ID: 905166333

View in Genome Browser
Species Human (GRCh38)
Location 1:36085284-36085306
Sequence CACAGGCAGGGATCCAGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905166326_905166333 -5 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166333 1:36085284-36085306 CACAGGCAGGGATCCAGGACTGG 0: 1
1: 0
2: 2
3: 30
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905166333 Original CRISPR CACAGGCAGGGATCCAGGAC TGG Exonic
900379539 1:2377076-2377098 CACAGGCTGGGACCGAGGAATGG + Intronic
900562901 1:3316457-3316479 TACTGGGAGGGATTCAGGACAGG + Intronic
900616685 1:3568650-3568672 CACTGGCTGGCATCCAGGGCAGG - Intronic
900868242 1:5283702-5283724 TACAGGCAGGGGTGCAGGTCAGG + Intergenic
901044231 1:6385926-6385948 CACAGACAGGGAAACAGGACAGG + Intronic
901519290 1:9770498-9770520 CAGAGGCAGGGCTCCAGCCCAGG - Intronic
901820614 1:11826964-11826986 AATAGGCAGGGATCCTGGAAGGG - Intronic
902289832 1:15428790-15428812 CACAGGCAAGGATTCAGGCTCGG - Exonic
902292143 1:15442419-15442441 CAGAGGAAGGGGTCCAGGTCAGG - Intronic
903970919 1:27118285-27118307 CACAGGCAGGGAGCCAAAAGTGG - Intronic
904786186 1:32984835-32984857 CACAGGCAGAGGACCAGGGCAGG + Intergenic
905166333 1:36085284-36085306 CACAGGCAGGGATCCAGGACTGG + Exonic
905369626 1:37476121-37476143 CAGAGGCAGGGTTCCAGCCCAGG + Intronic
906817634 1:48895362-48895384 CCCAGCAAGGGACCCAGGACTGG + Intronic
908762434 1:67524556-67524578 CCCAGGCAGGGATCCTGGATGGG + Intergenic
908912514 1:69088519-69088541 TACAGGCAGAGATCCAGGAGAGG - Intergenic
911184297 1:94887848-94887870 CACCCACAGGGATCCAGGAAAGG - Intronic
912387436 1:109278845-109278867 TCCAGGCAGGGAGCCAGGATGGG - Intergenic
912447615 1:109750016-109750038 CAAAGGCAGGGAGGCAGGAAGGG - Intronic
913386016 1:118259177-118259199 TCCTGGCAGGGCTCCAGGACGGG + Intergenic
917807726 1:178628846-178628868 TACAGGCAGTGAGCCTGGACAGG - Intergenic
918451529 1:184664109-184664131 CGAAGGCAGAGATCCTGGACCGG - Intergenic
919745574 1:201006391-201006413 AACAGGCAGGGAACTAGGGCTGG + Intronic
919812520 1:201418001-201418023 AACAGGCTGGGAGCCAGGTCAGG - Intronic
920360242 1:205410370-205410392 CACAGGCTGAGATCCAGGGGTGG + Intronic
921704211 1:218302201-218302223 GACAGGCAGAGCTCCAGGAAGGG + Intronic
922360015 1:224812589-224812611 CAGAGTCAGGGTTGCAGGACAGG - Intergenic
1062794687 10:335627-335649 CACATGGGGAGATCCAGGACAGG + Intronic
1062940380 10:1416568-1416590 AACTGGCTGGGATCCAGGAAAGG + Intronic
1064230174 10:13522795-13522817 CACAGGTAGGGTTCCAGTGCAGG - Intronic
1064986289 10:21213628-21213650 CCGAGGCAGGGAACCAGGGCAGG + Intergenic
1065263411 10:23950473-23950495 CACAGACAGGGATACGGGAGGGG + Intronic
1067187535 10:44043506-44043528 CACAGGCAGGGACCCAGGCCAGG + Intergenic
1067216560 10:44309106-44309128 CAGTGAGAGGGATCCAGGACAGG - Intergenic
1067512085 10:46904627-46904649 CACAAGAAGAGACCCAGGACAGG + Intergenic
1067650161 10:48147197-48147219 CACAAGAAGAGACCCAGGACAGG - Intergenic
1067782800 10:49221255-49221277 CCCAGCTAGGGAGCCAGGACTGG + Intergenic
1067847925 10:49737898-49737920 CACAGGCAGGGGGCCTGGCCAGG - Intronic
