ID: 905163793

View in Genome Browser
Species Human (GRCh38)
Location 1:36063690-36063712
Sequence ATGAATGTGAATAAATTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905163793 Original CRISPR ATGAATGTGAATAAATTGGA AGG Exonic
902854036 1:19186687-19186709 ATGCATGAGATTAAATAGGATGG - Intronic
903959399 1:27047271-27047293 ATGAATGTGAGTTTATGGGAAGG - Intergenic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
905358367 1:37400828-37400850 ACGAATGCAAATGAATTGGAGGG - Intergenic
905562475 1:38938399-38938421 ATGAAGGTGGATAAATAGGCAGG - Intronic
906193224 1:43912508-43912530 AGGGATGTGAATAAACTGAAGGG + Intronic
907073643 1:51559566-51559588 ATGCATATGAATAAAATGGGGGG - Intergenic
908082267 1:60593846-60593868 ATAAATGTGAATAAAATAAACGG - Intergenic
908114914 1:60931123-60931145 AAGAATGAAAATAAATTGGAGGG - Intronic
908230566 1:62100688-62100710 ATGATTGTCAAGAAATTGGTTGG - Intronic
908701950 1:66911800-66911822 ATGACTTTGAATAGAATGGAAGG - Intronic
909224538 1:73001036-73001058 ATATATGTGAATAAATGGTATGG + Intergenic
909240602 1:73207775-73207797 ATGTATGTGTATAATTTTGAGGG - Intergenic
909328674 1:74385840-74385862 ATGAAAGTGCATAAATTGGATGG + Intronic
910080359 1:83334410-83334432 ATGAAAGTAAAAAATTTGGAGGG + Intergenic
910521043 1:88122914-88122936 ATGCTTGTGCAAAAATTGGAAGG - Intergenic
910872965 1:91851899-91851921 CTGAATGTGCATATAGTGGAGGG - Intronic
911006112 1:93226381-93226403 TTGCATTTGAATCAATTGGAAGG + Exonic
911388583 1:97209406-97209428 ATAAATGTGAGTAATCTGGAGGG - Intronic
911921864 1:103773610-103773632 ATGAGTTTGAATAAATTTTAGGG + Intergenic
912402429 1:109406317-109406339 ATAAAGGTGAAAAAATAGGATGG + Intronic
912748379 1:112265080-112265102 ATGAGTTTGAACAAAATGGAGGG - Intergenic
913377910 1:118174980-118175002 AGATATGTGAATAGATTGGAAGG + Intronic
913423446 1:118699255-118699277 ATGAATGTCAATGCTTTGGAAGG + Intergenic
915027715 1:152847906-152847928 ATGCATGTGAAAAAAGGGGATGG - Intergenic
915060986 1:153184799-153184821 CTGAATGTGCAAAAACTGGAAGG - Intergenic
915775231 1:158476700-158476722 ATGAATATGAATAAGATGAAAGG + Intergenic
915991503 1:160521790-160521812 AAGAAAGTGACAAAATTGGAAGG - Intronic
916309463 1:163379205-163379227 ATGTATGTGAATTTATTGTATGG + Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916541880 1:165764747-165764769 AGCAATGTGAAGAAATTGAAAGG + Intronic
917067541 1:171113177-171113199 ATGAATGTGAATACAGTTGAAGG - Intronic
917985643 1:180315536-180315558 GTTAATCTGAATAACTTGGAAGG + Intronic
918923258 1:190744186-190744208 ATGAATATAAATGAGTTGGAAGG - Intergenic
919149786 1:193681210-193681232 ATGATAGTGAATAAATTGACAGG + Intergenic
919360540 1:196588248-196588270 CTGAATGTGAATTAAATAGATGG + Intronic
921014592 1:211176881-211176903 ATGATTTTGAATAAAATGGGAGG - Intergenic
921309898 1:213832384-213832406 ATGAATGTGGTTAAATTTGGGGG - Intergenic
921322604 1:213956865-213956887 ATAAATGAGAATACATAGGATGG - Intergenic
921827724 1:219692688-219692710 ATGAATCAGAATCATTTGGAGGG + Intronic
921906182 1:220497650-220497672 TAGAATGTGCATAAATTGCAGGG - Intergenic
923570364 1:235108014-235108036 AAAAATGTGAAAAAATTGGCTGG - Intergenic
923830017 1:237545103-237545125 ATGAATGTGAACAAATTATTGGG + Intronic
1063752611 10:8968235-8968257 ATGGATATTAAAAAATTGGAAGG + Intergenic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1064291628 10:14039591-14039613 ATGACTTTGAATAGAATGGAAGG - Intronic
1064797707 10:19032231-19032253 AAGAATGTGCATAAAGTAGACGG - Intergenic
1064994188 10:21282029-21282051 AGGAATGGGAAGAAATTGGTAGG - Intergenic
1065049100 10:21772503-21772525 ATGTATGTCAAGAAATTAGATGG - Intronic
1066767722 10:38817814-38817836 ATGAATTTGACTCAAATGGAAGG - Intergenic
1068160607 10:53258253-53258275 AAGAATGTGAATCAATTTGGAGG + Intergenic
1068206431 10:53860371-53860393 ATGAATGTTCTTAAATTTGAAGG + Intronic
1069142725 10:64847600-64847622 TTGAACGAGAATAATTTGGATGG + Intergenic
1069295663 10:66841427-66841449 ATCCATTTGAATGAATTGGAAGG - Intronic
