 1:103438332-103438354 TTTTATAAACAGTTCAGGCTGGG - Intergenic
911994893 1:104753827-104753849 TTTTAAAAACAAATTAGTCTGGG - Intergenic
913489943 1:119369652-119369674 ATTTAAAGATAGATGAGAATTGG + Intronic
913705161 1:121413694-121413716 ATTTAAAAGCTGATGTGGTTGGG + Intergenic
914330860 1:146670089-146670111 ATTTAAATGCAGATGACACTTGG + Intergenic
915574941 1:156769287-156769309 ATTTAAATACATAGTAGGCTAGG - Intronic
915967855 1:160327560-160327582 AATTAAAAAAAAAGGAGGCTGGG + Intronic
916292928 1:163186362-163186384 CTTTAAAAAGAAATGGGGCTGGG - Intronic
916332477 1:163633079-163633101 ATTTAAAAACAGACTAGACCAGG - Intergenic
916449316 1:164904754-164904776 ATTAAAAACCAGTTAAGGCTGGG + Intergenic
916673496 1:167046142-167046164 ATATATAAGCAGATGAGGCCAGG + Intergenic
916971074 1:170016961-170016983 GTATAAAAGGAGATGAGGCTGGG + Intronic
917108816 1:171523738-171523760 ATTTAAAAACATTTAGGGCTGGG + Intronic
917422738 1:174881793-174881815 AATTAAAAGCAAATGAGGCCAGG - Intronic
918051799 1:180979909-180979931 ATCAAAAAAGAGATGGGGCTGGG + Intronic
918278980 1:182984344-182984366 ATTTAAAAATGGTTCAGGCTGGG + Intergenic
918321521 1:183369570-183369592 ATTGAAAAAAAGAATAGGCTGGG - Intronic
918482976 1:184999470-184999492 AGATAAAAGCATATGAGGCTAGG - Intergenic
918629311 1:186696818-186696840 ATTAAAAGACAAATGATGCTAGG + Intergenic
919446766 1:197714266-197714288 TTTTAAAAATTGATAAGGCTGGG - Intronic
920188943 1:204180013-204180035 ATTAAAAAGCAAATGGGGCTGGG + Intergenic
920821112 1:209381894-209381916 ATGAAAAAACAAATGAGGCTGGG - Intergenic
921122079 1:212145967-212145989 TTTAAAAAACAGATGGGGCCTGG - Intergenic
921209762 1:212884295-212884317 ATTTAAAAAAAAAACAGGCTGGG + Intronic
921352017 1:214245494-214245516 ATTTAAAACCACATTAGGCCAGG - Intergenic
921687160 1:218103248-218103270 ATGTAAAAGCACATAAGGCTGGG - Intergenic
921742835 1:218706217-218706239 ATTCAAAAAAAGTGGAGGCTTGG + Intergenic
922467131 1:225852187-225852209 ATTTAAAAATGAATGAGGCCGGG + Intronic
922529333 1:226331463-226331485 CTTTAAAAAAAAATGAGGCTGGG - Intergenic
922879220 1:228967379-228967401 TTTAAAAAACAAATGATGCTGGG - Intergenic
923058731 1:230450931-230450953 ATTTAAAAATAAAAGAGGCCGGG + Intergenic
923188552 1:231597575-231597597 ATTAAAAAAAAGAAGAGGCCGGG - Intronic
924054335 1:240110817-240110839 TTTTAAAAAAAATTGAGGCTAGG + Intronic
924081463 1:240402811-240402833 ATTTAAAAAATAATGAGACTGGG + Intronic
924326955 1:242905043-242905065 GTTAAAAAACAGTAGAGGCTGGG + Intergenic
924353772 1:243147883-243147905 TTTAAAAAACAAAAGAGGCTGGG + Intronic
924473813 1:244366457-244366479 ATTAAAATAAACATGAGGCTGGG - Intronic
924509213 1:244714837-244714859 CTTGAAAGACAGATGAGGCCAGG + Intergenic
924563779 1:245179326-245179348 ATTCAAAAACAAAGGAGGCCGGG + Intronic
924605681 1:245532780-245532802 ATTGAAAAGCATATGGGGCTGGG - Intronic
1062984647 10:1756869-1756891 AATTAAGAGCAGATAAGGCTGGG + Intergenic
1063032034 10:2245059-2245081 ATTTAAACACAAGTGGGGCTGGG - Intergenic
1063336013 10:5214742-5214764 ATTTAACAATTGATGAGTCTAGG - Intronic
1063561647 10:7133778-7133800 ATTTAAAAGCATATGAGTCATGG - Intergenic
1064040083 10:11954335-11954357 TTTTAAAAAAAAATTAGGCTGGG + Intronic
1064260155 10:13779021-13779043 ATTTAAAAAAAGAATTGGCTGGG + Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064389695 10:14931263-14931285 ATTAGAAAACGAATGAGGCTGGG + Intronic
1064448089 10:15414480-15414502 ATATAAAATCAAATGAGGCTGGG - Intergenic
1064720119 10:18220555-18220577 AAATAAACACAGATAAGGCTGGG - Intronic
1064821900 10:19346078-19346100 ATATGAAAGCATATGAGGCTGGG - Intronic
1065007836 10:21395917-21395939 TTTAAAAAATAAATGAGGCTGGG + Intergenic
1065323135 10:24527302-24527324 ATTTAAAAAAATTTTAGGCTGGG + Intronic
1065323145 10:24527382-24527404 ATTAAAAAAAAAATTAGGCTGGG - Intronic
1066129870 10:32382518-32382540 TTTTTAAAACAAATGAGGCCAGG + Intergenic
1066627804 10:37427143-37427165 AATTAAAAACAAAGGAGGCCAGG - Intergenic
1066748233 10:38624549-38624571 AATAAGAAACACATGAGGCTAGG + Intergenic
1067377666 10:45742609-45742631 ATATAAAAATAGATTAGGCCGGG - Intronic
1067391674 10:45868927-45868949 ATTTAAAAAAAGAGGGGGCCGGG + Intergenic
1067403008 10:45994735-45994757 ATTTAAAAAAAGAGGGGGCCGGG - Intronic
1067871616 10:49967215-49967237 ATTTAAAAAAAGAGGGGGCCGGG - Intronic
1067885366 10:50083293-50083315 ATATAAAAATAGATTAGGCCGGG - Intronic
1068052458 10:51967750-51967772 ATGTAAAAACCCATGACGCTAGG - Intronic
1068108008 10:52643926-52643948 ATGTCAAAACAAATCAGGCTAGG + Intergenic
1068130383 10:52888960-52888982 ACTTAAAAACAGGGCAGGCTTGG + Intergenic
1068273208 10:54756970-54756992 ATTTGAAGACAGAGGATGCTTGG + Intronic
1068294512 10:55052402-55052424 TTTTAAAAGTATATGAGGCTGGG + Intronic
1068668994 10:59705931-59705953 AATTTAAGACAGATAAGGCTGGG - Intronic
1069399723 10:68030142-68030164 TTTTAAAAACATATAAGGCCGGG + Intronic
1070151831 10:73810161-73810183 ATTTAAAAACAGTTCAGGACAGG + Intronic
1070348172 10:75565777-75565799 ATTAAAGGACAGAGGAGGCTGGG + Intronic
1070350892 10:75591352-75591374 AGTTAAAAACAGATGGGGCAAGG + Intronic
1070351358 10:75594904-75594926 ATATGCAAACAGATGAGGCATGG - Intronic
1070876790 10:79821345-79821367 ATTTAAAAACATATAAGAATTGG + Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1071959539 10:90796719-90796741 ATTAAAAAACAGACAAGGCTAGG + Intronic
1072086523 10:92084872-92084894 GTTAAAATACAGATGAGGCCGGG - Intronic
1072176402 10:92926826-92926848 ATTTAAAAAAATATGGGGCCGGG - Intronic
1072363339 10:94682786-94682808 ATAGAAAAGCTGATGAGGCTGGG + Intergenic
1072669444 10:97418695-97418717 ATTTAAAAAAGAAAGAGGCTTGG + Intronic
1072955286 10:99882767-99882789 ATTTAAAAAAAAATAAGGCCAGG + Intronic
1072961797 10:99935858-99935880 ATTTAAAAAAAAATTAGGCCAGG - Intronic
1072964530 10:99960508-99960530 ATTTAAAAAAAAATTAGGCCAGG + Intronic
1073039980 10:100597019-100597041 CATTAAAGAAAGATGAGGCTGGG - Intergenic
1073426977 10:103460782-103460804 ATTTTAAAATACTTGAGGCTGGG + Intergenic
1073433237 10:103500394-103500416 AGTTAGAAACTGATGGGGCTGGG + Intronic
1074379297 10:112965876-112965898 TTTTAAAAATATTTGAGGCTGGG + Intronic
1074586940 10:114776911-114776933 ATTAAAAAACATTTTAGGCTGGG - Intergenic
1074745843 10:116531543-116531565 ATTTAAAAAAAGGATAGGCTGGG + Intergenic
1075355043 10:121764244-121764266 ATTTAACAACAGGGGAAGCTGGG + Intronic
1076176030 10:128368461-128368483 TTTTAAAAACAGACCAGGCGCGG - Intergenic
1076185636 10:128446239-128446261 ATTTAATTATGGATGAGGCTGGG - Intergenic
1076664437 10:132078105-132078127 TTTTAAAAACACAAGAGGCTGGG - Intergenic
1077258704 11:1604053-1604075 ATGTAAAAAAAGATGTGTCTTGG + Intergenic
1077590514 11:3487358-3487380 CATGAAAAACAGTTGAGGCTGGG - Intergenic
1078076931 11:8170728-8170750 ATTAAAAAGCAGTTGAGACTGGG + Intergenic
1078205720 11:9227809-9227831 ATTAAAAAAAAAATGAGGCCAGG + Intronic
1078242157 11:9539490-9539512 ACTCAAAAACAGATCAGGCCGGG - Intergenic
1078286999 11:9967074-9967096 ATTTAAAAATAAATGAGGCCTGG + Intronic
1078570221 11:12451416-12451438 ATTTGATGACACATGAGGCTAGG + Intronic
1078606115 11:12777086-12777108 CTTTAAAAAAAAATAAGGCTGGG - Intronic
1078606938 11:12785268-12785290 ATCTGAAAACTGAGGAGGCTGGG - Intronic
1079629972 11:22662722-22662744 ATTTAAAACTAGATGAGGCAGGG + Intronic
1079780445 11:24595668-24595690 ATTTATAAATAAATGAAGCTAGG + Intronic
1080000158 11:27338022-27338044 ATTTAAAAATATCCGAGGCTGGG + Intronic
1080478260 11:32618845-32618867 TATTAAAAAAAGAAGAGGCTGGG - Intronic
1080506952 11:32924266-32924288 ATTTAAAGACAGTGGAGGCCAGG + Intronic
1080583482 11:33661980-33662002 ATTTAAAAATATATGCAGCTTGG + Intronic
1081036067 11:38148295-38148317 AATTAAATACCAATGAGGCTGGG - Intergenic
1081124497 11:39306337-39306359 AATATAAAACAGATGAGGTTAGG + Intergenic
1081236307 11:40651335-40651357 AATTAAAAAGAGATGGGGGTGGG + Intronic
1081310155 11:41560858-41560880 TTTAAAAGAGAGATGAGGCTGGG - Intergenic
1081315393 11:41624469-41624491 ATTTACAAACACCTGAGACTGGG + Intergenic
1082083596 11:48031151-48031173 AAATAACAAAAGATGAGGCTAGG - Intronic
1082863224 11:57874618-57874640 ATTTAAAAAAAAATGCTGCTGGG + Intergenic
1083245554 11:61424746-61424768 ATTTAAAAAAAAAGAAGGCTGGG - Intronic
1083465906 11:62845930-62845952 AATTAAATAAAAATGAGGCTGGG - Intergenic
1083746291 11:64738732-64738754 ATATAAAAACATATGAGACTGGG - Intronic
1083914646 11:65733447-65733469 ATTATTAAAAAGATGAGGCTGGG + Intergenic
1084246237 11:67859139-67859161 CATGAAAAACAGTTGAGGCTGGG - Intergenic
1084282769 11:68109382-68109404 ATTTAAAAATATAAGAGGCCGGG - Intronic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084826442 11:71735361-71735383 CATGAAAAACAGTTGAGGCTGGG + Intergenic
1085607189 11:77912064-77912086 ATTTAAAACTAGATACGGCTAGG + Intronic
1085639114 11:78180363-78180385 ATTAAAAAACACATAAAGCTGGG + Intronic