1068595517 10:58899017-58899039 CACTGGCAGGGATCCAAAACAGG + Intergenic
1070381068 10:75880893-75880915 CACAGTCGGGCAGCCAGGACAGG + Intronic
1070739611 10:78894188-78894210 AACAGGCAGGGAGCACGGACTGG - Intergenic
1070982032 10:80656966-80656988 AGCAGGCAGGGCTCCAGGAGGGG - Intergenic
1071154402 10:82672683-82672705 CACAGGCAGGGGCCCAGGCCTGG - Intronic
1071188599 10:83074780-83074802 CATGGGCAGGGACCCAGGAGAGG + Intergenic
1072118698 10:92387412-92387434 AAGAGGCAGGGCTCCAGGAGAGG - Intergenic
1072934405 10:99698571-99698593 GGCAGGCAGGGATCCAGAAATGG - Exonic
1073212781 10:101818324-101818346 CAGAGGCAGAGAACGAGGACAGG - Exonic
1073472376 10:103730954-103730976 CCCAGGCAGGGGACCAGCACAGG + Intronic
1073572172 10:104589783-104589805 CACCAGAAGGGATCCAGCACTGG - Intergenic
1073914456 10:108386170-108386192 AACAGGCCGGGGACCAGGACTGG - Intergenic
1075006765 10:118836147-118836169 TTCTGGCAGGGAGCCAGGACTGG + Intergenic
1075292758 10:121244290-121244312 CACAGGAAGGGCTCCAATACTGG + Intergenic
1075621111 10:123929035-123929057 CCTAGGCAGGAGTCCAGGACAGG + Intronic
1075977013 10:126704899-126704921 CACAGCCAGTGAGCCAGAACTGG + Intergenic
1077303202 11:1856511-1856533 GCCAGGCGGGGCTCCAGGACTGG - Intronic
1078011401 11:7575805-7575827 CACGGGCAGGGAACCTGGGCTGG + Intronic
1078180467 11:9006029-9006051 CACAGGGAGGAATCCAGCCCTGG - Intergenic
1080522125 11:33076601-33076623 CAAAGGCAGCAATCCAGGCCAGG + Intronic
1081644550 11:44780658-44780680 CACAGACTGGATTCCAGGACTGG - Intronic
1081787081 11:45755460-45755482 CCCAGGCGGGGATCCAAGAGTGG - Intergenic
1082098417 11:48150822-48150844 CAAAGGCAGAGATGCTGGACAGG - Intronic
1082701583 11:56438558-56438580 GACAGGCACTGATCCTGGACAGG + Intergenic
1082996641 11:59260903-59260925 CACAGGCTGGGAGCCAGGCCAGG + Intergenic
1083404300 11:62446080-62446102 CCCAGGGAGGGATGCAGGAGGGG + Intronic
1085309612 11:75508508-75508530 CACACGGATGGAGCCAGGACAGG + Intronic
1086492353 11:87368379-87368401 CAGAGGAAGGGATCCAGGCCTGG + Intergenic
1088700523 11:112407477-112407499 CACAAGAAAGGATTCAGGACTGG + Intergenic
1090331805 11:125938668-125938690 CTCAGGTAGGGATGCAGGGCTGG - Intergenic
1091456884 12:614532-614554 CAGAGGGAGGGAGCCAGGCCCGG - Intronic
1091752806 12:3033172-3033194 GACAGGCAGGGAGGCTGGACTGG - Intronic
1092003849 12:5052414-5052436 CAAAGGCAGGGCTACAGGAAGGG - Intergenic
1096584682 12:52612174-52612196 CACAGGCAGCTTTCCAGGGCTGG + Intronic
1097415356 12:59308984-59309006 CACATAGAGGGATCAAGGACTGG + Intergenic
1101732817 12:107440617-107440639 CACAGGCTCGGTTCCAGGTCTGG - Intronic
1101992597 12:109499557-109499579 CACAGGCAGGGAGCAGGGCCGGG + Intronic
1102033405 12:109757740-109757762 AACAGGCAGGGAGCCAGGGGTGG + Intronic
1103135063 12:118499795-118499817 CACAGACAGGGAGGCAGGAAGGG - Intergenic
1103298302 12:119906922-119906944 CACAGGCTGGGATGCAGGATGGG + Intergenic
1104410493 12:128553856-128553878 AAGAGGCAGGGAGCCAGGAATGG + Intronic
1104810368 12:131616885-131616907 GACAGGGCGGGATCCAGGAGCGG - Intergenic