1069656101 10:70089965-70089987 ATGAATGTGATCAAACTTGAAGG + Intronic
1070477683 10:76846190-76846212 ATCAAAGTGAATAAAGCGGATGG + Intergenic
1071702917 10:87961487-87961509 GGGATTGAGAATAAATTGGAAGG - Intronic
1071770355 10:88722338-88722360 ATAAATGCCAATAAAATGGATGG - Intergenic
1074988263 10:118677275-118677297 TTGAAAGTGAAGAAAATGGAAGG - Exonic
1077719776 11:4616272-4616294 ATGAAAGAGAGTAAAGTGGATGG - Intergenic
1080940836 11:36915989-36916011 ATGAATGTGAAAAATTTTTAAGG - Intergenic
1081394870 11:42574705-42574727 ATGAATGGGAACAAATTCAAAGG - Intergenic
1081608216 11:44540934-44540956 ATGGCTGTGAATAAATTGATTGG - Intergenic
1081647117 11:44797764-44797786 ATGAAAGTGAAAAATTTGGGAGG + Intronic
1083215421 11:61215778-61215800 ATGAGTGTGAATGAAAAGGATGG - Intergenic
1083218305 11:61234607-61234629 ATGAGTGTGAATGAAAAGGATGG - Intergenic
1084628888 11:70332629-70332651 ATGAATGGGGAGAACTTGGAGGG - Intronic
1085921609 11:80964252-80964274 CTCAATGTGATTAAGTTGGAGGG - Intergenic
1086891152 11:92259736-92259758 TTGAATTGAAATAAATTGGAAGG + Intergenic
1087047378 11:93853399-93853421 ATGAATTTGAATAGAATGGGAGG + Intergenic
1087334701 11:96829025-96829047 CTGAATGTGAATAACTTGGATGG + Intergenic
1087501024 11:98953852-98953874 ATTAATGTGAATGATTTAGAAGG + Intergenic
1088142195 11:106631055-106631077 ATCCAAGTGGATAAATTGGATGG - Intergenic
1088388436 11:109286802-109286824 ATGAAGGTGAAAAAAATTGAAGG + Intergenic
1089360267 11:117881124-117881146 ATGAATGTGGAGAAGTTGGTTGG - Intergenic
1090099364 11:123778007-123778029 AAGTATGTGACTGAATTGGATGG - Intergenic
1091141932 11:133242715-133242737 ATGAATGTGAGAAAAGGGGAGGG + Intronic
1091574523 12:1720869-1720891 ATGATTTTGAATAGAATGGAAGG - Intronic
1091777965 12:3197022-3197044 ATGAGACTGAACAAATTGGAGGG - Intronic
1093064859 12:14646617-14646639 CAGAATGAGAATAAATTAGATGG - Intronic
1093582662 12:20801762-20801784 ATGATGCTGAAAAAATTGGATGG + Intergenic
1093781615 12:23143612-23143634 ATGGATGTGGAGAAATAGGAAGG - Intergenic
1094290719 12:28846157-28846179 CTGAATGAGAATAAAATGGTGGG - Intergenic
1094785900 12:33847859-33847881 ATGACAGTGAATAAATTTTACGG - Intergenic
1096071381 12:48777232-48777254 CTGAATGGGAAGGAATTGGAGGG + Intronic
1096762472 12:53853623-53853645 ATAAATCTAAATAACTTGGAAGG - Intergenic
1097486091 12:60203151-60203173 ATGAATGAGAATAAAATAAATGG + Intergenic
1097700220 12:62812329-62812351 ATGAATATGAGTAATTTTGAAGG - Intronic
1097740322 12:63234088-63234110 ATGACTTTGAATAAAATGGAAGG + Intergenic
1098315825 12:69192483-69192505 AAGAATTTGAATAAGTGGGAAGG - Intergenic
1100118154 12:91334934-91334956 CTGAATGAGAATAATTTGTATGG + Intergenic
1100593657 12:96053154-96053176 ATGAATGTGTAAAGTTTGGATGG + Intergenic
1100738258 12:97562240-97562262 AAGAATGTGGATACATGGGAAGG - Intergenic
1103456200 12:121067918-121067940 ATGAATTTGGATAAAGTGGTTGG - Intergenic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1103822065 12:123706803-123706825 AGGAATTTTAATAAACTGGACGG - Exonic
1106058343 13:26260539-26260561 ATGGATGGTAACAAATTGGAAGG + Intronic
1106983034 13:35312729-35312751 ATGATTGCTAATATATTGGATGG + Intronic
1108048486 13:46405981-46406003 CTGGGTGTAAATAAATTGGAGGG - Intronic
1108269463 13:48745321-48745343 TTGAAAAAGAATAAATTGGAAGG - Intergenic
1109311356 13:60697826-60697848 ATGAATGAAAATAAATTCCAGGG - Intergenic
1109688639 13:65855227-65855249 AGCAATGAGAATATATTGGAGGG + Intergenic
1109694188 13:65931743-65931765 ATGAAATTTAATAAATTGAATGG - Intergenic
1110139147 13:72105737-72105759 TTGGAGATGAATAAATTGGAAGG - Intergenic
1110358879 13:74602167-74602189 AAGGATGTAAATAAATTGGTAGG + Intergenic
1110584982 13:77179145-77179167 AATAATGTGTATATATTGGATGG + Intronic
1111032218 13:82617522-82617544 ATGTATGTGAAAAAATTATATGG + Intergenic
1111349794 13:87013156-87013178 AGCAATGTCAACAAATTGGAGGG + Intergenic
1111710828 13:91812065-91812087 CTGACTGTGAATAAAGTGGCAGG + Intronic