1085986541 11:81794231-81794253 ATTAAGAAACATCTGAGGCTGGG - Intergenic
1086406994 11:86507090-86507112 ACTTAAAAACAGAGCAGGTTGGG - Intronic
1087525835 11:99311220-99311242 ACTTAAAAACTAATCAGGCTGGG - Intronic
1087939289 11:104075820-104075842 ATATAAAGACAGATAAGGCCTGG - Intronic
1088120323 11:106361355-106361377 ATTAAGAACCAGAGGAGGCTGGG - Intergenic
1088138894 11:106591862-106591884 ACTTAAAAATAGAAGTGGCTGGG - Intergenic
1088166433 11:106943908-106943930 ATAAAAAAACAGGTTAGGCTGGG + Intronic
1088242463 11:107786251-107786273 TTTAAAACAAAGATGAGGCTGGG - Intergenic
1088272250 11:108045703-108045725 ATTTAAAAAAAAATTAGGCGTGG + Intronic
1088676862 11:112202748-112202770 GTTTAAAAGCATATGTGGCTGGG + Intronic
1089011303 11:115134224-115134246 ATTAAAAAACAAAGGTGGCTGGG + Intergenic
1089656908 11:119954694-119954716 GTTTAAAAAAACATGGGGCTGGG + Intergenic
1089916623 11:122163291-122163313 ATTTGTAAACAGAAAAGGCTGGG + Intergenic
1090090790 11:123695811-123695833 ACTTAAAAATAGTTAAGGCTGGG - Intergenic
1090262266 11:125330217-125330239 AGTGAAAAGGAGATGAGGCTTGG + Intronic
1090297379 11:125600656-125600678 ATTTAAAAAGAAATAAGGCTGGG - Intronic
1090526020 11:127537757-127537779 ATTTAACAAAAGATGAGGTTAGG + Intergenic
1091459548 12:633518-633540 ATTTAAAAACTTCTGAGGCTGGG + Intronic
1091489857 12:923760-923782 ATTTAAAAAAAGAAAAGGCCGGG + Intronic
1092163994 12:6331477-6331499 ATTTAAAAACACATGTTACTGGG + Intronic
1092416802 12:8296264-8296286 CATGAAAAACAGTTGAGGCTGGG - Intergenic
1093031441 12:14292801-14292823 ATTAAAAAACAGAGGAGACTTGG + Intergenic
1093145231 12:15557328-15557350 ATTAAAAAAAAGAAGAAGCTAGG - Intronic
1093772013 12:23029267-23029289 GTTTAAAAAAAAATGAGGGTTGG - Intergenic
1094020249 12:25906254-25906276 TTTTAAAAAAAGATTAGGCTGGG - Intergenic
1094366274 12:29686005-29686027 ATTTAAAAACTGTTGAGTGTGGG - Intronic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1094677712 12:32637294-32637316 ATTTATAAATAAAGGAGGCTTGG + Intronic
1095427659 12:42094360-42094382 AAAAAAAAAAAGATGAGGCTGGG + Intronic
1095627965 12:44340554-44340576 TCTTAAAAATATATGAGGCTTGG + Intronic
1095729379 12:45489954-45489976 ATTAAAAGATGGATGAGGCTAGG - Intergenic
1096052631 12:48624478-48624500 TTTGAAAATAAGATGAGGCTCGG - Intergenic
1096178490 12:49538528-49538550 ATCTAAAAGCAGATGGGGCGGGG - Intergenic
1096274528 12:50194596-50194618 ATTTAAAAATATATGTTGCTGGG - Intronic
1096367290 12:51039430-51039452 AATTAAAAGCAGACTAGGCTGGG + Intergenic
1096455127 12:51778551-51778573 ATTTAAAAACAGGTATGGCCAGG - Intronic
1096989949 12:55792677-55792699 ATTTAAAAAAAGGACAGGCTGGG - Intronic
1097050942 12:56222715-56222737 ATTTAATACCAGATTAGTCTAGG - Intronic
1097093129 12:56523482-56523504 TTTAAAAAAGAAATGAGGCTGGG + Intronic
1097537796 12:60895676-60895698 ATTTAAAAATAGATAAGTGTTGG + Intergenic
1097674016 12:62577786-62577808 ATTTAAAAACAGTTGAGAATAGG - Intronic
1097825457 12:64170825-64170847 ATTTAAAAAAAGAAGAGGAAAGG - Intergenic
1098079825 12:66772239-66772261 ATTGAAAGTCAGATGAGGATGGG - Intronic
1098235085 12:68410589-68410611 CATTAAAAATAGTTGAGGCTGGG + Intergenic
1098403354 12:70097642-70097664 AATTAAAAACAACAGAGGCTGGG - Intergenic
1099091380 12:78314469-78314491 ATTTAAAAATATATGATGCAGGG + Intergenic
1099269049 12:80484300-80484322 ATTAGAAAACAGACTAGGCTAGG - Intronic
1099850026 12:88082395-88082417 ATTTTAAAGATGATGAGGCTGGG + Intronic
1099942039 12:89200035-89200057 ATATAAAAACAAATGCGGCTGGG - Intergenic
1100224764 12:92545058-92545080 ATTTAAAAACAGCTGATACCAGG - Intergenic
1100470029 12:94883126-94883148 ATTTAAAAATAAAACAGGCTGGG + Intergenic
1100649584 12:96570267-96570289 AATTACAAAGAGCTGAGGCTGGG - Intronic
1101001160 12:100359157-100359179 ATTTAAAAACCTATGACGTTGGG + Intronic
1101054347 12:100896748-100896770 GTTTAAAAACAGATGAGCAGAGG + Intronic
1101153545 12:101906556-101906578 ATTTGAAAGGAGCTGAGGCTGGG + Intronic
1101405881 12:104428343-104428365 AATTAAAAAAATATGAGACTAGG - Intergenic
1102065916 12:109975507-109975529 ATTAAAAAACAAAAGGGGCTGGG - Intronic
1102132159 12:110540505-110540527 ATGTAAAAACAAATTAGGCGTGG - Intronic
1102158345 12:110748155-110748177 TTTAAAAAAAACATGAGGCTGGG - Intergenic
1102359521 12:112272343-112272365 AATTAAAAATAAATGAGGCTAGG - Intronic
1102806787 12:115788569-115788591 CCTTCTAAACAGATGAGGCTGGG + Intergenic
1102964388 12:117114653-117114675 ATTTAAAAACAGCACTGGCTAGG - Intergenic
1103108061 12:118247808-118247830 ATTTTAAATAAGTTGAGGCTGGG - Intronic
1103259275 12:119572631-119572653 AAAGAAAAACAGAGGAGGCTGGG + Intergenic
1103401138 12:120643533-120643555 AGTTAAAAACAAATGAAACTTGG - Intronic
1103503883 12:121427240-121427262 TTTTAAAAATAAAAGAGGCTGGG + Intronic
1103647774 12:122408641-122408663 TCTTAAAAACAGAATAGGCTGGG - Intronic
1103868661 12:124074898-124074920 GTATAAAAACAGATTAGGATGGG - Intronic
1104451214 12:128869463-128869485 ATTTCAAAATAGATGGGGCTGGG - Intronic
1105020845 12:132815901-132815923 ATTAAAAAACAAAACAGGCTGGG + Intronic
1105526124 13:21179315-21179337 ATTTAAAAATAGCTGAGGCCGGG + Intergenic
1105536311 13:21267542-21267564 TTTTTAAAACAAATGAGGATTGG - Intergenic
1105543847 13:21337704-21337726 AGGTGAAGACAGATGAGGCTAGG - Intergenic
1105567632 13:21565966-21565988 ATTGAAAAACAGATAAGGTCTGG - Intronic
1105948700 13:25210957-25210979 TTTTAAAATGACATGAGGCTGGG - Intergenic
1106270201 13:28145620-28145642 AGTTAAAAACAAATTAGGCTAGG - Intronic
1106345751 13:28875919-28875941 ATTTAAACATTGATGAGACTTGG + Intronic
1106381743 13:29245990-29246012 ATATTAAAATAGATGAGGCTGGG - Intronic
1106448702 13:29860522-29860544 ATTTAAAAAAAGAGGGGCCTGGG + Intergenic
1106452713 13:29897472-29897494 ATTTAAAAAGCCATGAGGATGGG - Intergenic
1106679654 13:31997071-31997093 ATTTAAAAAAAAAGAAGGCTGGG + Intergenic
1106811685 13:33364592-33364614 ATTAAGAAAAAGAGGAGGCTGGG + Intergenic
1106972772 13:35163356-35163378 ATTAAAAAACAGTTCAGGCTAGG + Intronic
1107663872 13:42668934-42668956 TTTTAAAAAAAGAGGAGACTAGG + Intergenic
1107849912 13:44560958-44560980 ATCTTAAAGCAGATGAGACTAGG - Intronic
1107907657 13:45076349-45076371 AGTTAAAAAAAAATTAGGCTGGG + Intergenic
1108233397 13:48374313-48374335 ACTTAAACTCAGATGAGGATTGG + Intronic
1108355946 13:49628794-49628816 CTTTAAAAACATATGTGGCTGGG + Intronic
1108410581 13:50142629-50142651 ACTTAAAAAAAAATGAGGTTGGG + Intronic
1108710887 13:53031103-53031125 ATTTAAAAGTAGATGAGACATGG + Intronic
1108760630 13:53559391-53559413 ATTTAAAAACACATTAGGTTTGG - Intergenic
1108906651 13:55483473-55483495 ATGAAAAAACACATGAGACTGGG - Intergenic
1109831179 13:67791100-67791122 TTTTATAAGCTGATGAGGCTGGG + Intergenic
1110797547 13:79657652-79657674 ATTAAAAAAAAAATAAGGCTGGG - Intergenic
1111296546 13:86286619-86286641 ATTGAAAATCAGATGAGGCCAGG - Intergenic
1111453185 13:88446077-88446099 ATTATGAAACTGATGAGGCTGGG - Intergenic
1111876499 13:93903783-93903805 TTTTAAAAACAGTTGGGGCGGGG - Intronic
1112180224 13:97070765-97070787 ATTTACAAACCAATGAGGCCTGG + Intergenic
1112473472 13:99710210-99710232 ATTTAAAAATAGGTAAGGGTGGG - Intronic
1112614935 13:100994594-100994616 AGAAAAGAACAGATGAGGCTGGG + Intergenic
1112753764 13:102607884-102607906 ATTTAAAAATAAATGAGGCCAGG - Intronic
1113258376 13:108532496-108532518 TTTTTAAAACAAAAGAGGCTGGG + Intergenic
1113658886 13:112090404-112090426 ATTTAAAAACAGCATAGGCCGGG + Intergenic
1114214606 14:20646851-20646873 GTTTAAAAACACGTGTGGCTTGG - Intergenic
1114327920 14:21608161-21608183 ATTTAAGAATCGATGAGACTTGG + Intergenic
1114428853 14:22643261-22643283 ATTAAAAAAAAAATTAGGCTAGG - Intergenic
1114458115 14:22870256-22870278 TATTCAAAACAGATGCGGCTGGG + Intergenic
1114804686 14:25821347-25821369 ATTTGATTACAGATGAGTCTGGG - Intergenic
1114894464 14:26969827-26969849 TTCTAAAAAAAAATGAGGCTGGG + Intergenic
1115191424 14:30751378-30751400 AGCTAATAAGAGATGAGGCTGGG - Intergenic
1115203908 14:30880916-30880938 ATTCAAAATCAAATGAGGCCGGG + Intronic
1115207654 14:30928078-30928100 ATTTAAAAACATTTGATACTGGG - Intronic
1115500580 14:34045992-34046014 ATTAAAAAATAGAATAGGCTGGG - Intronic
1115693295 14:35869253-35869275 GTTTAAAAAGAGATGAGGCCAGG + Intronic
1116004501 14:39277951-39277973 ATTAAAAAAAAGATGAAGCTGGG - Intronic
1116302065 14:43195496-43195518 ATTAAAAAATACCTGAGGCTGGG - Intergenic
1116501689 14:45631872-45631894 ATTAAAAAGTAGAAGAGGCTGGG + Intergenic
1116812859 14:49556056-49556078 ATTTAAAAAAAAATGGGGCTGGG - Intergenic
1117041977 14:51776099-51776121 ATTAAAAAGCAGATTTGGCTGGG - Intergenic
1117217376 14:53565409-53565431 GTTTCAATAGAGATGAGGCTAGG + Intergenic
1117418851 14:55523819-55523841 ATTTTAAAATAAAAGAGGCTGGG + Intergenic
1117523629 14:56575700-56575722 TTTTGAAGACAAATGAGGCTGGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118834058 14:69463523-69463545 ATTAAAAAACAGATCAGGCCGGG - Intergenic