1104977213 12:132557529-132557551 AACAGGCAGAGATCCTGGCCTGG - Intronic
1105580266 13:21689207-21689229 CTCAGGCAGGGACCCAGGCAGGG - Intronic
1106101318 13:26696797-26696819 CAGAGCCAGGGATTCAGGTCTGG - Intergenic
1106413650 13:29528116-29528138 CCCAGCCAGGAATCCAGGCCAGG - Intronic
1109166400 13:59040429-59040451 CACAGGCAGGGCTGGGGGACTGG - Intergenic
1112533758 13:100229913-100229935 CAAAGGCAGGGGTTCAGGGCAGG - Intronic
1113408482 13:110063274-110063296 AACTGGCAGGCATCCAGCACGGG + Intergenic
1113625485 13:111793181-111793203 CAGAGGCAGGGAGCCCGGGCAGG - Intergenic
1115730028 14:36258569-36258591 AACAGGCAGTGAGCCAGAACTGG - Intergenic
1117176436 14:53151976-53151998 CCCTGGAAGTGATCCAGGACCGG - Intronic
1118290621 14:64518444-64518466 CATAGCCAGAGATACAGGACTGG - Intronic
1118458517 14:65966782-65966804 CGCAGGGAGGGATTCAGGTCTGG - Intronic
1118912658 14:70074652-70074674 GACAGGCATAGATCCAGGACAGG + Intronic
1119348374 14:73944516-73944538 GGCAGGCAGGGATCCAGAAGAGG - Exonic
1119717734 14:76870603-76870625 CACAAGGAGGGAGCCAGGACAGG + Intergenic
1120240807 14:81947607-81947629 AAAAGGCAGGGCTCCAGGAATGG + Intergenic
1121082582 14:91120252-91120274 CCCAGGCAGAGGTCCATGACAGG - Intronic
1121113724 14:91329590-91329612 CACAGGCAAGCATCAAGGTCTGG + Intronic
1122236511 14:100333442-100333464 CACAGGCTGGGAGCCAGGTCGGG - Intergenic
1122253988 14:100463487-100463509 CACAGGCTGGGAACCAGGGGAGG - Intronic
1122532668 14:102439734-102439756 CACAGGCAGAGATGCTCGACAGG + Intronic
1122809503 14:104281063-104281085 CACGGCCTGGGATCCAGGACAGG - Intergenic
1202904252 14_GL000194v1_random:59468-59490 CACAGGGAGGGTCCCAGGCCAGG + Intergenic
1124364919 15:29064505-29064527 TCCAGGCAGGCTTCCAGGACAGG + Intronic
1124987703 15:34638396-34638418 CACAGGCAGGGATGGGGGAAAGG - Intergenic
1128338730 15:66805077-66805099 CAAAGGCAGGGATACTGGACTGG + Intergenic
1128367290 15:67013488-67013510 CTCAGGAAGAGATCAAGGACTGG + Intergenic
1128708254 15:69852967-69852989 TACAGGAAGGGCTCAAGGACTGG + Intergenic
1128752078 15:70156885-70156907 CGCAGGCAGGGCTCCGGGCCAGG - Intergenic
1129202759 15:74014800-74014822 GACAGGGAGGCATCCAGGAGTGG + Intronic
1129251402 15:74311076-74311098 CACAGGCCTGGAGGCAGGACGGG + Intronic
1129600419 15:76995243-76995265 CACAGTCTGGGACCCAGGGCAGG - Exonic
1129604640 15:77018912-77018934 CAGAGACAGGGGTCCAGGAGGGG + Intronic
1129606280 15:77026610-77026632 CACAGACAGGGCTCCAGCTCTGG + Intronic
1130048509 15:80464441-80464463 CCCAAGCAGGGACCCAGGCCCGG - Intronic
1131117018 15:89801970-89801992 CACAGGCAGGGGTGGGGGACGGG + Intronic
1131901183 15:97089326-97089348 CACAGCCAGGCATGCAGGCCTGG - Intergenic
1132279624 15:100602103-100602125 CCCAGGCAGGTAACCGGGACCGG - Exonic
1132835974 16:1953788-1953810 CACAGGCAGGGCTTCCGGGCGGG - Intronic
1132863912 16:2084475-2084497 CACAGTCAGGGACCCTGGACGGG + Exonic
1132874632 16:2130878-2130900 CAAATGCTGGGGTCCAGGACTGG - Intronic
1132908970 16:2298811-2298833 CACAGGCTGGGACCCGGGGCGGG - Intronic
1133043923 16:3075805-3075827 AACAGGCTGGGAGCCAGGCCTGG + Intronic