1111728889 13:92047389-92047411 AGGAATGAGAAAAAATTTGATGG - Intronic
1111919870 13:94398731-94398753 AAGAATGAGAATAAATTAAAAGG - Intronic
1112627520 13:101122672-101122694 ATAAAATTGAATAGATTGGATGG - Intronic
1112634693 13:101202504-101202526 AAGAGTGTGATTGAATTGGAGGG - Intronic
1112848180 13:103669782-103669804 ATAAATGTGAATAAATCTTATGG + Intergenic
1112884615 13:104153748-104153770 ATATATGTTAATAAATTGGTAGG - Intergenic
1113612749 13:111659237-111659259 ATTAATGTGAATTAATTTCAAGG + Intronic
1113626401 13:111851082-111851104 ATGACTTTGAATAGAATGGAAGG - Intergenic
1114745781 14:25145181-25145203 AACAATGTGAATAAATTTTAGGG - Intergenic
1114969595 14:28009195-28009217 ATAAATGTGGATATTTTGGAGGG - Intergenic
1115291757 14:31779963-31779985 AAGAATGTGAATAAAATGCCTGG - Intronic
1115490287 14:33951766-33951788 AAGCATGTGATTAATTTGGAAGG - Intronic
1115923603 14:38406226-38406248 ATGAATATGAATAAAATATATGG + Intergenic
1116053934 14:39839750-39839772 ACTAATGTGGGTAAATTGGAAGG + Intergenic
1116173140 14:41428733-41428755 ATGACTTTGAATAGAATGGAAGG - Intergenic
1116479458 14:45381432-45381454 ATGAATGAGAATAAAATGGAGGG + Intergenic
1116682334 14:47988405-47988427 ATGTATGTGTATAAATAGAAAGG + Intergenic
1117848775 14:59943854-59943876 ATGAAAGCGAATAAGTTGGAAGG - Intronic
1118648328 14:67862934-67862956 ATAAATATGCATATATTGGAGGG + Intronic
1118924221 14:70177218-70177240 ATGAATGTGCAAAAATAGAAGGG + Intronic
1118962383 14:70546583-70546605 ATGACTTTGAATAGAATGGAAGG + Intergenic
1120348026 14:83315186-83315208 AAGAAGGTGAATTAATTTGAAGG - Intergenic
1120631914 14:86901941-86901963 ATGACTATGAATACAGTGGAAGG + Intergenic
1121395230 14:93615880-93615902 ATGTATGTGTATAAATTTGGAGG - Intronic
1126207749 15:46064648-46064670 GTGAATGTGAGTAAATGTGAAGG + Intergenic
1128547105 15:68575730-68575752 ATGCAGGTGATTTAATTGGAAGG - Intergenic
1128824119 15:70694563-70694585 ATGAATGAGAATAAAATGAATGG + Intronic
1128917947 15:71583176-71583198 AAAAAGGTGAATAACTTGGAAGG - Intronic
1131925990 15:97384471-97384493 AATAATGTGAATAAAATAGATGG - Intergenic
1132400926 15:101504723-101504745 ATGAATGAGAATTGCTTGGAGGG - Intronic
1132460666 16:52877-52899 GGGAAGGAGAATAAATTGGAAGG + Intronic
1133652914 16:7829815-7829837 AGGAATGGGAATAAAAAGGAAGG - Intergenic
1134859764 16:17550769-17550791 ATGACTTTGAATAAAATGGGAGG - Intergenic
1135796394 16:25447073-25447095 ATTTATGTGACAAAATTGGATGG - Intergenic
1136652446 16:31684416-31684438 ATGACTTTGAATAGAATGGAAGG + Intergenic
1136746186 16:32594264-32594286 ATGAGTGTGAATTAACTGGCTGG - Intergenic
1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG + Intergenic
1140359169 16:74330300-74330322 ATGAATGGGCAAAAAGTGGAGGG - Intergenic
1140494714 16:75374966-75374988 ATGAAAGTTAATAATTTGGTGGG - Intronic
1140824653 16:78694594-78694616 GTTAATGTGAATAAATGGGCTGG - Intronic
1203048315 16_KI270728v1_random:853468-853490 ATGAGTGTGAATTAACTGGCTGG - Intergenic
1146868374 17:36358682-36358704 AAAAATGTGAATATATTGGCTGG + Intronic
1147071247 17:37959307-37959329 AAAAATGTGAATATATTGGCTGG + Intergenic
1147082773 17:38038832-38038854 AAAAATGTGAATATATTGGCTGG + Intronic
1147098717 17:38162803-38162825 AAAAATGTGAATATATTGGCTGG + Intergenic
1147652852 17:42072051-42072073 ATGACTGTGAATGAGGTGGAGGG + Intergenic
1148703135 17:49603780-49603802 ATGAATGAGAAGTAATTGAAGGG - Intronic
1150454501 17:65295867-65295889 ATGAATGTAAATGATTTGGCTGG - Intergenic
1150573620 17:66410538-66410560 AACAATGTCAATGAATTGGAAGG - Intronic
1150598621 17:66629820-66629842 ATGAATGTGATAAAATTTCACGG + Intronic
1150814684 17:68383718-68383740 AAGTGCGTGAATAAATTGGAGGG + Intronic
1203175992 17_KI270729v1_random:13454-13476 ATGGAACTGAATAAACTGGAAGG - Intergenic
1154047366 18:10919014-10919036 ATATATTTGAATAAATTTGAGGG - Intronic
1154173945 18:12070078-12070100 ATATATTTGAATAAATTTGAGGG + Intergenic
1154928799 18:20970561-20970583 AAGAATATGATTAAGTTGGAAGG - Intronic
