ID: 905166326

View in Genome Browser
Species Human (GRCh38)
Location 1:36085266-36085288
Sequence CTGTGTCAGGGCATCGATCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905166326_905166338 6 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166338 1:36085295-36085317 ATCCAGGACTGGGTGCCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 122
905166326_905166335 3 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166335 1:36085292-36085314 GGGATCCAGGACTGGGTGCCCGG 0: 1
1: 0
2: 5
3: 22
4: 412
905166326_905166334 -4 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166334 1:36085285-36085307 ACAGGCAGGGATCCAGGACTGGG 0: 1
1: 1
2: 2
3: 22
4: 297
905166326_905166332 -10 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166332 1:36085279-36085301 CCTGACACAGGCAGGGATCCAGG 0: 1
1: 0
2: 2
3: 20
4: 264
905166326_905166337 5 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166337 1:36085294-36085316 GATCCAGGACTGGGTGCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 148
905166326_905166336 4 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166336 1:36085293-36085315 GGATCCAGGACTGGGTGCCCGGG 0: 1
1: 0
2: 0
3: 35
4: 275
905166326_905166333 -5 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166333 1:36085284-36085306 CACAGGCAGGGATCCAGGACTGG 0: 1
1: 0
2: 2
3: 30
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905166326 Original CRISPR CTGTGTCAGGGCATCGATCT CGG (reversed) Exonic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
913672786 1:121113690-121113712 CTGGGTCAGGGCATTGAGATTGG - Intergenic
914024562 1:143901064-143901086 CTGGGTCAGGGCATTGAGATTGG - Intergenic
914663047 1:149809085-149809107 CTGGGTCAGGGCATTGAGATTGG - Intronic
917709116 1:177666403-177666425 CTGTTTCAGGGCCCTGATCTGGG + Intergenic
920169212 1:204059991-204060013 TGGTGTAGGGGCATCGATCTCGG + Intergenic
922826000 1:228519272-228519294 ATATGTGAGGGCATCCATCTTGG + Intergenic
924794471 1:247283185-247283207 CTGTTTCGGGACATCGATCTAGG + Intergenic
1063097877 10:2923946-2923968 CTGAGCCAGGGCATCAACCTGGG + Intergenic
1065976977 10:30850153-30850175 CTGCATCAGGGCATAGTTCTGGG + Exonic
1066162184 10:32746057-32746079 CTGTGTCTGGTCAGCCATCTTGG - Intronic
1066174842 10:32892625-32892647 TTGTGTCAGAGCTTCCATCTAGG + Intergenic
1071016060 10:80998246-80998268 CTGTTTCAGGGTATGGTTCTTGG + Intergenic
1071907111 10:90186588-90186610 CTCTGTCTGGGCATGAATCTTGG - Intergenic
1075285588 10:121182945-121182967 CTGAGTCAGGGTTTCAATCTGGG - Intergenic
1076299435 10:129413822-129413844 CTGTGTCAGGTCTTAAATCTGGG + Intergenic
1076623617 10:131808548-131808570 CTGAGGCTGGGCATAGATCTCGG - Intergenic
1080590880 11:33722346-33722368 CAGTCTCAGGACATGGATCTAGG - Intronic
1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG + Intronic
1085664650 11:78403076-78403098 ATGTGTCAGTGCCTTGATCTTGG + Intronic
1087154651 11:94889098-94889120 ATGTGTCACGGCATTTATCTAGG - Intergenic
1092125627 12:6073287-6073309 GTGTGTCAGGGAACCGATCTGGG - Intronic
1093241933 12:16687350-16687372 ATCTGCCAGGGCCTCGATCTTGG - Intergenic
1093741774 12:22697096-22697118 CTGTCTCAGTGCAGCGCTCTAGG + Intergenic
1106144049 13:27036106-27036128 CTGTGTCACAGCTTCCATCTCGG - Intergenic
1118737388 14:68711744-68711766 CTGAGTCTGGGCCTCAATCTGGG - Intronic
1124706745 15:31972932-31972954 ATGTGTCAGTGCCTCGATCTTGG - Intergenic
1129656175 15:77527023-77527045 CTGTCTCAGGGGCTCGAGCTGGG - Intergenic
1129918431 15:79295609-79295631 CTGTGTCAGGGGACGGGTCTGGG - Exonic
1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG + Intronic
1132738209 16:1397713-1397735 CTGGGGCAGGGCATGGACCTGGG + Intronic
1140873558 16:79129025-79129047 CTGTGTCAGGACAATGAACTTGG - Intronic
1147363047 17:39943458-39943480 GGGTGTCAGGGCATCCAGCTAGG - Intronic
1152238178 17:79149234-79149256 AGGTGGCAGGGCATCCATCTGGG + Intronic
1155074122 18:22340420-22340442 CTGTGTCAGAGTCTCCATCTGGG - Intergenic
1155755706 18:29492950-29492972 ATGTGTGAGTGCATTGATCTTGG - Intergenic