1118920232 14:70143435-70143457 ATTTACAAACAGATGGGCCTGGG + Intronic
1119271112 14:73305931-73305953 ATTTAAAAAGCAATGAAGCTGGG - Intronic
1119497208 14:75090132-75090154 ATTTAAAAAAAAATAAGGCCAGG - Intronic
1119549794 14:75500251-75500273 AATTAAAAAAAAATAAGGCTGGG + Intergenic
1119967550 14:78933956-78933978 ATTTACAAACAGCTGAAGATGGG - Intronic
1120592687 14:86394667-86394689 ATTTATAAACAAAAGAGGCTGGG + Intergenic
1120706647 14:87752823-87752845 ATTTAAGAAAACCTGAGGCTGGG + Intergenic
1121060842 14:90908267-90908289 TTTTAAATTCAGATGAGGCAGGG + Intronic
1121086135 14:91147434-91147456 ATCCAAAAATAGTTGAGGCTGGG - Intronic
1121179405 14:91917281-91917303 ATGAAAAAACAAATTAGGCTGGG + Intronic
1121236662 14:92396400-92396422 AAGTAGAAACAGATGAGGTTGGG + Intronic
1122102210 14:99421793-99421815 AGTTAATAAATGATGAGGCTAGG + Intronic
1122162472 14:99793910-99793932 ATTTCCAAACAGATGTGGGTCGG - Intronic
1122392821 14:101401971-101401993 ATTTAAAATCAGATCAGGGACGG + Intergenic
1122656820 14:103267616-103267638 ATTTAACATGAGATGTGGCTGGG + Intergenic
1122729847 14:103787943-103787965 AATTAAAAAAAAAGGAGGCTGGG - Intronic
1123025851 14:105423527-105423549 TTTTAATAAAAGTTGAGGCTGGG + Intronic
1124825479 15:33090389-33090411 ATTTGAAAACAGCTAAGGTTTGG + Intronic
1125132370 15:36298529-36298551 ATTTAGAAATAAATGAGGTTTGG - Intergenic
1125652321 15:41327492-41327514 CTTTAAAAAGAAAAGAGGCTGGG + Intronic
1125707007 15:41747432-41747454 ATTTAAAAACATAAGAGGCCAGG + Intronic
1125858137 15:42971008-42971030 GATTAAAAACAGGTGGGGCTGGG - Intronic
1125873572 15:43124371-43124393 ATTTTAAAACACTTCAGGCTGGG + Intronic
1126584830 15:50274093-50274115 AATTAAAAACTGAGGAAGCTAGG + Intergenic
1126650248 15:50912962-50912984 ATTTAAAAAAAAATCAGGCCAGG - Intronic
1126769370 15:52039810-52039832 ATTTAAAGACAAAACAGGCTGGG - Intronic
1127248417 15:57204142-57204164 ATTTAGAAAGTGATGAGGCCAGG + Intronic
1127282635 15:57504924-57504946 TTTTTAAAACAGATGAGGGCTGG + Intronic
1127431174 15:58910241-58910263 ATTTGAAAACAGCTGAAGCGAGG + Intronic
1127457452 15:59167972-59167994 ATTTAAATAAAAATTAGGCTGGG - Intronic
1127491804 15:59472173-59472195 ATTTAAAACCTGAGCAGGCTGGG + Intronic
1127512123 15:59653199-59653221 ATTTAGAAACAGATGAGGGATGG + Intronic
1127568552 15:60217280-60217302 ATTTACACACAGCTGAGGCTGGG - Intergenic
1128290400 15:66474148-66474170 ATTTCAAAACTAATGAGGCTTGG + Intronic
1128956862 15:71956147-71956169 ATTTAAAAAAAGAAAAGGCCAGG + Intronic
1128963710 15:72036440-72036462 AAGAAAAAACAGATGAGTCTTGG + Intronic
1129013715 15:72446720-72446742 ATTTAAGACCAGAGGAGGCTGGG - Intergenic
1129232501 15:74204522-74204544 ATTTAAAATCAGATGGGAGTTGG - Intronic
1129345673 15:74916837-74916859 ATTTAAAAACATACCAGGCCGGG + Intergenic
1129443902 15:75602759-75602781 ATACAAAAACAGATTAGGCATGG - Intronic
1129632412 15:77275420-77275442 TTTAAGAAACAAATGAGGCTGGG + Intronic
1129874798 15:78967005-78967027 TTTTAAAAAAAAATGAGGCTGGG + Intronic
1130219293 15:82004806-82004828 TTTTAAAGACAGATTAGGCCAGG - Intergenic
1130401170 15:83555693-83555715 ATGGAAAAGCAAATGAGGCTGGG - Intronic
1130644499 15:85712127-85712149 ATTAAAACACAGACCAGGCTGGG - Intronic
1131101431 15:89692901-89692923 TATAAAAAACAGATGAGGCCAGG - Intronic
1131225505 15:90621616-90621638 CTTTAAAAACAAAACAGGCTGGG - Intronic
1131280875 15:91020098-91020120 ATTAAAAAAAATATTAGGCTGGG - Intronic
1133400690 16:5484481-5484503 AATTAGAAACAGTTAAGGCTGGG + Intergenic
1133925080 16:10185683-10185705 TTTAAAATACAGATGTGGCTGGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134610927 16:15607251-15607273 ATTAAAAAACAGTGGGGGCTGGG + Intronic
1135102145 16:19615352-19615374 ATTGAAAAAGAAATCAGGCTGGG + Intronic
1135103625 16:19628068-19628090 ATTTAAGAATATATCAGGCTGGG + Intronic
1135128131 16:19828531-19828553 ATTTGAAAACATATCAGGTTGGG - Intronic
1135290286 16:21230587-21230609 ATTTAAAAACAGGTCAGGCGAGG - Intergenic
1135606790 16:23832667-23832689 ATATAAAGACAGAGGAGGATGGG + Intergenic
1135816577 16:25639775-25639797 ATTAAAGAACACCTGAGGCTGGG + Intergenic
1135984097 16:27171002-27171024 ATTAAAGTACAGTTGAGGCTGGG - Intergenic
1136009199 16:27351808-27351830 TTTTAAAGAGAGATGGGGCTGGG - Intronic
1137032647 16:35538318-35538340 AAAGAAAAACAGATGAGGCTGGG + Intergenic
1137340650 16:47600847-47600869 ATTAAAAATCACTTGAGGCTGGG + Intronic
1137515476 16:49139885-49139907 ATTTATAAATACATGAGTCTGGG + Intergenic
1137594421 16:49714359-49714381 AATTAAAAACTGATGGGGCCAGG + Intronic
1137834912 16:51582830-51582852 ATATAAAACCAGATGAGGCCGGG - Intergenic
1137963003 16:52903590-52903612 ATATATGAACAGATGAGGATAGG - Intergenic
1138004229 16:53315944-53315966 TTTTAATCAAAGATGAGGCTGGG + Intronic
1138062984 16:53910829-53910851 ATCTAAAAACAAAACAGGCTGGG - Intronic
1138375136 16:56558152-56558174 ATTTAAAAACAAAATTGGCTGGG + Intergenic
1138818490 16:60229772-60229794 TTTTAAAAACACAGCAGGCTGGG - Intergenic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1140002694 16:71040817-71040839 ATTTAAATGCAGATGACACTTGG - Intronic
1140495784 16:75387058-75387080 AGTTAAAAACAAATGAAGCACGG + Intronic
1140807269 16:78544588-78544610 ATTGAAAATGAGATGTGGCTGGG + Intronic
1141057378 16:80831113-80831135 GTTCAAAAACAGATTTGGCTGGG + Intergenic
1141076728 16:81012888-81012910 ATTTAAAAGCAAAGGAGGCCAGG - Intronic
1141125910 16:81401096-81401118 ACTTAAAGACAGCTGTGGCTTGG - Intergenic
1141167995 16:81673218-81673240 ATTAATAAGCAGGTGAGGCTGGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141877673 16:86837245-86837267 ATTTCAAAACAGACAAAGCTGGG + Intergenic
1142400677 16:89856762-89856784 AAATAAAAAATGATGAGGCTGGG + Intronic
1142406867 16:89894938-89894960 ATTTAAAACCAGCGGAGGCTGGG - Intronic
1142546233 17:705439-705461 ATTAAAAATCAGCTGGGGCTGGG + Intronic
1142580453 17:938762-938784 AATTAAGAACAGAACAGGCTGGG + Intronic
1142593746 17:1019620-1019642 ATTTAAACACAGAGGAGGGAGGG + Intronic
1143144577 17:4766070-4766092 CTTTAAAAAAAAATGAGACTGGG + Intergenic
1144159345 17:12542512-12542534 ATTAAAAAATACCTGAGGCTGGG + Intergenic
1144229009 17:13180801-13180823 ATTTAAAAAAATCTGAGTCTTGG + Intergenic
1144628161 17:16855934-16855956 CTTTAAAAACAAATCAGGCTGGG - Intergenic
1144646115 17:16974724-16974746 ATTAAAAAAAAAATTAGGCTGGG - Intergenic
1144877233 17:18405108-18405130 GTTTAACAGCAAATGAGGCTGGG - Intergenic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1145154997 17:20539298-20539320 GTTTAACAGCAAATGAGGCTGGG + Intergenic
1145159751 17:20566500-20566522 CTTTAAAAACAAAACAGGCTGGG - Intergenic
1146267403 17:31461964-31461986 CTTTAAAAACTAATGTGGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146753586 17:35405676-35405698 ATTTAAAAACAAATTAGGGCTGG - Intergenic
1146770776 17:35567218-35567240 ATCTAAACACAGTTGAGGCCGGG + Intergenic
1146777852 17:35637979-35638001 AATTAAAAAAAGTTTAGGCTGGG - Intronic
1146946178 17:36875232-36875254 ATTTAAAAACAGAGCTGGCCAGG + Intergenic
1147361641 17:39934396-39934418 ATTTCTAGACAGGTGAGGCTAGG - Intergenic
1148010870 17:44480284-44480306 ATTTAAAAAAAAATGCGGCAGGG + Intronic
1148151539 17:45399295-45399317 TTTTAAAATGAAATGAGGCTGGG + Intronic
1148172410 17:45533526-45533548 ATCTAAAAACACTCGAGGCTGGG - Intergenic
1148276859 17:46311926-46311948 ATCTAAAAACACTCGAGGCTGGG + Intronic
1148293069 17:46473598-46473620 ATTAAAACAAAGATTAGGCTGGG + Intergenic
1148315253 17:46691297-46691319 ATTAAAACAAAGATTAGGCTGGG + Intronic
1148616203 17:49001782-49001804 ATTTAAAAACAGTTGTGGAAAGG + Intronic
1148691714 17:49531480-49531502 AATTAAAAATAAATGAGGCTGGG - Intergenic
1149146306 17:53497606-53497628 ATTTAAAAACAAAATTGGCTGGG + Intergenic
1149476212 17:56963056-56963078 AATTAAAACCACAAGAGGCTGGG - Intergenic
1149587182 17:57799114-57799136 ATTTGAAAACCAATGAGGCCAGG - Intergenic
1149816707 17:59732536-59732558 ATTAACAAACAAATGAGGCCGGG - Intronic
1150012355 17:61516687-61516709 ATTCAAAAGCAGATATGGCTGGG + Intergenic
1150403616 17:64880442-64880464 ATCTAAAAACACTCGAGGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG + Intronic
1150696999 17:67414150-67414172 GTTTGAAAACTGATAAGGCTGGG - Intronic
1150914541 17:69423181-69423203 ACTTAAAAACAGCTGAGGCTTGG - Intronic
1151097102 17:71510874-71510896 ATTTAAAACCAGAACAGCCTTGG + Intergenic
1151145542 17:72037047-72037069 ATTCAAAAACAGATGAGATGGGG + Intergenic
1151197705 17:72443743-72443765 ATTTAAAAATAAATAAGGCCAGG + Intergenic
1151590505 17:75041061-75041083 AGTTAAAAAAAGCAGAGGCTGGG + Intronic
1151752635 17:76049367-76049389 CTTGAAAAACAGATGGGGTTTGG + Intronic
1151926628 17:77202321-77202343 ACTTAAAAAAAAAGGAGGCTGGG + Intronic
1152043471 17:77920284-77920306 ATTAAAAAAAAGAAGAGGCTGGG + Intergenic
1152171074 17:78749104-78749126 ATTTAAAAACAAACTAGGCCAGG + Intronic
1152814371 17:82398692-82398714 ATTAAAAAAAAAAAGAGGCTGGG - Intronic