1155289440 18:24325778-24325800 ATGAATGTGATTAAACTGGGAGG + Intronic
1155333558 18:24742223-24742245 ATTAATTTGAATACAATGGAGGG + Intergenic
1155818448 18:30345827-30345849 TTAAATGTGAAGAAATTGGAGGG - Intergenic
1156185030 18:34652551-34652573 ATGAATGAAAAGACATTGGAAGG - Intronic
1156705599 18:39877798-39877820 AAGTTTGTGAATAATTTGGAAGG - Intergenic
1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG + Intergenic
1157138535 18:45082566-45082588 ATGTAAGTGAATAAATAGAAGGG + Intergenic
1157333604 18:46721180-46721202 TTGAAGGTGAATGAATTTGAAGG - Intronic
1158249610 18:55472804-55472826 ATAAATGTGAAAATATTGCAAGG + Intronic
1158375180 18:56855469-56855491 ATGAATGAAAATAAATATGATGG - Intronic
1158622617 18:59046218-59046240 ATGTATGTAAAGAACTTGGAAGG + Intergenic
1159610262 18:70517088-70517110 TTACATGTGAATAATTTGGATGG + Intergenic
1159817164 18:73089315-73089337 AAGGATGTGAAGAATTTGGATGG - Intergenic
1162556734 19:11391366-11391388 AAGAAGGTGATTAAATTTGAGGG + Intronic
1164417667 19:28059990-28060012 ATGAGTGTGAACAAATTGGCTGG + Intergenic
1164417850 19:28061166-28061188 ATGGCTGTGAACAAATTGGCTGG - Intergenic
1167168988 19:47818430-47818452 ATAAATGTGAAAGAAATGGATGG - Intronic
925877346 2:8324094-8324116 ATAAATCTGAAAAAATTGGAAGG - Intergenic
926235482 2:11039985-11040007 ATGAATTTGAAGAACATGGAGGG - Intergenic
927365582 2:22291941-22291963 ATGAATGTACATAAATTAGATGG - Intergenic
927479797 2:23443484-23443506 ATGAAAGGGAAAAAAGTGGAGGG - Intronic
927840704 2:26441393-26441415 ATGATACTGAATAAATGGGATGG + Intronic
929292298 2:40207385-40207407 CTGAATGGCAATATATTGGATGG + Intronic
930023475 2:47015258-47015280 ATGAATTTTAAATAATTGGAGGG - Intronic
930489909 2:52056324-52056346 ATGATTGTGAATAAAGAGGCAGG - Intergenic
931072704 2:58671481-58671503 ATGAATCTAAATACATTTGAAGG - Intergenic
931156785 2:59641742-59641764 ATGAATCTAAAGAAATTGGAGGG - Intergenic
931900120 2:66779115-66779137 ATGAATGTGACCAAAAGGGAAGG + Intergenic
932559188 2:72852154-72852176 CAGAATGTCAAAAAATTGGAAGG - Intergenic
933069726 2:77842194-77842216 ATGAATGAGAATCAACTGGAGGG + Intergenic
935451197 2:103211531-103211553 ATGAATGTGTATAAAACGAATGG + Intergenic
936114372 2:109690446-109690468 ATGACTTTGAATAGAATGGAAGG + Intergenic
936969010 2:118157119-118157141 ATGGATTTTAATAAATTGGCAGG + Intergenic
937916964 2:127103978-127104000 GGGTATGAGAATAAATTGGAAGG - Intronic
938277954 2:130044138-130044160 TTGAATGAGATAAAATTGGAGGG - Intergenic
938328919 2:130434939-130434961 TTGAATGAGATAAAATTGGAGGG - Intergenic
938361028 2:130686553-130686575 TTGAATGAGATAAAATTGGAGGG + Intergenic
938684583 2:133725366-133725388 TTGAATGTGAATATAATGGCTGG - Intergenic
939006960 2:136800141-136800163 ATTAATGTGAAAAAAATTGAGGG - Intronic
939248270 2:139653483-139653505 GTCAATGTGAATAAATTTAAGGG - Intergenic
939329991 2:140745640-140745662 ATGAAAGGGAACAAATTTGATGG - Intronic
940050153 2:149453846-149453868 ATAAATGAAAAAAAATTGGAGGG - Intronic
940248588 2:151647719-151647741 ACGAATGTCAAAAACTTGGAAGG + Intronic
940442823 2:153739082-153739104 ATAAATGTGAAGTATTTGGAGGG - Intergenic
941029917 2:160499524-160499546 ATGAATCTGGAAAAATGGGAAGG - Intergenic
941352318 2:164451897-164451919 ATGAATGTGTACAAAGTGTAGGG - Intergenic
941582155 2:167312281-167312303 CTGAAATTGAATAAATTGAATGG + Intergenic
941673596 2:168320949-168320971 TTGAATGAAAAGAAATTGGAAGG + Intergenic
941980521 2:171451118-171451140 ATGTATGGGAATACACTGGAGGG - Intronic
942423802 2:175837891-175837913 ATGAATGTGATTAAATGTCATGG - Intergenic
942476762 2:176334641-176334663 ATGAATGTCAAAAGAGTGGAAGG + Intronic
942911426 2:181248878-181248900 ATGAATGTTAACAAATTCTATGG - Intergenic
945165293 2:206936890-206936912 ATTATTGTGAATAAATTGTGTGG + Intergenic
945351721 2:208788316-208788338 CTGAATGGGCAAAAATTGGAAGG + Intronic
948380345 2:237546273-237546295 ATGACTGTGAATAGAATGGGAGG + Intronic
1174508549 20:51033137-51033159 ATGAATGTGAATTGAATGAATGG + Intergenic