1156499436 18:37547849-37547871 CTGTGTGAGGGTATGTATCTGGG + Intronic
1156944754 18:42815033-42815055 CTGTGTCAGAGAAACGGTCTAGG - Intronic
1158677088 18:59529779-59529801 CTGTTTCTGGTCATTGATCTTGG + Intronic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1160371328 18:78374063-78374085 CTGTGTCAGAGCATTGAGCTCGG + Intergenic
1164495144 19:28753936-28753958 CCGTGTCAGGTCATCCCTCTTGG - Intergenic
1164589014 19:29495996-29496018 CTGTCCCAGGGCATGGAACTAGG - Intergenic
927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG + Intergenic
927556532 2:24037912-24037934 CTGTGTCTGGGCAGCGATGCTGG + Exonic
933260243 2:80124207-80124229 CAGTGTCTGGACATAGATCTGGG - Intronic
933996285 2:87672354-87672376 CTGAGTCTGAGCATCCATCTAGG + Intergenic
934153235 2:89170463-89170485 CTGTGTTATTGCATCCATCTGGG - Intergenic
934213999 2:90011468-90011490 CTGTGTTATTGCATCCATCTGGG + Intergenic
938962195 2:136353870-136353892 ATGTGCCAGGGCCTTGATCTTGG + Intergenic
940464877 2:154014543-154014565 CTGTGTCAGGTCAGCCATCTTGG + Intronic
945853489 2:215038667-215038689 CTGTCTCAGGGCGTAAATCTTGG + Intronic
946618820 2:221539085-221539107 CTGTGTCAGGACCTTGAACTTGG - Intronic
948804401 2:240447263-240447285 CTGTGTCGGGGCATAGCTCGAGG - Intronic
1170568255 20:17618614-17618636 CTGTTTCTGGGCTTCGCTCTTGG + Exonic
1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG + Intergenic
1182465215 22:30511454-30511476 CAAGGTCAGGGGATCGATCTTGG + Intergenic
950463958 3:13142338-13142360 CTGTGTCTGAGCATGCATCTGGG - Intergenic
951045742 3:18036277-18036299 CTGTGTTAGGACATGGCTCTTGG + Intronic
952122804 3:30264620-30264642 CTGTGTCAGAGGAAAGATCTGGG - Intergenic
954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG + Intergenic
965561820 3:170069201-170069223 CTGAGTCAGGGAAGAGATCTGGG + Intronic
969177253 4:5408041-5408063 ATCTGTCAGGGCCTTGATCTTGG + Intronic
970343061 4:15127062-15127084 CTGTGCCAGTGCCTTGATCTTGG + Intergenic
986162216 5:5240345-5240367 CTGTGTCACAGCATTGACCTTGG + Intronic
988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG + Intronic
999268265 5:150280960-150280982 CTGTGTCTGTGCATTGTTCTGGG + Intronic
1008239538 6:49092465-49092487 ATGTTTCAGGACATTGATCTAGG - Intergenic
1010584751 6:77643927-77643949 CTGTGTCAAGGAAATGATCTGGG - Intergenic
1011446773 6:87449897-87449919 ATGTTTCAGGGCATTGGTCTGGG - Intronic
1011968817 6:93195819-93195841 CTGTGTCTGGGGATAGTTCTAGG + Intergenic
1013763660 6:113549306-113549328 ATGTGTCATGACATTGATCTGGG + Intergenic
1016234304 6:141844206-141844228 ATGTTTCAGGGCATTGGTCTAGG - Intergenic
1016910033 6:149189918-149189940 CTGTGTCAGAGAAAAGATCTGGG + Intergenic
1019919574 7:4154914-4154936 CTGTGGCAGAGCATGGATTTTGG - Intronic
1027972415 7:85102348-85102370 CTGTGTCAGGGCAAAGACCATGG + Intronic
1028648063 7:93120217-93120239 CTGTGTCAGGGGGAAGATCTGGG - Intergenic
1029792268 7:102857151-102857173 ATGCTTCAGGGCATTGATCTTGG + Intronic
1030098148 7:105919912-105919934 CTGTGACATGACATCAATCTTGG + Intronic
1032267436 7:130379431-130379453 CTGTGTCAGGACCCCGACCTTGG - Intergenic
1033142515 7:138840253-138840275 CTGTGTCAGGTGCTGGATCTGGG + Exonic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1044335074 8:90973175-90973197 CTGAGTCAGGGTATCGAACTTGG + Intronic
1045184564 8:99824175-99824197 GTGTGTCAGGGCCTCCTTCTTGG - Intronic
1049378490 8:142300806-142300828 CTGTCACTGGGCATCAATCTGGG + Intronic
1049444540 8:142623992-142624014 CTGGGTCAGGGCACCGAGCCGGG + Intergenic
1055219387 9:73909963-73909985 GTGTCTCAGGGCTTAGATCTTGG - Intergenic
1059213225 9:112534143-112534165 CTGTGTCATGACATAGAGCTTGG + Intronic
1060317562 9:122526823-122526845 GTGAGTCAGGGCAACGATATTGG + Exonic
1060820879 9:126661151-126661173 CTGTGTCAGGGCATCCACACTGG - Intronic
1061257194 9:129459915-129459937 CAGTGTCAGGGCCCCGAGCTTGG - Intergenic
1061380129 9:130251267-130251289 CTGAGTCAGAGCATCGTGCTGGG + Intergenic
1186211585 X:7255888-7255910 CTCTGTGAGGGCACTGATCTAGG + Intronic