1133239301 16:4404993-4405015 CTCAGGCAGGGATCGGGGCCAGG - Intronic
1133547892 16:6825801-6825823 CAGAGGCAGCGATCCTGCACAGG + Intronic
1134107754 16:11495955-11495977 CACAGCCAGGGCCCCAGGGCTGG - Intronic
1134165389 16:11925531-11925553 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1134489914 16:14688911-14688933 CACAGCCAGGAAGGCAGGACAGG - Intronic
1134495295 16:14728028-14728050 CACAGCCAGGAAGGCAGGACAGG - Intronic
1134545179 16:15102581-15102603 CACAGCCAGGAAGGCAGGACAGG + Intronic
1134553574 16:15149711-15149733 CAAATGCTGGGGTCCAGGACTGG - Intergenic
1135054969 16:19224178-19224200 CACAGACAGAAATCCAGGGCAGG + Intronic
1135310348 16:21400427-21400449 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1135363293 16:21832840-21832862 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1135448496 16:22538220-22538242 CACAGCCAGGAAGGCAGGACAGG - Intergenic
1136149930 16:28340757-28340779 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1136166164 16:28454561-28454583 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1136196807 16:28660459-28660481 CACAGCCAGGAAGGCAGGACAGG - Intergenic
1136213147 16:28774582-28774604 CACAGCCAGGAAGGCAGGACAGG - Intergenic
1136257877 16:29054499-29054521 CACAGCCAGGAAGGCAGGACAGG - Intergenic
1136307091 16:29379567-29379589 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1136320615 16:29481810-29481832 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1136429294 16:30187531-30187553 CCCAGGCTGGGAACCAAGACTGG + Intronic
1136435188 16:30221150-30221172 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1136517199 16:30775299-30775321 GGCCGGCAGGGATCCCGGACTGG + Exonic
1136545318 16:30951038-30951060 CACAGACAGGGATCTGGGCCAGG - Intronic
1137486987 16:48899739-48899761 CAGGGACAGGCATCCAGGACTGG - Intergenic
1137674986 16:50299707-50299729 CACAGGCAGTGGTGCAGGCCAGG - Intronic
1138187540 16:54987833-54987855 CACAGGCAGAGAGCTAGGAATGG - Intergenic
1138533421 16:57647121-57647143 CATAGGCAGGGATGAAGGAGGGG + Intronic
1139855221 16:69974560-69974582 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1139884937 16:70201685-70201707 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1140367578 16:74393832-74393854 CACAGCCAGGAAGGCAGGACAGG - Intergenic
1140737446 16:77911063-77911085 CACAGGCAGGGACCCAGAACTGG + Intronic
1141184677 16:81779108-81779130 CAGAGGCGGGGCTCCAGGCCTGG + Intronic
1141410591 16:83830233-83830255 CTCAGGCAGGGACCTAGGATGGG - Intergenic
1142383434 16:89747035-89747057 CACAGCCAGGGCGCCAGGCCCGG - Intronic
1143096031 17:4478886-4478908 CCAACGCAGGGAGCCAGGACCGG + Intronic
1143166376 17:4899197-4899219 CACCGGCAGGGGACCTGGACGGG - Exonic
1143551223 17:7631595-7631617 CGCAGGCAGCCATCCAGGGCAGG - Exonic
1143665872 17:8359744-8359766 GAAAGGCAGGGTTTCAGGACTGG + Intergenic
1143974690 17:10821188-10821210 ACCAGGCAGGGGCCCAGGACGGG - Intergenic
1144857247 17:18276249-18276271 GACAGGAAGGGATCCAGAGCTGG - Intronic
1146059198 17:29595719-29595741 CCCTGGCCTGGATCCAGGACAGG - Intronic