1174530360 20:51207697-51207719 ATGAATGTGTATATCTTGGTGGG + Intergenic
1176940845 21:14923514-14923536 ATGAATGTTAATCCATTGCATGG - Intergenic
1177009401 21:15713618-15713640 ATGAATATGAATAAATCACAGGG - Intergenic
1177423127 21:20887806-20887828 ATGATTCTAAATACATTGGAAGG + Intergenic
1177706799 21:24716151-24716173 ATAAATGTAAATAAAAGGGATGG - Intergenic
1177798584 21:25805115-25805137 ATGAATGAGATAAAATAGGAAGG + Intergenic
949587401 3:5455205-5455227 ATGAATGTACATCGATTGGATGG - Intergenic
949681941 3:6524137-6524159 TTAAATGTGAAGAAATTGAATGG - Intergenic
949792319 3:7806615-7806637 CTGTATGTAAATGAATTGGAAGG - Intergenic
950009642 3:9713715-9713737 ATGGATGGGTATAAATTAGATGG + Intronic
951135032 3:19095524-19095546 ATGAATGAGAACAAAATGTAAGG - Intergenic
951190758 3:19768248-19768270 GAGAATGTGGAGAAATTGGAAGG + Intergenic
951378516 3:21953709-21953731 ATGAATATTAAAAAAATGGATGG - Intronic
951665700 3:25121076-25121098 ATGCATGTGTATAAAGTGGTGGG + Intergenic
951868303 3:27332373-27332395 ATTTTTGTGAATATATTGGAAGG + Intronic
952569310 3:34694992-34695014 ATGAACTTGAATAATTTGGTGGG + Intergenic
953136222 3:40184143-40184165 ATGAATATGAATAGACTGGGAGG - Intronic
954837663 3:53484133-53484155 ATGAATCAGAATCACTTGGAGGG + Intergenic
954860307 3:53682724-53682746 AGTAATATGAATAGATTGGATGG + Intronic
956019222 3:64915868-64915890 ATGAAACTGAATAAATAGAATGG - Intergenic
956497906 3:69848864-69848886 ATTAATGAGAATAAATTATATGG + Intronic
957897964 3:86448062-86448084 ATGACTGTGACTGAATTTGAGGG + Intergenic
958638186 3:96772411-96772433 ATAAATTTGAATAGAATGGAAGG + Intergenic
958752348 3:98206720-98206742 ATGCATTTGAATCAACTGGAGGG + Intergenic
958862951 3:99467026-99467048 AAGAATCTTAATATATTGGATGG - Intergenic
959059900 3:101606559-101606581 TTAAATGTGAATAGATTGGCTGG - Intergenic
959520966 3:107322465-107322487 AAGAATGTTAAGAACTTGGATGG - Intergenic
959655725 3:108802198-108802220 CTGAATGAGAAAAAATTGAAAGG + Intergenic
959690242 3:109190388-109190410 ATGACTTTGAATAAAATGGGAGG - Intergenic
959895232 3:111598044-111598066 ATGAATGTTAGTAAGTTGTAAGG + Intronic
960181489 3:114585561-114585583 ATAAATGTGAATACATTAGACGG - Intronic
960191336 3:114709996-114710018 ATCAATGTGAATTCATAGGAAGG - Intronic
963171393 3:142254859-142254881 AGGCATGTGAACAAATTGAAAGG - Intergenic
964309209 3:155374370-155374392 ATGAATACAAATAAATTGGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965506483 3:169521008-169521030 ATGAAGCTCAATAAATGGGAAGG + Intronic
965585913 3:170318315-170318337 ATTAATGTGAAAAAATTCTAAGG - Intergenic
966052532 3:175638392-175638414 AAGGATGTGAATAAACTGAATGG - Intronic
969275497 4:6132902-6132924 ATGAATGTGTAGAAGTTGGCTGG - Intronic
970060347 4:12026408-12026430 GTGAATTTGAATTAAATGGAAGG - Intergenic
970688634 4:18596849-18596871 ATCAATGTTTATAAAATGGATGG + Intergenic
970782926 4:19760416-19760438 ATGAATGGTAATAAATTCAATGG - Intergenic
971019822 4:22523325-22523347 ATGACTTTGAATAGACTGGAAGG + Intergenic
971233729 4:24822121-24822143 ATGAAATTGAACAAATTGAATGG + Intronic
972478266 4:39473962-39473984 ATGATTAAGAATAAATTGGCTGG + Intronic
972534650 4:39989474-39989496 AAGAATGTGTGTAAATGGGATGG - Intergenic
973150489 4:46881457-46881479 GTGACTTTGAATAAAATGGAAGG + Intronic
973947701 4:55976579-55976601 AAGAATGTAAATAAGTTGAAGGG - Intronic
974666847 4:64972793-64972815 GTAAATGTGCATAAATTAGACGG + Intergenic
974824216 4:67105713-67105735 GAGAAAGTGAAAAAATTGGAGGG + Intergenic
975757026 4:77580914-77580936 GAGAATGTGAAAAATTTGGAGGG - Intronic
975877307 4:78856762-78856784 CTGGATGTTAATAAATTTGAGGG - Intronic
976462784 4:85332211-85332233 ATAAATGTGAATAAATTAATTGG + Intergenic
976496624 4:85737760-85737782 AACAATGTTAATAAATTGTATGG + Intronic
976751541 4:88455293-88455315 AGGCATGTGAATACATTGCAAGG + Intergenic
977065449 4:92307286-92307308 ATGAATGTGATGAAACTGGAGGG + Intronic
977086920 4:92611665-92611687 AAAAATGTGAAGAAATTGGTGGG - Intronic