1153021172 18:630402-630424 TTTTAAAATCAGTTGAGGCCGGG - Intronic
1153196808 18:2608499-2608521 TTATAAAAACAAATGCGGCTGGG - Intronic
1153670115 18:7403661-7403683 TCTTAAAAACAGATCATGCTTGG + Intergenic
1153671095 18:7412805-7412827 ATTAAAAAACAGATATGGCCAGG - Intergenic
1153823686 18:8855447-8855469 AATTAAAAACAAACAAGGCTGGG + Intergenic
1154329616 18:13418861-13418883 ATTTTAAAGGAGGTGAGGCTGGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155445100 18:25902871-25902893 ATTAAAAAATAGACAAGGCTGGG + Intergenic
1155526881 18:26725314-26725336 ACTTAAAAACAGAACAGGGTTGG - Intergenic
1155616070 18:27722829-27722851 ATTTAAAAACATTTTTGGCTGGG - Intergenic
1156424443 18:36994597-36994619 ATTAAAAAACATGTGATGCTAGG - Intronic
1156697156 18:39780849-39780871 ATTTAAAAACAGAATAGCCAAGG - Intergenic
1157128687 18:44982432-44982454 ATTTAAAAAGAGTTTAGGCAGGG - Intronic
1158039815 18:53079383-53079405 ATATAGAAACAGATGACCCTTGG + Intronic
1158574384 18:58623845-58623867 ATTTAAAAAAAAATTAGGATGGG - Intronic
1159143108 18:64420971-64420993 TTTTAAACAAATATGAGGCTTGG - Intergenic
1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG + Intergenic
1159429743 18:68336301-68336323 ATTATAAAAAAGATGAGGCCAGG - Intergenic
1160114848 18:76068219-76068241 ATATATACACAGATCAGGCTGGG - Intergenic
1160201189 18:76796858-76796880 ATTTAAACATAGTTCAGGCTGGG + Intronic
1160283013 18:77510987-77511009 ATATAAAAATATATGAGGCCAGG + Intergenic
1161306112 19:3569316-3569338 TTTTAAAAAGAGATGCGGCCGGG + Intronic
1161598594 19:5165988-5166010 AGTTAAACACAGACCAGGCTTGG + Intronic
1161969224 19:7567279-7567301 ATTAAAAAAAATAAGAGGCTGGG + Intergenic
1162213912 19:9116317-9116339 AAAAAAAAAAAGATGAGGCTGGG - Intergenic
1162454526 19:10775375-10775397 ACAGACAAACAGATGAGGCTGGG - Intronic
1162507605 19:11095752-11095774 ATTAAAGAACAGAACAGGCTGGG - Intronic
1162518254 19:11163174-11163196 ATTTAAAAGTACATGAGGCCGGG - Intergenic
1162547770 19:11340975-11340997 ATTAAAAAATAAATGAGGCTGGG + Intronic
1162678375 19:12318286-12318308 ACTTAAAAGTACATGAGGCTGGG - Exonic
1162706405 19:12558310-12558332 TTTTAAAAACTGATGGGGCTGGG + Intronic
1162848886 19:13415443-13415465 ATTTAGAACTAGATGAGGCCAGG + Intronic
1162924143 19:13921319-13921341 ATTTAGCCACAGAGGAGGCTGGG + Intronic
1162927957 19:13939584-13939606 ATTTAAAAAAAAATTAGCCTGGG + Intronic
1163022138 19:14487974-14487996 ATTAAAAATTATATGAGGCTGGG - Intronic
1163303988 19:16465796-16465818 GTATAAAAACAAATGAGGTTAGG + Intronic
1163895449 19:20054326-20054348 ATTGAAATACAAATGAGGCCTGG + Intergenic
1165353311 19:35288982-35289004 AATAAAATGCAGATGAGGCTGGG + Intergenic
1166752499 19:45171004-45171026 TCTTAAAAACAGAAGGGGCTGGG + Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167754945 19:51406643-51406665 ATCAAGAAACAGAGGAGGCTGGG + Intergenic
1167900235 19:52616131-52616153 ATTTAAGAAAAGATTTGGCTGGG - Intronic
1168298952 19:55392526-55392548 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1168393503 19:56029559-56029581 ATTTAAATACAAATGAGGCCGGG - Intronic
1168579798 19:57545585-57545607 ATTTGAAACCATATTAGGCTAGG + Intronic
925050510 2:811134-811156 CATTGAAAACAAATGAGGCTTGG - Intergenic
925352014 2:3207760-3207782 ATTAAAAAACAAAAGTGGCTAGG - Intronic
925948443 2:8888730-8888752 ATTAAAAAACAGTTAAGGCTGGG + Intronic
926164649 2:10513549-10513571 ATTAAAAAGGAGATGTGGCTGGG + Intergenic
926927493 2:18002152-18002174 ATATAAAAGCTGATGGGGCTGGG - Intronic
927543267 2:23930869-23930891 ATTTAAAAAAAAAGGAGGCCAGG + Intronic
927983196 2:27388113-27388135 AATAAAAAACAGTTGAGGCCAGG + Intronic
928340209 2:30436265-30436287 ATTTAAAAAAACAGTAGGCTAGG + Intergenic
928387495 2:30882963-30882985 AGTTAAAAACTGTTGAAGCTGGG - Intergenic
928505841 2:31951824-31951846 TTTTAAAATCAAATGGGGCTGGG - Intronic
928691046 2:33798973-33798995 TTTAAAAAACAAATGAGGCCGGG + Intergenic
929275682 2:40022125-40022147 ATTTAAGAAGAGATTAGGGTGGG - Intergenic
929354942 2:41011006-41011028 AAATAAAAAAATATGAGGCTCGG - Intergenic
929595652 2:43174041-43174063 AGTAAATAACAGGTGAGGCTGGG - Intergenic
929602857 2:43215473-43215495 TTTAAAAAACAGATGAGGCCAGG + Intergenic
930153704 2:48083728-48083750 ATTTAAAAACACTTCAGGCCGGG + Intergenic
930194237 2:48493298-48493320 ATTTAAAAATAGGTAAGGCCGGG - Intronic
930389750 2:50745993-50746015 ATCTGAACACAGAAGAGGCTGGG - Intronic
930749317 2:54917654-54917676 ATTTAAAAAGAAAAGAGGCCAGG - Intronic
930794581 2:55375086-55375108 AGTTAATAATATATGAGGCTGGG + Intronic
931170774 2:59801592-59801614 ATTTAAAAAAAAATTAGGCCAGG + Intergenic
931296546 2:60932287-60932309 ATTTAAGAAAAGAGGAGGCCAGG - Intergenic
931322947 2:61189568-61189590 CTTTAAGAACTAATGAGGCTGGG - Exonic
931372021 2:61672446-61672468 ATTGAAAAATAAATAAGGCTGGG + Intergenic
931605293 2:64046448-64046470 TTTTAAAAACAGTTGAGGCTGGG + Intergenic
932689910 2:73903644-73903666 ATTTAAAAACATAATAGGCCGGG + Intronic
932725476 2:74176467-74176489 ATTTAAAAACAGGCAAGGCCGGG + Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933534179 2:83551864-83551886 ATGTAAAAGCTGATGGGGCTGGG - Intergenic
933583652 2:84155857-84155879 TTTTTTCAACAGATGAGGCTAGG - Intergenic
934048450 2:88190720-88190742 AATTAAGAAAAGATGTGGCTGGG + Intergenic
934311202 2:91866700-91866722 AATAAGAAACACATGAGGCTAGG + Intergenic
934551591 2:95266152-95266174 ATTTATAAAGAAAAGAGGCTGGG - Intergenic
934678841 2:96268056-96268078 TTATAAAAACAGATCCGGCTGGG + Intronic
934688510 2:96339104-96339126 GTTTAAACACACATGTGGCTGGG - Intronic
934910570 2:98250544-98250566 ATTTAAAAATTGTTCAGGCTGGG + Intronic
935044804 2:99471289-99471311 TTTTAAACACAGATGACCCTGGG - Intronic
935186529 2:100739296-100739318 ATTTTAAAAGAGATGAGGCTGGG + Intergenic
935395793 2:102607341-102607363 ATTTAAAAATGGATGAGGAGGGG - Intergenic
935579642 2:104745660-104745682 ATTTTAAAACAAGTGGGGCTTGG + Intergenic
936393495 2:112098275-112098297 ATTTAATAAAAGAAGAGGCTGGG + Intronic
937033106 2:118757337-118757359 CTTTAAAGACTGCTGAGGCTGGG + Intergenic
939151053 2:138473070-138473092 ATGTAAAAATAACTGAGGCTGGG - Intergenic
939240096 2:139547044-139547066 ATTAAAAAACAGACGGGGCCGGG - Intergenic
939760828 2:146176323-146176345 AGTTAAAAACTAATGAGGTTTGG - Intergenic
940444690 2:153764239-153764261 ATTCAAAAAAAGCAGAGGCTGGG + Intergenic
940500774 2:154490844-154490866 ATTAAAAAAAATATGATGCTAGG - Intergenic
940657222 2:156502580-156502602 ATTTAAAAACTCATCAGGCCTGG - Intronic
940849085 2:158671527-158671549 TTTGAAAAACAGATTAGACTGGG - Intronic
941232067 2:162923257-162923279 ATTTAATAACAGATAAATCTTGG + Intergenic
941252392 2:163182154-163182176 AATTAGAAACAGCTTAGGCTCGG - Intergenic
941465515 2:165821713-165821735 ATTTAAAGACACCTGGGGCTGGG + Intergenic
941816435 2:169800233-169800255 ATTTTAAAAGAAATGAGGCCGGG + Intronic
941868313 2:170357080-170357102 ATATAAAAACAGACTAGGCCAGG - Intronic
942374408 2:175322368-175322390 ATTTAAAAACAGATAAAAGTTGG - Intergenic
942518466 2:176778115-176778137 GTTTAAAAAAAGTTGAGGGTTGG - Intergenic
942912127 2:181256942-181256964 TTTTAAAACAAAATGAGGCTTGG - Intergenic
943010850 2:182447281-182447303 ATTTCCAAGCAGATGAAGCTGGG + Intronic
943855975 2:192791358-192791380 ATTTAAAAACAGAAGATTCAAGG + Intergenic
944617657 2:201478776-201478798 ATTCAAAATCAGAAGAGGCTGGG + Intronic
944785907 2:203069953-203069975 AATTTAAAACAAATCAGGCTGGG - Intronic
945400022 2:209370311-209370333 ATTTAAAAACACATTTGGCTAGG + Intergenic
945534224 2:210992085-210992107 TTGTAAAAACATATTAGGCTTGG - Intergenic
945821774 2:214673652-214673674 ATTTAAAGACAACTGAGGCAGGG + Intergenic
946004906 2:216516211-216516233 TTTTAAAAAAAGATGAGCATTGG - Intronic
946102962 2:217342867-217342889 ATTAAGAAATAAATGAGGCTGGG + Intronic
946660224 2:221991790-221991812 ATTTTAAAAAAGATGAGTGTGGG - Intergenic
947189341 2:227485529-227485551 ATTTAAAAACAATTTGGGCTGGG - Intronic
947281706 2:228462512-228462534 ATATAAAAAGAGAAGAGGCAAGG + Intergenic
947413850 2:229872266-229872288 TTTTAAAAAAAGAAGAGTCTGGG + Intronic
947429085 2:230009964-230009986 ATAAAAAAATAGATAAGGCTGGG + Intronic
947435763 2:230070614-230070636 ATTTAAAAATTATTGAGGCTGGG + Intergenic
947510170 2:230745564-230745586 TCTTAAAAGCAGATGAAGCTGGG + Intronic
947526382 2:230878994-230879016 ATTTCAGAACAGAGGAGGCAGGG - Exonic
947711296 2:232317730-232317752 ATTAAAAAATAGAAGAGGCTAGG - Intronic
948128310 2:235581509-235581531 ATTTAAAAAGAAAATAGGCTGGG + Intronic
948177570 2:235956172-235956194 ATGTAAAAAGGGAAGAGGCTGGG + Intronic
948558990 2:238838015-238838037 AATTAAAAATACATGTGGCTGGG - Intergenic
1169094599 20:2885768-2885790 ATTAAAAAAGACTTGAGGCTGGG + Intronic
1169310318 20:4532700-4532722 ATTTGGAAACAGAAAAGGCTAGG + Intergenic
1169429514 20:5524149-5524171 GGTTAAAAAAAAATGAGGCTGGG - Intergenic
1169446217 20:5673079-5673101 ATTTAAAAACAGATATGGCCGGG - Intergenic
1169482561 20:5997872-5997894 ATTGGAAAAGAGAGGAGGCTGGG - Intergenic
1169600791 20:7258441-7258463 ATCCAAAAAGAGATGAGTCTTGG + Intergenic
1169820770 20:9707396-9707418 ATTTAAAACAAGAAGGGGCTGGG - Intronic
1169983136 20:11409951-11409973 ATTTAAAAATAAATAAAGCTAGG - Intergenic
1170197011 20:13699675-13699697 ATTTAAAAAGACATGAGCATGGG - Intergenic
1170619270 20:17980512-17980534 ATTTAAAAAAAAATCAGGCTGGG + Intronic
1170717013 20:18840512-18840534 ATTGAGAAACACATGAGTCTGGG - Intergenic
1172088537 20:32409266-32409288 AAATAAAAATAGCTGAGGCTGGG - Intronic
1172172005 20:32942389-32942411 ATTTAAAAATACATTAGGTTGGG + Intronic
1172315663 20:33952202-33952224 TTATAAAAAGAAATGAGGCTGGG + Intergenic
1172582747 20:36061389-36061411 TTTTAAAAAGAGAGAAGGCTGGG + Intergenic
1172673267 20:36648989-36649011 ATTCAAAAGGATATGAGGCTGGG - Intergenic
1172721516 20:37002323-37002345 AAAAAAAAACAGATAAGGCTAGG - Intronic
1173425808 20:42942428-42942450 ATCCAAAAACAGAACAGGCTGGG + Intronic
1173517212 20:43673339-43673361 ATTTAAAAAGAGGTGAGGTCGGG + Intronic
1174334377 20:49848217-49848239 ATTTAAAAACAGATTAGACTGGG - Intronic
1174403095 20:50286598-50286620 ATTTAAAAACCGAAGACGCGAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174827492 20:53781857-53781879 ATTTAAAAACAAACAAGGCTGGG + Intergenic
1175106539 20:56619074-56619096 TTTTAAATAGAGATGAGGCTGGG - Intergenic
1175545754 20:59776659-59776681 ATTTAAACACAGAAGAGGATGGG + Intronic
1176142398 20:63550447-63550469 TTTTAAAAAAAGAAAAGGCTAGG + Intronic
1176224857 20:63991126-63991148 ATTTTAAAAAACATCAGGCTGGG + Intronic
1177067715 21:16461879-16461901 ATTTAAGAGCAGATGAATCTGGG + Intergenic
1177102337 21:16914014-16914036 ATGTAAAAATAAATGAGGCCGGG - Intergenic
1177157694 21:17515140-17515162 GTTTAAGAACAGCTGAGGCCAGG + Intronic
1177438223 21:21083708-21083730 ATTTTAAAAAAGATGAGGCTGGG - Intronic
1177445237 21:21186932-21186954 TTTTAAAAAAATCTGAGGCTGGG + Intronic
1177507130 21:22033761-22033783 ATATAATAACAGATGAAACTTGG - Intergenic
1177846846 21:26299579-26299601 ATTAAAAAACACTTGGGGCTGGG - Intergenic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178571246 21:33739087-33739109 ATTAAAAAATATCTGAGGCTTGG - Intronic
1178571651 21:33743168-33743190 AATTAAAAGGAAATGAGGCTGGG + Intronic
1178793783 21:35724245-35724267 ATTAAAACTCAGAGGAGGCTGGG - Intronic
1178858801 21:36272352-36272374 ATTTAAAAATAAATCAGGCCGGG + Intronic
1178859226 21:36275138-36275160 ATTTAAAAACAAATCAGGCCGGG - Intronic
1179066430 21:38028841-38028863 ATTTATAAACTGATGAGTTTGGG + Intronic
1179321538 21:40296534-40296556 TTTAAAGAACAGATCAGGCTGGG + Intronic
1179660594 21:42872312-42872334 TTTGAAAATAAGATGAGGCTGGG + Intronic
1180537961 22:16412616-16412638 AATGAGAAACACATGAGGCTAGG + Intergenic
1180681425 22:17629509-17629531 AAATAAAAACAAATGAGCCTGGG - Intronic
1181183986 22:21088402-21088424 TTTTAAAAACATTTAAGGCTGGG + Intergenic
1181275587 22:21685872-21685894 TTTTAAAAAGAAATGAGGCCAGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182226375 22:28801686-28801708 ATTTAAAATAACAAGAGGCTGGG - Intergenic
1182364891 22:29771913-29771935 ATTTAAAAACATTTTTGGCTGGG - Intergenic
1182614467 22:31577581-31577603 TTTTAAGAAGAGAAGAGGCTGGG + Intronic
1183205310 22:36414815-36414837 AATTAAAATCACATCAGGCTGGG + Intergenic
1183471610 22:38010522-38010544 TTTTAAAAACTGATCAGACTAGG - Intronic
1183556830 22:38535002-38535024 ATCTAAAAAAAAAAGAGGCTGGG + Intronic
1183995255 22:41628258-41628280 ATTTAAAAACAGTATTGGCTGGG + Intronic
1184056454 22:42053965-42053987 ATTTAAAAAAAAATGAGACAAGG + Intronic
1184179445 22:42810170-42810192 ATTTAAAATCAAAACAGGCTGGG + Intronic
1184495225 22:44837178-44837200 AATTAAAAACAGTAGGGGCTGGG - Intronic
1185342882 22:50299562-50299584 TTTTGAAAACAGCGGAGGCTGGG - Intronic
949195368 3:1299676-1299698 ATTTAAAATCAGGTGGGCCTGGG - Intronic
949249839 3:1970539-1970561 AATTAAAATCAAATGAGGCTGGG - Intergenic
949285355 3:2396318-2396340 ACTTAAAAACAGGCTAGGCTGGG - Intronic
949737457 3:7190409-7190431 ATTTCAAAACAGATGTGTGTTGG + Intronic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
950019052 3:9773565-9773587 ATTTAAAAAAAGGTGAGTCAAGG + Intronic
950036883 3:9892460-9892482 AGTTAAAAGTAGAAGAGGCTGGG - Intronic
950061897 3:10078647-10078669 ATTTAAAGCAAGATGAGGCCGGG - Intronic
950351138 3:12354448-12354470 GTTTAAAAAAAGAAAAGGCTGGG + Intronic
950397649 3:12746191-12746213 ATTTATAAAGAAAAGAGGCTGGG - Intronic
950687108 3:14626547-14626569 ATTTAAAAAAAGAAGTTGCTGGG - Intergenic
950701107 3:14747788-14747810 TTTTAAAAAATGTTGAGGCTAGG + Intronic
950969800 3:17174885-17174907 ATGTAAAAACAGTTCTGGCTGGG - Intronic
951194774 3:19812005-19812027 ATATAAAAACTGATGGGGCTGGG - Intergenic
951526142 3:23655029-23655051 TTTTAAATACAGATAAGGCCAGG + Intergenic
951601850 3:24385530-24385552 ATTTAAAGGCAGATTATGCTGGG - Intronic
952672607 3:35988600-35988622 ATTAAAATGCAAATGAGGCTGGG - Intergenic
953367749 3:42360911-42360933 AATTGAAAACATATCAGGCTTGG - Intergenic
953647391 3:44767983-44768005 ATTTAAAAACAGGCCAGGCATGG + Intronic
953687838 3:45092088-45092110 ATTTAAATTAATATGAGGCTGGG - Intronic
953776024 3:45818292-45818314 ATTTAAAGGCAGCTGTGGCTTGG + Intergenic
953801667 3:46028880-46028902 AGTTAAAAACAGGTCAGGCATGG - Intergenic
954032333 3:47828474-47828496 AAAAAAAAAAAGATGAGGCTGGG + Intronic
954696138 3:52427783-52427805 ATTTAAAAGAAGATGAGCTTGGG - Intergenic
954721387 3:52566784-52566806 ATTTAAAAACGGTTAAGGCTGGG + Intronic
954923162 3:54209116-54209138 ATTTAAAAAGAGATTTGGGTGGG + Intronic
955068416 3:55552230-55552252 AGTTATAAACAGACGTGGCTGGG - Intronic
955208921 3:56922888-56922910 ATTTAAAAGCAGAACAGCCTGGG + Intronic
955733395 3:62011067-62011089 TCTAAAAAACTGATGAGGCTGGG + Intronic
956221849 3:66912945-66912967 TTTTAAGAAAATATGAGGCTGGG + Intergenic
956373384 3:68588167-68588189 ACATAAAAATACATGAGGCTGGG - Intergenic
956453730 3:69400088-69400110 GTTTAAAAAAAATTGAGGCTGGG + Intronic
956764894 3:72476378-72476400 GTTTAAAAACACATGAGCCTGGG - Intergenic
957060552 3:75477873-75477895 CATGAAAAACAGTTGAGGCTTGG - Intergenic
957295835 3:78331391-78331413 ATAAAAAAATACATGAGGCTGGG + Intergenic
957695088 3:83625983-83626005 ATTTTAAAACAGGTGAGGCCAGG + Intergenic
958052515 3:88366367-88366389 ACTGAAAACCAGATGAAGCTGGG + Intergenic
958061138 3:88482780-88482802 ATTTAAAAACAAATGAGAGATGG - Intergenic
958137643 3:89517244-89517266 ATTTAAAAACAGAAGAGAAAGGG - Intergenic
958425882 3:93978379-93978401 AATTAAAATTACATGAGGCTGGG + Intergenic
958796134 3:98708398-98708420 ATTAAAAAACACATGGGGCTAGG + Intergenic
958867201 3:99515281-99515303 CTTAAAAAACAAGTGAGGCTGGG - Intergenic
959215520 3:103446661-103446683 AGTTGAAAACAGAGGAAGCTGGG + Intergenic
959234455 3:103701125-103701147 ATTTTAAAATAGGTGATGCTGGG - Intergenic
959701293 3:109301354-109301376 ATTTAAAAAAATTTAAGGCTGGG + Intronic
959854737 3:111138380-111138402 TTTTAAAAACAGATGAAAGTTGG - Intronic
960119144 3:113928441-113928463 ATTTAAAAATTGATGAATCTAGG - Intronic
960138523 3:114129760-114129782 ATTTAAATAAAGTTCAGGCTGGG + Intronic
960675518 3:120190959-120190981 ATTTAAAAATGAGTGAGGCTGGG + Intronic
960915408 3:122689602-122689624 CTTTAAAAGAAAATGAGGCTGGG - Intronic
961232495 3:125329651-125329673 ATTTAAAAATATATCTGGCTAGG - Intronic
961894355 3:130154865-130154887 CATGAAAAACAGTTGAGGCTGGG - Intergenic
962117699 3:132529490-132529512 ATTTAAAATGATATTAGGCTGGG + Intronic
962184501 3:133243817-133243839 ATTAAAAAAGACATGAGGCCGGG - Intronic
963145731 3:141991745-141991767 TCTTAAAAACAAAAGAGGCTGGG + Intronic
963199311 3:142569938-142569960 ATAAAAAAACAGTTGGGGCTGGG - Intronic
963666595 3:148195951-148195973 ATCTAAAAAACGATGAGACTTGG + Intergenic
964048312 3:152358903-152358925 TTTAAAAACCAGATGAGGCTGGG - Intronic
964320395 3:155490237-155490259 AAATAAAAAGACATGAGGCTTGG + Intronic
965180373 3:165395097-165395119 AATTTAAAACAGAAGAGACTGGG - Intergenic
965640958 3:170828629-170828651 ATTAAAAATCAGCTTAGGCTAGG - Intronic
965795120 3:172431543-172431565 TCTTAAAAGCAGTTGAGGCTGGG - Intergenic
965851313 3:173029010-173029032 ATGTAATATCAGATGAGGCCAGG + Intronic
966186603 3:177232770-177232792 ATTTAAAAACACTTTAGGCTGGG + Intergenic
966491669 3:180534290-180534312 TTTAAAAAGCAGATGAGGCCAGG + Intergenic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
967138705 3:186534407-186534429 ATTTTAGAACAGGAGAGGCTGGG - Intergenic
967388799 3:188935146-188935168 CTTGAGAAACAGATGAGGTTTGG + Intergenic
967443450 3:189536661-189536683 ATTTAAAAACAGAAAAGGGATGG - Intergenic
967837402 3:193976304-193976326 ATTTAAAACCAGGTAAGACTTGG + Intergenic
968409110 4:371025-371047 AGTTAAAAAAAGATGTGGCCAGG - Intronic
968533794 4:1111682-1111704 ATTTAAAAACAAAAGTGTCTCGG - Intronic