977124209 4:93144037-93144059 ATGCATCTGAATTACTTGGAGGG + Intronic
977894307 4:102346190-102346212 ATGAATTTGAATAGAATGGCAGG - Intronic
978435313 4:108677680-108677702 ATAAATGTGCATACATTGGCAGG + Intergenic
978722331 4:111925539-111925561 ATGAATGAGTATAAAATTGAAGG - Intergenic
980305226 4:131052378-131052400 TTGTATGTGACAAAATTGGAAGG + Intergenic
981039019 4:140204032-140204054 ACCAATGTTCATAAATTGGAAGG + Intergenic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
983043057 4:162953625-162953647 ATGACTGTGAATAGAATGGGAGG + Intergenic
983087253 4:163462190-163462212 ATGAATCTAAATAAATAGTAGGG + Intergenic
983390070 4:167118994-167119016 AGGCATGTAGATAAATTGGAAGG - Intronic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
984487477 4:180389102-180389124 ATGAATGTGAATTCATTGTAGGG + Intergenic
985059872 4:186066909-186066931 TAGAATGTGAATAAATTTAAGGG + Intergenic
985302173 4:188502149-188502171 AAGAATGGGAATAATTAGGAAGG - Intergenic
986972398 5:13352461-13352483 ATGAATCTTAATAAGTAGGATGG - Intergenic
987277793 5:16379857-16379879 ATGGATGTGGAAAAATTGGGTGG + Intergenic
987491182 5:18582172-18582194 CTGAATGTGAATAAAATAGCAGG - Intergenic
987766621 5:22239892-22239914 ATTAATGTGAGTAAATATGAAGG + Intronic
987951234 5:24679151-24679173 CTGAATATGAAAAAATTGGCTGG - Intergenic
988304952 5:29482086-29482108 AGGAATGTTAATTAATTGGTAGG - Intergenic
988310085 5:29545310-29545332 AGACATGTTAATAAATTGGAAGG + Intergenic
988692128 5:33582752-33582774 ATGCATTTGAATATATTTGATGG - Intronic
988769235 5:34414744-34414766 ATGACTTTGAATAGAATGGAAGG - Intergenic
989224358 5:39009084-39009106 ATGAATGTTAATAAAATGAAAGG + Intronic
993007610 5:82445153-82445175 ACGAATGTGTATGACTTGGAGGG + Intergenic
993121563 5:83780703-83780725 ATGAAGATGAATAAAGTGGGAGG + Intergenic
994330112 5:98494671-98494693 ATGAATTTGAATAATTTTGAAGG - Intergenic
994619918 5:102150785-102150807 ATGACTTTGAATAAAATGGGAGG - Intergenic
994624248 5:102197713-102197735 ATTAATGTAAAAAAATTGCAGGG - Intergenic
994988703 5:106970967-106970989 ATGAATGTTAATAAATTATTTGG + Intergenic
995340316 5:111051151-111051173 GTGAATGAGTATAAATTGCATGG - Intergenic
995806796 5:116062038-116062060 ATGAATATGTGTAAAATGGAAGG + Intergenic
995963317 5:117872400-117872422 ATGATAGTGAAAAAATTAGAAGG - Intergenic
996620134 5:125490660-125490682 ATGAATGAAAATTAACTGGAAGG - Intergenic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
998388622 5:141772838-141772860 GTGAATGTGGATGAAGTGGATGG + Intergenic
999182515 5:149680274-149680296 AAGAATGTGCATAAAATGGCTGG - Intergenic
999215865 5:149934594-149934616 ATGGCTGTGAATAAAGTGGATGG - Exonic
1000476852 5:161719576-161719598 ACAAATGTTAATGAATTGGAAGG - Intergenic
1000506571 5:162127574-162127596 ATGAATGACAATGAATTTGAGGG + Intronic
1003471930 6:6444514-6444536 AAGGATGTGGAGAAATTGGAAGG + Intergenic
1003558031 6:7158098-7158120 TTGAATGTGAAGAAATGGAAAGG - Intronic
1004526502 6:16413562-16413584 GTGAATGTGAATCAATGGGTGGG + Intronic
1005642100 6:27806495-27806517 ATAAATGTTAGTAAATTGGATGG + Intergenic
1006752829 6:36389426-36389448 ATGAATGTACATAATTTGGCTGG - Intergenic
1007538919 6:42622798-42622820 ATGAATGTGGAAAAAGTGGCTGG - Intronic
1007713229 6:43838123-43838145 ATGAATGTGAGTGCATTTGAGGG - Intergenic
1008067595 6:47066566-47066588 GTGAATGTGAATGAATGTGAAGG - Intergenic
1008419242 6:51277695-51277717 ATGAAAGTGAAAAAATTGGCAGG + Intergenic
1009848061 6:69159154-69159176 ATGAAAGTAAATATATTAGAGGG - Intronic
1010100492 6:72100494-72100516 ATGAATATGAATAACTTGTTAGG + Intronic
1010405967 6:75506055-75506077 ATTAATGTGCAAAAATTGGCTGG + Intergenic
1010505334 6:76650682-76650704 ATGATGTTTAATAAATTGGAGGG - Intergenic
1010886015 6:81241750-81241772 AAGAATGAGACTAAACTGGAAGG - Intergenic
1011464262 6:87639473-87639495 ATAAATTAGAATAAATTGGGGGG - Intronic
1011473167 6:87727623-87727645 ATTAATGTGACCAAATTGGCTGG - Intergenic
1012055229 6:94398287-94398309 GTGAATGTGAACAAATGGAAAGG + Intergenic
1014260149 6:119207188-119207210 ATGAATGTGTACAAAGAGGAAGG - Intronic
1014517252 6:122394963-122394985 CTGACTGAGAATAAATTGTAAGG + Intergenic
1014561956 6:122901559-122901581 AAAAATGAGAAAAAATTGGAAGG + Intergenic
1015321582 6:131881370-131881392 ATAAATATTAATAAATAGGATGG - Intronic
1016491363 6:144607771-144607793 ATGAATCTGTATAACTTAGAAGG + Intronic
1016624908 6:146155741-146155763 ATGAAGTTGGAGAAATTGGAAGG - Intronic
1017785174 6:157750974-157750996 GAGGATGTGAAGAAATTGGAAGG + Intronic
1017991825 6:159495471-159495493 ATGAATGCAAATAAATTAGAAGG - Intergenic
1018291180 6:162293693-162293715 AGGAATGTGAATACAGTGGGTGG + Intronic
1018448737 6:163884869-163884891 AAGAAAGTGAATAAGGTGGATGG + Intergenic
1020484187 7:8701076-8701098 ATGAATATGAATAAAAGGAAAGG - Intronic
1020506733 7:8999443-8999465 ATGCATGTGAAGAAGTTGTAGGG - Intergenic
1021648478 7:22809584-22809606 ATGACTTTGAATAGAATGGAAGG - Intergenic
1021674077 7:23062926-23062948 ATGAAGGTGAATTAATTATAAGG + Intergenic
1021715458 7:23458014-23458036 ATGGATGTAAATAGATTTGATGG - Intronic
1021849848 7:24796547-24796569 TTGAATGTGAATAAATAACATGG - Exonic
1021941275 7:25681021-25681043 ATGATAATGAACAAATTGGATGG - Intergenic
1021996767 7:26186342-26186364 CTGAATGTGGATATTTTGGAAGG - Exonic
1022649360 7:32260461-32260483 ATCAAAGTGAACAAATTTGAGGG - Intronic
1023416416 7:39937339-39937361 ATGAAAATGAATTTATTGGAAGG - Intergenic
1024885983 7:54143168-54143190 ATGCATGTTGATAATTTGGAAGG - Intergenic
1026381178 7:69800847-69800869 AGGAATGTAAATAAATGGGAGGG - Intronic
1027298133 7:76799676-76799698 ATGAAAGTAAAAAATTTGGAGGG + Intergenic
1027836256 7:83247886-83247908 ATGAATCTGAATGATGTGGAAGG - Intergenic
1028932625 7:96430104-96430126 ATGCATATGAGTAAATTGCAAGG + Intergenic
1030274278 7:107702727-107702749 ATAAATGTGAATTAATTTGCTGG - Intronic
1030542630 7:110851115-110851137 ATGAATGTATATAAATTTTATGG + Intronic
1030739676 7:113093389-113093411 GTGCATGTGAATGTATTGGAAGG + Intergenic
1030866926 7:114711381-114711403 ATAAATGTAAATAAAGTGCATGG + Intergenic
1031305751 7:120124591-120124613 ATGACTTTGAATAAAATGGGAGG - Intergenic
1032955774 7:136970389-136970411 TAGTATTTGAATAAATTGGACGG - Intronic
1033410326 7:141111650-141111672 ATGAATGTTAAAAAGTTGGAGGG + Intronic
1033848203 7:145461573-145461595 AAGAGAGGGAATAAATTGGAAGG - Intergenic
1034061586 7:148096740-148096762 ATGAAGGCAAATAAAATGGAAGG + Intronic
1034156983 7:148964057-148964079 AGGATTGTGAATAAATATGAGGG - Intergenic
1034814265 7:154158292-154158314 ATGGAATTGAATAATTTGGATGG + Intronic
1034855512 7:154542681-154542703 ATAAATGTTTATAAAATGGATGG - Intronic
1035993506 8:4519074-4519096 AGGAATGAGATTAAATTGGTGGG - Intronic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1036606862 8:10314796-10314818 ATGAAAATGAAGAAAATGGAAGG + Intronic
1036976829 8:13422923-13422945 TTGAATTTGAGTAAAATGGAAGG + Intronic
1036985392 8:13522966-13522988 ATTAATGTGGCTAAAATGGAAGG + Intergenic
1037202769 8:16278310-16278332 ATGAATGTGAGTAGATCTGATGG + Intronic
1037586515 8:20280454-20280476 ATGAATGTCAATGAATGGGCAGG - Intronic
1038079117 8:24112431-24112453 TTGAATTAGAATACATTGGAAGG - Intergenic
1038105836 8:24432823-24432845 ATGACTTTGAATAGAATGGAAGG + Intergenic
1038300312 8:26339768-26339790 AGTAATGTGGATAAATTGCAGGG + Intronic
1038813327 8:30874698-30874720 ATCAAGGTTAAAAAATTGGAAGG + Intronic
1038892148 8:31737674-31737696 AATAATGTAAATAACTTGGATGG + Intronic
1039392992 8:37196933-37196955 ATGCATGGGAATTACTTGGAAGG + Intergenic
1040279688 8:46033111-46033133 ATGAATGCAAATAAAATGCAAGG + Intergenic
1040340197 8:46436574-46436596 ATGAAAGAGAATATTTTGGAAGG + Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1043065864 8:75569118-75569140 ATAAATTTGAATAAAATGGGAGG - Intergenic
1043839735 8:85088734-85088756 ATGCATGTGAATTACTTTGAAGG + Intergenic
1045070458 8:98498998-98499020 ATAATTCTGAATAACTTGGATGG + Intronic