970113507 4:12665101-12665123 ATTTAAAAATAGATGAATCCTGG - Intergenic
970319130 4:14858285-14858307 ATATAAAAAAAGATATGGCTTGG + Intergenic
970900382 4:21151955-21151977 ATATAAAAACAAAATAGGCTGGG + Intronic
970923623 4:21424270-21424292 TCTTAAAAACAAATGAGGATTGG + Intronic
971083499 4:23243216-23243238 ATTAAAAAACCAATGAGACTTGG - Intergenic
971215137 4:24655753-24655775 CATGAAAAAGAGATGAGGCTGGG + Intergenic
972470185 4:39396483-39396505 TTTTAAAAATAAATGAGGCCGGG - Intergenic
972586678 4:40443901-40443923 ATTAAAAGATAAATGAGGCTGGG + Intronic
972944275 4:44234888-44234910 AATTAGAAACAAATGAGCCTGGG - Intronic
973146112 4:46829194-46829216 ATTTAAAACAAGATGAGTATGGG - Intronic
973677242 4:53277755-53277777 ATTAAAAAACAGTCCAGGCTCGG + Intronic
973777954 4:54260702-54260724 AGTTAAAATGAGATGAGGCTGGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974000931 4:56509966-56509988 TTTTAAAAACAGATGAACTTGGG - Intronic
974881233 4:67759869-67759891 ATTAAAACAAAGATGAAGCTTGG + Intergenic
975089783 4:70388406-70388428 AAATAAAAATAGCTGAGGCTGGG - Intronic
975602905 4:76121624-76121646 TTTTAAAAATAGATTAAGCTGGG - Intronic
975748412 4:77496914-77496936 ATATAAAAAAAGATGTGGCTTGG - Intergenic
975817818 4:78237465-78237487 ATTTAAAAACTGATCAGTCAAGG - Intronic
976540408 4:86267840-86267862 ATATAAAAACAGAAGAGGAAGGG - Intronic
976562005 4:86512514-86512536 ATTTAAAACCTTTTGAGGCTAGG - Intronic
976592034 4:86858965-86858987 ATTTAAAAATAAAAAAGGCTGGG + Intergenic
976821376 4:89211085-89211107 AATAAACAACAGATGAGGCTGGG + Intergenic
976912410 4:90323653-90323675 ATTTAAAAAAAAAAGAGGATAGG - Intronic
977234131 4:94486704-94486726 ATAAAAAAACAGATTAGGCCAGG + Intronic
977299002 4:95246259-95246281 ATTTAATAATTCATGAGGCTGGG + Intronic
977939152 4:102839565-102839587 ATTCAAAATCATATGAGGCCGGG - Intronic
977944360 4:102894659-102894681 AATAAGAAACACATGAGGCTAGG + Intronic
978030282 4:103933383-103933405 ATTTAAAAAAAGATCAGCCCCGG + Intergenic
978354281 4:107854508-107854530 ACTTAAAAACAGATGCTTCTAGG + Intronic
978890958 4:113826951-113826973 ATATAAAAATAAATGACGCTAGG - Intergenic
979092816 4:116508052-116508074 ATTGAGAAACAGAGGAGGCCAGG - Intergenic
979196853 4:117929785-117929807 ATTTAAAAACAGACTAAACTGGG - Intergenic
979248034 4:118531755-118531777 TTTAAAAAACAAAAGAGGCTGGG - Intergenic
979306930 4:119156384-119156406 CTTTAAAAACTGATGAGACTAGG + Intronic
980074201 4:128276616-128276638 TTTTAAAAATAAATTAGGCTGGG - Intronic
980083431 4:128368125-128368147 ATTTAACAGTTGATGAGGCTTGG + Intergenic
980372974 4:131902932-131902954 ATATGAAAATAAATGAGGCTGGG - Intergenic
980392390 4:132163514-132163536 ATTTAGAATCAGATGAGCATAGG + Intergenic
980662781 4:135886019-135886041 ATTTATGAACAAATGAGACTTGG + Intergenic
980737007 4:136902893-136902915 ACTTAAAGAGAGATCAGGCTGGG - Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981736585 4:147959290-147959312 ATTTTAAAATAGATTAGGATGGG + Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982095883 4:151923053-151923075 AATTAAAAGCAGATGCTGCTGGG + Intergenic
982583485 4:157208413-157208435 ATTTAGACATAGATGAAGCTGGG + Intronic
982639124 4:157934649-157934671 ATCTAATAACAGAAGAGGCTGGG - Intergenic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
983075184 4:163317058-163317080 ATGTAAGAAGAGTTGAGGCTTGG - Intergenic
983093119 4:163529488-163529510 ATTTTAAAATAAATGAGGGTGGG - Intronic
983289655 4:165785872-165785894 TCTTAAAAAGAGATGAAGCTGGG - Intergenic
983853889 4:172617774-172617796 ATTTAAATAAAGTTAAGGCTGGG - Intronic
983921830 4:173354550-173354572 TCTAAAAAGCAGATGAGGCTGGG + Intergenic
984088711 4:175343791-175343813 TTTTAAAAACATAAGCGGCTGGG - Intergenic
984771717 4:183442403-183442425 CTTTAAAAAAAAATGAGGCCGGG + Intergenic
985050638 4:185987669-185987691 ATTTAAAAAAAAATTAGGCATGG + Intergenic
985167817 4:187116227-187116249 ATTAAAAAACATTTTAGGCTGGG + Intergenic
985250406 4:188018490-188018512 AGTTATATACAGAAGAGGCTGGG - Intergenic
985330881 4:188831463-188831485 ATTTAAAATGAGATGAAACTTGG + Intergenic
985340620 4:188948783-188948805 ATTTAAGAAAAGATGAGGCCGGG - Intergenic
986324478 5:6661826-6661848 TTTTAAAAAAAAATTAGGCTGGG - Intronic
986327962 5:6692755-6692777 TTTTAAAAATAGAAGAGGCTGGG - Intergenic
986352106 5:6890019-6890041 ATTGAAGAACATTTGAGGCTAGG + Intergenic
986610043 5:9558026-9558048 CTTTAAAAACAGGTGAGTTTTGG - Intergenic
986971233 5:13339434-13339456 AAAAAAAAACAGATAAGGCTGGG - Intergenic
987139208 5:14928447-14928469 TTTTAAAAGTAGATGAGGCCGGG + Intergenic
987351649 5:17027251-17027273 TTTTAAAAACAAATGAGGCTAGG - Intergenic
987725969 5:21699908-21699930 ATATAAAAAGTGATTAGGCTTGG + Intergenic
988337911 5:29929986-29930008 ATTTAAGAAAAGTTTAGGCTGGG - Intergenic
988433012 5:31141647-31141669 ATTAAGAAACAGGTGAGCCTTGG - Intergenic
989509559 5:42269165-42269187 CTTTAAACACCAATGAGGCTGGG + Intergenic
989584509 5:43064146-43064168 ATTTAAAAGCTGATGGGGCTAGG - Intergenic
989700557 5:44259164-44259186 TTTTAAGAATAGATTAGGCTGGG + Intergenic
989973615 5:50555203-50555225 ATTTAAAAGCTGATGTGGTTGGG - Intergenic
990247019 5:53873313-53873335 AAATAAAAACAGATGAGGCTGGG - Intergenic
990659920 5:58001934-58001956 ATTTCAAAAAAGAGGAGGGTAGG - Intergenic
990907326 5:60818710-60818732 ATTTAAGAAAACTTGAGGCTGGG + Intronic
991301301 5:65131894-65131916 ATTTAAATAGAGAGGAGGCCAGG - Intergenic
991370010 5:65908605-65908627 TTTTAAAAACTGATTAGGCCAGG - Intergenic
991370036 5:65909028-65909050 ATATAAAAAAAAATGAGGCCAGG + Intergenic
992186448 5:74249173-74249195 GTTTTAAAAAATATGAGGCTAGG + Intergenic
992222425 5:74586030-74586052 TTTTAAAAACAAATTAGGCCAGG - Intergenic
992546416 5:77818111-77818133 CTTTGAAAATAGCTGAGGCTGGG - Intronic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
993871160 5:93256118-93256140 ATTTAAAAAAAGCCAAGGCTGGG - Intergenic
994154192 5:96484393-96484415 ATTTAAAAACAGATGTAGAAGGG - Intergenic
994227357 5:97268361-97268383 ATTTAAAAAAAGAGGAGGGAGGG - Intergenic
994326552 5:98453702-98453724 TTTAAAAAACAGATGAGAGTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994715902 5:103321201-103321223 ATGTAAACAAAAATGAGGCTGGG - Intergenic
995336905 5:111009878-111009900 ATTTAAAAAGAGATAAATCTTGG - Intergenic
995376252 5:111477438-111477460 ATTTGAAAAAAAATGAGGGTGGG - Intronic
995590811 5:113698251-113698273 ATTTAACAAATGATGTGGCTTGG + Intergenic
995713270 5:115055856-115055878 CTTTAGGAACAGATGAGTCTGGG + Intergenic
995957242 5:117792494-117792516 ATTTAAAAAGAGCTGAGCCCCGG + Intergenic
996043174 5:118839656-118839678 ATTTAAAAACAAATTAGGGCTGG - Exonic
996757459 5:126949705-126949727 ATTCAAAAGCAGATGTTGCTAGG + Intronic
996797020 5:127358548-127358570 TTCTAAAAACAGAAGAGCCTGGG + Intronic
998007618 5:138667308-138667330 TTTTAAATAGAGATGGGGCTGGG + Intronic
998089162 5:139352819-139352841 AGATAGTAACAGATGAGGCTGGG + Intronic
998437116 5:142120310-142120332 ATTTATAAACAGACGAGATTGGG - Intronic
999224026 5:150005020-150005042 ATTTATAAACAGAAGTTGCTTGG + Intronic
999907329 5:156156331-156156353 ATATTAAAACAGCTGTGGCTGGG + Intronic
1000084637 5:157878784-157878806 ATTTAAATAGAGATGGGGCCAGG - Intergenic
1000307167 5:160005415-160005437 ATATAAAAATAAATAAGGCTGGG - Intergenic
1000570528 5:162907521-162907543 CTTCAAAATCAGATCAGGCTTGG + Intergenic
1000686708 5:164258898-164258920 ATTTAAAAAGAGTTTAGGTTTGG + Intergenic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1001213801 5:169836049-169836071 ATTTAAAAACAAAACAAGCTGGG - Intronic
1001893015 5:175355264-175355286 TCTTACAGACAGATGAGGCTGGG + Intergenic
1001976284 5:176002413-176002435 ATGCAAAAAAAAATGAGGCTGGG + Intronic
1002060908 5:176625555-176625577 ATTCAAACCCAGCTGAGGCTGGG + Intronic
1002116975 5:176969973-176969995 ATTTAAAATCATTTCAGGCTGGG + Intronic
1002241138 5:177841354-177841376 ATGCAAAAAAAAATGAGGCTGGG - Intergenic
1002305674 5:178281196-178281218 ATCTAAAAACAGATGAATTTGGG + Intronic
1002352927 5:178597121-178597143 ATTAAAAGACTGAGGAGGCTAGG - Intergenic
1002547702 5:179961985-179962007 ATTCATAAACAGATAATGCTAGG - Intronic
1003004208 6:2366027-2366049 AATTAAAAAGAAATTAGGCTAGG + Intergenic
1003168521 6:3701923-3701945 ATATAAAAACACTTGAGACTGGG + Intergenic
1003343291 6:5242422-5242444 ATTTAAAAATACATGAGGCTGGG + Intronic
1003692480 6:8368121-8368143 ATTAAAAAACAGAACAGGCTGGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004420320 6:15463725-15463747 ATTTGAAAACAGAACAGGCTGGG - Intronic
1004674620 6:17829529-17829551 ACTTAAAATCACATGAGGCCAGG - Intronic
1004832155 6:19488536-19488558 AATTAAAAATATATCAGGCTGGG - Intergenic
1004858237 6:19773689-19773711 TTTTAAAAACGGATCTGGCTGGG + Intergenic