1045355882 8:101388705-101388727 ATGAATGTGAGGAAATTCTAAGG + Intergenic
1045996630 8:108370000-108370022 ATGAATGTGAATCACTGGTATGG + Intronic
1046100599 8:109609994-109610016 AGTAATGTGAAGACATTGGAGGG - Intronic
1046199777 8:110909782-110909804 ATGATTCTGGACAAATTGGATGG + Intergenic
1046533315 8:115475203-115475225 ATGAAGGTGAATAACTTCTAGGG + Intronic
1047886537 8:129256632-129256654 ATAAATGTCAATATTTTGGAAGG - Intergenic
1048372057 8:133787224-133787246 AGGGAAGTGAATAAATGGGATGG + Intergenic
1049448372 8:142642368-142642390 ATGACTTTGAATAAAATGGGAGG + Intergenic
1050870416 9:10560955-10560977 ATGAATGTGGGTGAATTGGGTGG + Intronic
1051962465 9:22784497-22784519 AGATATGTGAATAAAATGGAAGG - Intergenic
1052914317 9:33912653-33912675 AGGAATGCCAATAAACTGGAAGG - Intronic
1055870894 9:80878439-80878461 ATGGATGTAAATAAATATGATGG + Intergenic
1055962158 9:81830937-81830959 ATTAACGTGAATAATGTGGAAGG + Intergenic
1056082181 9:83106829-83106851 ATGAAAATGAAGAAATTAGAAGG - Intergenic
1056134600 9:83619651-83619673 TTGAATCTGTATAATTTGGAGGG + Intergenic
1056736940 9:89217930-89217952 ATGATTGAGAAACAATTGGAGGG - Intergenic
1057360184 9:94366257-94366279 GTCAATGTGAACAAAATGGAAGG - Intergenic
1057663157 9:97021830-97021852 GTCAATGTGAACAAAATGGAAGG + Intergenic
1058482084 9:105406098-105406120 ATGAATGTGCAAAGACTGGAAGG + Intronic
1058649746 9:107164214-107164236 TAGAGTGTGAATAATTTGGATGG - Intergenic
1059580340 9:115540002-115540024 AGGAATGTGAATTATATGGATGG + Intergenic
1059932926 9:119279182-119279204 CTCAGTGTGAATAAATTAGAAGG + Intronic
1060319644 9:122545207-122545229 ATAAATGTTAATAAATTAAAAGG - Intergenic
1060643142 9:125256058-125256080 ATGACTGTGAATACATTGCTAGG + Intergenic
1061091101 9:128426906-128426928 GTGAAGGTGAAACAATTGGAGGG + Intronic
1061627515 9:131849767-131849789 ATGAGTGTGTATAAAGTGCATGG + Intergenic
1185935615 X:4254033-4254055 ATGAATGAGAAAAAATGAGAAGG - Intergenic
1186044818 X:5524240-5524262 ATGAATGATGATAAATTGAAAGG + Intergenic
1186948105 X:14591870-14591892 ATGAATGTTAATGAAATGTAAGG - Intronic
1187430319 X:19217631-19217653 AAGAATGTCAATAGATTGAATGG - Intergenic
1188063046 X:25624576-25624598 AATAATGTAATTAAATTGGAAGG - Intergenic
1188751350 X:33909157-33909179 ATGACTTTGAATAGAATGGAAGG + Intergenic
1188946569 X:36312244-36312266 ATGGGTGTCAATAAATTGGTAGG + Intronic
1188951766 X:36384457-36384479 ATGAATGTGTTTATCTTGGAAGG + Intronic
1189553792 X:42120639-42120661 ATGAATGAGAATCACCTGGAAGG - Intergenic
1190997625 X:55625580-55625602 AACAATGTGAACAAAGTGGATGG + Intergenic
1191707278 X:64106318-64106340 AGCATTGAGAATAAATTGGAGGG + Intergenic
1192354587 X:70388901-70388923 AAAAATATCAATAAATTGGATGG - Intronic
1193631490 X:83893809-83893831 ATGAATGGAAAAAAAGTGGAAGG - Intergenic
1194247203 X:91530095-91530117 ATGACTTTGAATAGAATGGAAGG + Intergenic
1194883629 X:99285642-99285664 ATGAATGTAAATATATTTGATGG - Intergenic
1195114471 X:101683032-101683054 ACAAATGTGAATACATTTGAGGG - Intergenic
1195287125 X:103396284-103396306 ACAAATGTGAATACATTTGAGGG + Intergenic
1195566945 X:106350650-106350672 TTGAATGTGAGTGAATTTGAGGG + Intergenic
1196561004 X:117148214-117148236 AGGAAGGTGAATAGATTGAAGGG + Intergenic
1197321710 X:125040235-125040257 ATGAATGTGAATATTTAGGAGGG - Intergenic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198864111 X:141103066-141103088 ATGAATGGGAGTAAATGAGAGGG + Intergenic
1198898578 X:141484350-141484372 ATGAATGGGAGTAAATGAGAGGG - Intergenic
1199242520 X:145564379-145564401 AGGAATATGAATCAATTGAAGGG + Intergenic
1199385233 X:147215819-147215841 ATGACTCTGAATAAAATGGGAGG + Intergenic
1199717875 X:150519190-150519212 AAAGATGTGAATAAAGTGGAAGG + Intergenic
1200310993 X:155077177-155077199 ATGAATGTGAACAATTCTGACGG - Exonic
1200566223 Y:4771633-4771655 ATGACTTTGAATAGAATGGAAGG + Intergenic
1200945669 Y:8833843-8833865 ATGAATGTCAATATATTGGCTGG - Intergenic
1201652600 Y:16306998-16307020 AGGAATGTCAACAGATTGGATGG - Intergenic