1004885684 6:20049783-20049805 ATTTAGAGAAAAATGAGGCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1004978022 6:20989945-20989967 ATTTAAAAATAAAATAGGCTCGG + Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006351532 6:33524773-33524795 ATTTAAAAAATTATCAGGCTGGG + Intergenic
1006482372 6:34307281-34307303 CTTTAAAAAAAGTTGAGGCCAGG + Intronic
1006859602 6:37161968-37161990 ATTTAAAAACTTTTGAGGCCGGG + Intergenic
1007364541 6:41382131-41382153 ATCTAAAAAGAGAAGAGGCCGGG + Intergenic
1007881189 6:45168618-45168640 ATTTAAAAACAGATGCAGCCAGG - Intronic
1008512533 6:52290199-52290221 ATTTAAGAACAAATGAGGGCTGG + Intergenic
1008622191 6:53281518-53281540 ATTCAAAAACAGATGAAGAAGGG - Intronic
1008953559 6:57188359-57188381 ATTTAAAAAAAGATAAAACTAGG + Exonic
1008981772 6:57491851-57491873 ATTTAAAAGCTGACGAGGCTGGG + Intronic
1009169847 6:60384674-60384696 ATTTAAAAGCTGATGAGGCTGGG + Intergenic
1009295767 6:61944793-61944815 AGTAAAAAACATATGAGGCTGGG + Intronic
1009881944 6:69579391-69579413 ATCTAAAAATACATAAGGCTTGG - Intergenic
1010180478 6:73081149-73081171 GTTTGAACACAGAAGAGGCTTGG + Intronic
1010314542 6:74431503-74431525 ATTGAAAAACACATGAAGCCAGG - Intergenic
1010956287 6:82094275-82094297 ACTTAAAGAGAGATGGGGCTTGG + Intergenic
1011391352 6:86857373-86857395 AATTAAAAATAGAACAGGCTTGG + Intergenic
1011481802 6:87801257-87801279 ATCTAAAAACAGAAAAGTCTGGG - Intergenic
1011720185 6:90148185-90148207 GTTTAAAAACATAGGAGACTTGG + Intronic
1013146064 6:107394050-107394072 ATTTAATTACTGATGAGACTGGG + Intronic
1013425264 6:110006256-110006278 ATTTGCAAAAAGATCAGGCTGGG - Intergenic
1014721611 6:124923784-124923806 ATTTAAAAATACCTGAGACTGGG - Intergenic
1014729771 6:125019229-125019251 ATTGAAAAACAGATGATGACAGG - Intronic
1015098367 6:129445262-129445284 ATTTAAATACAGTTCTGGCTTGG + Intronic
1015131804 6:129819564-129819586 ATTAAAAAAAAAATGTGGCTGGG - Intergenic
1015552042 6:134421700-134421722 ATTTGAAAACAGATGTGTCATGG + Intergenic
1015642913 6:135356132-135356154 ATTTTAGAATAGCTGAGGCTGGG - Intronic
1016280486 6:142412285-142412307 ATTAAAAAACAAATGTGGTTTGG - Intronic
1016318263 6:142813859-142813881 ATTAAAAAACATCTGAGGCCAGG - Intronic
1016759921 6:147725682-147725704 TTTTAAAGACAGGTAAGGCTGGG - Intronic
1016829852 6:148423230-148423252 ATTAAAAAACACATGGGGCTGGG - Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1016941707 6:149487768-149487790 ATGTAAGAAAAGATGAGTCTGGG + Intergenic
1017087172 6:150724300-150724322 ATCTAAAGGCAGAGGAGGCTGGG + Intronic
1017382899 6:153850730-153850752 TTTTAAAAACAGTTGTGGCCGGG + Intergenic
1017606359 6:156138648-156138670 ATTTAAAAAAAGATAAGTGTTGG - Intergenic
1017807735 6:157960805-157960827 TTTTAAAAATAAATCAGGCTGGG - Intergenic
1017930077 6:158944443-158944465 ATTTGAAAACAAAAGAGGCCAGG - Intergenic
1018055242 6:160046752-160046774 ATTTAAATACTGATGAGACCTGG + Intronic
1018171072 6:161143378-161143400 ATTAAGAAATAGGTGAGGCTGGG - Intronic
1018190430 6:161305215-161305237 ATTAAAAACCAGCTGAGGCCGGG + Intergenic
1018335234 6:162779605-162779627 ATGTTATAACAGATGAGTCTTGG + Intronic
1018498553 6:164377541-164377563 ATTTCAAAACAGATGCGGAAGGG - Intergenic
1018718455 6:166553805-166553827 ATTTGAAAACAGATGATAGTAGG - Intronic
1018765342 6:166928608-166928630 ATTTAAAGAGAGAAGAGGCCAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020186286 7:5961828-5961850 ATTTAAAAAGTAGTGAGGCTTGG - Intronic
1020225942 7:6280034-6280056 ATTTAAAAAGAGACCAGCCTGGG + Intergenic
1020296628 7:6762946-6762968 ATTTAAAAAGTAGTGAGGCTTGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020438976 7:8197257-8197279 ATTAAAAAAAAGAAGAGGCTGGG + Intronic
1020742449 7:12039062-12039084 ATTTAAAATGAGATTAGGGTGGG + Intergenic
1020838659 7:13186350-13186372 CTTTAAAAAAAGATGAGGCTGGG + Intergenic
1020859439 7:13472595-13472617 AGTAAAGAAAAGATGAGGCTGGG + Intergenic
1021083275 7:16388577-16388599 ATAAAATAACAGTTGAGGCTGGG + Intronic
1021289889 7:18830153-18830175 GTTTAAAAGCAGATGACACTTGG + Intronic
1022109174 7:27217700-27217722 ATTTAAAAAAATAGGAGGCTGGG + Intergenic
1022209409 7:28194039-28194061 ATTAATAAAACGATGAGGCTGGG - Intergenic
1022425408 7:30264172-30264194 ACGTAAAAATAGTTGAGGCTGGG - Intergenic
1022465660 7:30651885-30651907 TTTTTAAAATAGATGAGGGTGGG + Intergenic
1023002527 7:35825446-35825468 ATTTGATGACAGATGAGGGTGGG - Intronic
1023149068 7:37182690-37182712 ATTTAAAAAGCCAAGAGGCTTGG + Intronic
1023165958 7:37343768-37343790 TTTTAAAAAGAAATGGGGCTGGG - Intronic
1023886808 7:44363395-44363417 ATTTAAAAATAAATCGGGCTGGG + Intergenic
1025148857 7:56529426-56529448 ATTTGAAAATAAATTAGGCTGGG + Intergenic
1025214358 7:57043414-57043436 ATTTAGCATAAGATGAGGCTGGG - Intergenic
1025224606 7:57146093-57146115 TTTTAAAAACTGATATGGCTGGG + Intergenic
1025657595 7:63533399-63533421 ATTTAGCATAAGATGAGGCTGGG + Intergenic
1025711936 7:63919842-63919864 ATTTGAAAATAAATTAGGCTGGG + Intergenic
1025777612 7:64572840-64572862 ATTTAAAACCACTTGAGCCTAGG - Intergenic
1025818392 7:64941464-64941486 TTTAAAAAACAAATGTGGCTGGG + Intergenic
1025845817 7:65196156-65196178 ATTTAAAACTAGATACGGCTAGG - Intergenic
1025896042 7:65701869-65701891 ATTTAAAACTAGATACGGCTAGG - Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026526216 7:71155566-71155588 TTTTAAAAAAAGAAGAAGCTGGG - Intronic
1026618295 7:71927503-71927525 CATTAAAAACATTTGAGGCTGGG - Intronic
1026652823 7:72230285-72230307 TTTTAAAAACAGATCAGCCTGGG + Intronic
1026815235 7:73506201-73506223 ATTAAAAAACAAATAAGGCCGGG + Intronic
1026924504 7:74181029-74181051 ACTTAAAAATGGTTGAGGCTGGG - Intronic
1027009200 7:74727629-74727651 ATTTAAAAACAAATGTGGTATGG - Intronic
1027029982 7:74881006-74881028 ATTTTAAAAGAAATGAGGCCAGG - Intergenic
1027129019 7:75577702-75577724 ATATAAAACCAGAGCAGGCTGGG + Intronic
1027385416 7:77654961-77654983 ATTTAAATAAAAAGGAGGCTGGG - Intergenic
1027481001 7:78696231-78696253 ATCAAAAAAGAAATGAGGCTAGG - Intronic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1027970280 7:85071326-85071348 ATTTTGAAACAGTTGAGTCTGGG + Intronic
1028124708 7:87099388-87099410 CTTCAAAACCAGCTGAGGCTAGG - Intergenic
1028280861 7:88926289-88926311 ATTTAAAATCAAAGGAGGCCGGG + Intronic
1028442069 7:90874821-90874843 ATTAAAAAAAGGATGAGGCCGGG - Intronic
1028568909 7:92264705-92264727 ATTTATTGACAAATGAGGCTGGG - Intronic
1028593196 7:92520554-92520576 ATTTAAAAACAGAATAGCCAAGG - Intronic
1029176619 7:98669305-98669327 ATATGAACAGAGATGAGGCTGGG + Intergenic
1029271461 7:99379609-99379631 ATCTTAATCCAGATGAGGCTGGG - Intronic
1029373779 7:100166174-100166196 ATTTAAAAACAGAAGAGTAAGGG + Intronic
1029566872 7:101344614-101344636 ATTAAAAAATAAATTAGGCTGGG - Intergenic
1031377294 7:121043172-121043194 AATGAAAAAGAGATGAGGCAAGG + Intronic
1031402818 7:121345760-121345782 ATTTAAAAGCAAATGATGGTTGG - Intergenic
1031948059 7:127861764-127861786 ATTAAAAAACAAATAAGGCCAGG - Intronic
1031960634 7:127986440-127986462 TTTTATAGACAGATGAGGCCTGG + Intronic
1032007440 7:128314260-128314282 ATTTATAAAGAAAAGAGGCTTGG - Intronic
1032346986 7:131125573-131125595 ATCCAAAAAAAGATCAGGCTAGG + Intronic
1032510138 7:132465887-132465909 TTTTAGAAAAAGAGGAGGCTAGG + Intronic
1032738842 7:134718641-134718663 ATTTTAAAACAGCTGAGGCCAGG - Intergenic
1032773124 7:135079758-135079780 ATGTATAAAAAGATGAGGCTGGG - Intronic
1033128429 7:138724973-138724995 TTCTAAAAACACATGTGGCTGGG + Intronic
1033211120 7:139460964-139460986 ATTGAAAAAAAGAGGAGGTTGGG + Intronic
1034156687 7:148961428-148961450 TTTTAACAAGAGATGTGGCTGGG + Intergenic
1034495024 7:151415283-151415305 TTTTAAAAACAGCTTTGGCTGGG - Intergenic
1034508581 7:151517066-151517088 CTTTAAAATCAAATGCGGCTGGG + Intronic
1034604047 7:152294163-152294185 ACTTAAAAATTGATGTGGCTGGG - Intronic
1034608397 7:152340287-152340309 ATTTAATAGCTGATTAGGCTGGG - Intronic
1035495356 7:159320660-159320682 ATTTAAAAACATATCTGGCTGGG + Intergenic
1035576073 8:706476-706498 ATATAAAAAAAGATAAGGCCAGG + Intronic
1037384564 8:18324407-18324429 ATTTAAAAAAATATTTGGCTGGG + Intergenic
1038280964 8:26164321-26164343 AGTTAAAAACAGAGGAAGATGGG + Intergenic
1038598615 8:28914161-28914183 TTTTTAAAACAGATCAGGCCAGG - Intronic
1038718353 8:30011745-30011767 ATTTGGAAACAGACAAGGCTAGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039063283 8:33589393-33589415 ATTTAATTACATAAGAGGCTGGG - Intergenic
1039094792 8:33871841-33871863 ATTTAAAAAGAAATAAGGCTGGG + Intergenic
1039717356 8:40124074-40124096 TTTTAAAAACATATGAAGCAAGG + Intergenic
1039736655 8:40339823-40339845 ATTTAAACACATGTGAGGCTAGG - Intergenic
1040452167 8:47558936-47558958 ATTTAAAAAACGGTGAAGCTGGG - Intronic
1040516512 8:48139705-48139727 ATTAAAAAAAAGAAGTGGCTGGG - Intergenic
1040914680 8:52556961-52556983 ATTTAAAAACAAAGCAGGGTAGG - Intronic
1040959397 8:53015156-53015178 TTTTAAAAACACAAGTGGCTTGG - Intergenic
1041108654 8:54466099-54466121 TTTTAAAAACAGATTGGGGTTGG + Intergenic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1041486773 8:58386218-58386240 AATGGAAAACAGTTGAGGCTGGG + Intergenic
1041735331 8:61105123-61105145 AAATTAAAACAGATGTGGCTGGG - Intronic
1041812180 8:61923674-61923696 ATTTAAAATAGAATGAGGCTGGG - Intergenic
1042205939 8:66329710-66329732 CTTTAAAAACACATGGGTCTAGG - Intergenic
1042705070 8:71657919-71657941 ATTTAAAAACTCATGACTCTTGG + Intergenic
1043065489 8:75565558-75565580 ATTTTAAAACAAATGAAGCATGG + Exonic
1043429635 8:80182563-80182585 ATTTAAAAAAAGATCACGCCAGG + Intronic
1043615971 8:82126191-82126213 ATCTGAAAACAGATGAGGACAGG + Intergenic
1043690867 8:83149966-83149988 ATATAAAAGCTGATGAGGTTGGG - Intergenic
1043980362 8:86631127-86631149 ATTTAAAAGCAGATGTGGTGTGG + Intronic
1044151980 8:88790908-88790930 ATTTAAAAACAGATTTATCTGGG - Intergenic
1044578914 8:93802674-93802696 ACTTAAAAGCTGAAGAGGCTGGG - Intronic
1044667855 8:94649341-94649363 ATTAAAAAATAAATGAGGCCAGG - Intronic
1045078415 8:98596641-98596663 ATTTAAAAAGAGAAAAGTCTTGG - Intronic
1045155441 8:99463988-99464010 ATTTAAAGACAGTTAAGGCCTGG - Intronic
1045198555 8:99954746-99954768 ATTTAAAAACAAACAAGGCTGGG - Intergenic
1045243757 8:100425137-100425159 ATTGAAAAACAGTTCTGGCTGGG + Intergenic
1046013377 8:108576872-108576894 ATTTTAAAACTGAGGAGGATGGG + Intergenic
1046619560 8:116513867-116513889 TTTTAAAAACAGAAGTGGGTGGG - Intergenic
1046697707 8:117360514-117360536 ATGAAAAATCAGAAGAGGCTGGG + Intergenic
1046743817 8:117855963-117855985 ATTTAAAGAGAGATGCGGCCGGG - Intronic
1046914572 8:119666483-119666505 ATTTAAAAAGAAAAAAGGCTGGG + Intronic
1047041314 8:120999217-120999239 ATATAGAAACACCTGAGGCTGGG - Intergenic
1047263890 8:123287340-123287362 GGTTAAAAACAGATGGGGCCGGG - Intergenic
1047570705 8:126095618-126095640 ATTTAAAAACTGATGGGGCCAGG + Intergenic
1047660803 8:127034374-127034396 TTTTAAAAAAAAATGTGGCTTGG + Intergenic
1047683391 8:127278012-127278034 ATTTAAAAAATTATGTGGCTGGG + Intergenic
1047694838 8:127393364-127393386 ATTTAAAAACCATTCAGGCTGGG + Intergenic
1048017959 8:130514238-130514260 TATTAATAACAGATGAGCCTGGG + Intergenic
1048759924 8:137782753-137782775 TTTTAAAAAAAAATTAGGCTGGG + Intergenic
1049520920 8:143090163-143090185 ATTTAAAAAAAAATGAGGCAGGG + Intergenic
1050087656 9:1983124-1983146 ATTTAATAATGGATGAAGCTAGG - Intergenic
1050135962 9:2464865-2464887 CTTTAAAAGCAGATCAGGCATGG - Intergenic
1051167551 9:14280442-14280464 ATTTAAAAAATGATTAGGATAGG - Intronic
1051445648 9:17135952-17135974 ACTTAACAATAGATGATGCTTGG + Intronic
1051848319 9:21477930-21477952 ATTTAAAAAAAGAACAGGCTGGG - Intergenic
1052326032 9:27217540-27217562 ATTTGAAAACACATGTAGCTGGG + Intronic
1052423637 9:28275441-28275463 AGTTGAAGACTGATGAGGCTGGG - Intronic
1052617491 9:30860214-30860236 ACTTGAAAACAGATGATGCTAGG + Intergenic
1053021910 9:34701131-34701153 CTTGAAAAAAGGATGAGGCTAGG - Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1053528412 9:38853262-38853284 TTTGAGAAACAGATGAGGCAGGG - Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054200638 9:62077695-62077717 TTTGAGAAACAGATGAGGCAGGG - Intergenic
1054637719 9:67510665-67510687 TTTGAGAAACAGATGAGGCAGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1054830120 9:69615581-69615603 ATTTAAAATCTATTGAGGCTAGG - Intronic
1055334985 9:75224290-75224312 AATTAAAAAGAGTTGAGGCTTGG - Intergenic
1055379001 9:75685801-75685823 ATTTAAAAAAAGACGAGGATGGG + Intergenic
1055548375 9:77406710-77406732 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1056174336 9:84019502-84019524 TTTTAAAAAAAGATTAGGCTGGG - Intergenic
1056300278 9:85233114-85233136 ATTTAGAAACAGAGTATGCTAGG - Intergenic
1056517511 9:87369247-87369269 AATTAAAAACATATTTGGCTGGG - Intergenic
1057087434 9:92224540-92224562 ATCTAAAAATGGGTGAGGCTGGG + Intronic
1057493509 9:95541593-95541615 ATTTAAAAAGAGTTCAGGCCAGG + Intergenic
1058321668 9:103639438-103639460 ATTTAAAAAGACAAGTGGCTAGG - Intergenic
1058590177 9:106557110-106557132 TTTTAAAACCAGATAAGGGTTGG + Intergenic
1058639930 9:107073709-107073731 ATTTAATTACAAATGAGGCTTGG - Intergenic
1058935858 9:109768827-109768849 ATTTAAAAATAGACCAGGCAAGG + Intronic
1059205811 9:112463954-112463976 AATTAAAACCACACGAGGCTGGG - Intronic
1059511430 9:114851769-114851791 ATTTAAAAAAACCTGAGGCTGGG - Intergenic
1059749533 9:117234936-117234958 ATTTAAAGAAGGATAAGGCTGGG + Intronic
1060128253 9:121071387-121071409 AATTAAAAAAAAATCAGGCTGGG + Intergenic
1060468162 9:123926265-123926287 ATTAAAATAAACATGAGGCTGGG + Intronic
1060711124 9:125865101-125865123 ATTTAAATACTGATGTGGCATGG - Intronic
1060847411 9:126848381-126848403 AAGTAAAGACAGATGATGCTGGG - Intergenic
1061462801 9:130753719-130753741 ATTTAAGAGGAGATGAGGCCTGG - Intronic
1061689186 9:132311260-132311282 GCTTAAAAAAAAATGAGGCTGGG - Intronic
1062132236 9:134904481-134904503 ATCAAAAAATATATGAGGCTGGG + Intergenic
1062384053 9:136301914-136301936 TCTTAAAAATAGAGGAGGCTGGG + Intronic
1185605034 X:1363885-1363907 ATTTAAAAAAAAATTTGGCTGGG + Intronic
1185878432 X:3718791-3718813 TTTTAAAAACAGCTGAAACTTGG + Intergenic
1185919203 X:4070488-4070510 CTTTAAAAAGAGATGAGTATAGG + Intergenic
1185962350 X:4558747-4558769 ATTTAAAAATAAAAGAGGCTGGG + Intergenic
1185977496 X:4737989-4738011 ATTTACTTACAGATGAGCCTCGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186994112 X:15101547-15101569 TTTTAAAAAGGGAAGAGGCTTGG + Intergenic
1187072036 X:15898150-15898172 TTTAAAAAATAGAAGAGGCTGGG + Intergenic
1187454854 X:19432266-19432288 ACTATAAAACATATGAGGCTGGG + Intronic
1188353418 X:29160004-29160026 ATTTAAGAAGAAAAGAGGCTGGG - Intronic
1188480859 X:30635661-30635683 ATTAAAAAATAGACTAGGCTGGG - Intergenic
1188530676 X:31137312-31137334 TCTTAAAAAGAGATGAGCCTGGG - Intronic
1188794753 X:34448863-34448885 AATTAAAAACAGATGAGATTTGG - Intergenic
1189582080 X:42416929-42416951 ATTTAAAAATAGATGCAACTGGG - Intergenic
1189672227 X:43423419-43423441 ATTAAAAAACATCTGAGGCCAGG + Intergenic
1189766961 X:44381732-44381754 AATTAAAAAAAAATTAGGCTGGG - Intergenic
1190048102 X:47128752-47128774 TTTAAAAAACAGATAAGGCCGGG + Intergenic
1190487653 X:50943792-50943814 ATATTTAAACAGAAGAGGCTGGG - Intergenic
1190704552 X:53016127-53016149 AATAAAAACCACATGAGGCTGGG + Intergenic
1190787009 X:53661327-53661349 TTTTAAAAAAAGGTGAGGCTGGG - Intronic
1192315599 X:70049083-70049105 ATTTGAAAACAGGTGAGGTGAGG + Intronic
1192484871 X:71516365-71516387 ATTCAAAAACAGCTCAGGCTGGG - Intronic
1192614090 X:72599893-72599915 ATTTTAAAAGATATGAGGCCAGG + Intronic
1192815517 X:74586796-74586818 ATTTAAAAATAAGTAAGGCTGGG + Exonic
1193127922 X:77889274-77889296 ATTTAAAAAAGAATGAGGCCAGG - Intronic
1193145401 X:78070890-78070912 ATTCAATAATAAATGAGGCTGGG + Intronic
1193242249 X:79184572-79184594 GTTTAAAAATAGATTAGGCTGGG - Intergenic
1193348575 X:80431557-80431579 ATTTACAAAAGGAAGAGGCTGGG + Intronic
1193698231 X:84735385-84735407 ATATAAAAGCTGATGGGGCTGGG - Intergenic
1194957988 X:100203414-100203436 ATGTAAGAACAGATGGGGCGCGG + Intergenic
1195261704 X:103138480-103138502 ATTTAAAAACAGATGAAATGGGG - Intergenic
1195402471 X:104475969-104475991 AATTAAAACCAGAGAAGGCTGGG + Intergenic
1195458661 X:105099249-105099271 ATTAAAAAATAGCTGAGGCTGGG + Intronic
1195887607 X:109656621-109656643 AGTTGAAGACAGATGAGACTTGG + Intronic
1195951870 X:110283824-110283846 AATTAAAATAAAATGAGGCTGGG + Intronic
1196231123 X:113223219-113223241 TTTGAAAAAGAGATGTGGCTGGG + Intergenic
1196650642 X:118165138-118165160 ATTTAAAAGAAAAGGAGGCTGGG + Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1196930066 X:120673270-120673292 GTTGAAAAATAGGTGAGGCTAGG + Intergenic
1197271810 X:124432719-124432741 ATTCAAAAACAGAGTTGGCTGGG - Intronic
1197590739 X:128406923-128406945 ATTTAAAAACAGGTGTAGATTGG + Intergenic
1197594607 X:128450749-128450771 ATTTAAGAAGAGATTTGGCTGGG + Intergenic
1197803116 X:130372784-130372806 ATTTTAAAGCAGATGCAGCTTGG + Intronic
1198090853 X:133328237-133328259 ATCTAAAAAGAAATGAGTCTGGG - Intronic
1198226244 X:134648394-134648416 ATTTAAAAAACGTGGAGGCTGGG + Intronic
1199038340 X:143079719-143079741 ATTAAGAAATACATGAGGCTGGG + Intergenic
1200129670 X:153834290-153834312 ATTAAAAAACAAATCAGGCCGGG - Intergenic
1200683557 Y:6241584-6241606 ATTAACAAACAAATGAGGCTGGG + Intergenic
1200887507 Y:8283698-8283720 GTAGAAAAACAGATGAGGCCAGG - Intergenic
1201018537 Y:9627839-9627861 ATAAAAAAACAAATGAGGCCAGG - Intergenic
1201049078 Y:9912802-9912824 ATTAACAAACAAATGAGGCTGGG - Intergenic
1201224397 Y:11803966-11803988 GTTAAAAAACAGTAGAGGCTGGG + Intergenic
1201305527 Y:12546677-12546699 GTTTAAAGCCAAATGAGGCTGGG - Intergenic
1201650887 Y:16284586-16284608 ATTTAAAAAAAGAGGAGATTAGG - Intergenic
1201965780 Y:19733574-19733596 ATTTATAAACATAAGAGGCCAGG + Intronic