1147212126 17:38877827-38877849 GACAGGCAGGCATGAAGGACAGG - Intronic
1147556735 17:41484457-41484479 AACAGGCAGGGGTCCAGGAATGG - Intergenic
1148559427 17:48597458-48597480 CAGAGCCGGGGTTCCAGGACAGG - Intronic
1148579534 17:48734196-48734218 CTCAGGCAGAGCTCCAGGGCAGG - Intergenic
1149138924 17:53405904-53405926 CACAGGCTGGGATGCAGAACAGG - Intergenic
1149442994 17:56690813-56690835 CGGAGGCTGGGATCCAGGGCAGG + Intergenic
1150993688 17:70291170-70291192 AACAGGCAGGTTTCCAAGACAGG - Intergenic
1152096219 17:78273212-78273234 CACTGGCAGGAATGCAGGAGGGG - Intergenic
1152215531 17:79029625-79029647 CACAGGATGGGCTGCAGGACGGG + Intronic
1152595053 17:81233863-81233885 CAGAGGCAGGGGTCCCGGATGGG + Intronic
1153530786 18:6043363-6043385 CACAGGCAGTATTCCAGGCCTGG + Intronic
1153811681 18:8757590-8757612 CCCCGGCAGGGATCTAGAACAGG + Intronic
1154116644 18:11617536-11617558 CACAGCCAGGAAGGCAGGACAGG + Intergenic
1154518245 18:15197506-15197528 CCCAGGCTGGGCTCCAGGAGTGG - Intergenic
1157562848 18:48660721-48660743 AACTGGCAGGGAGCGAGGACAGG - Intronic
1159871742 18:73766574-73766596 CACAGGCATGGGTCTAAGACAGG - Intergenic
1160076294 18:75680684-75680706 AACAGGCACGGCTCCAGCACAGG + Intergenic
1160888122 19:1361817-1361839 CGCAGGGAGGGGGCCAGGACGGG - Intronic
1161249994 19:3275461-3275483 GACAGACAGGGACCCAGGCCCGG + Intronic
1161577003 19:5059897-5059919 CACACGCAGGCATCCCGGAGAGG - Intronic
1161804291 19:6433555-6433577 TACAGCCAGGGTTCCAGGATGGG + Exonic
1161845720 19:6710894-6710916 CGCAGGGAGGGATCCGGGATGGG + Intronic
1161922258 19:7275308-7275330 CAGAGGCGGGGATCCAGCCCTGG - Intronic
1162422632 19:10574587-10574609 CACAGGCTGGGATCGATGAGGGG + Intronic
1163353908 19:16797278-16797300 CAGGAGAAGGGATCCAGGACGGG - Intronic
1163782818 19:19259215-19259237 CAGAGGGAGGGACCCAGTACTGG - Intronic
1163783026 19:19260510-19260532 CACAAGGAGTGATCCAGGCCGGG - Intronic
1163884710 19:19955442-19955464 CCCAGACAGGGCTCCAGGCCAGG + Intergenic
1164315873 19:24087545-24087567 CCCAGAGAGGGCTCCAGGACAGG - Intronic
1164700598 19:30281448-30281470 CAAAGGCAGGGCACCAGGAGAGG - Intronic
1165152113 19:33766953-33766975 CACAGACAGGGACCTGGGACTGG + Intronic
1165385827 19:35510239-35510261 CCCCTGCAGGGATCCAGCACCGG - Exonic
1166759000 19:45212979-45213001 CCCAGGCAGGGAGTCAGGAGGGG + Exonic
1167155599 19:47736774-47736796 CCCAGAAAGTGATCCAGGACTGG + Intronic
1167285349 19:48596121-48596143 CTGAGGCATGGATCCAGGAAGGG + Intronic
1167728700 19:51236731-51236753 CACAGGAAGAGATGGAGGACTGG - Intronic
1167765089 19:51477279-51477301 TAAAAACAGGGATCCAGGACAGG - Intergenic
925984011 2:9200580-9200602 CACAGGCAGGGAGGAAGGGCAGG + Intergenic
926202921 2:10814167-10814189 CTTAGGCAGGGGTCCAGGAGTGG + Intronic
926229316 2:10990761-10990783 CACAGGCAGGGTTGGAGGAGTGG - Intergenic
927842699 2:26455690-26455712 CCCAGGCAGGGAACCGGGGCTGG - Intronic
928167689 2:28982531-28982553 CACAGGCTGGCTCCCAGGACTGG + Intronic
929207343 2:39311801-39311823 GAGAGTCAGGAATCCAGGACAGG - Intronic
929238934 2:39633779-39633801 CTCAGCCAGGGATTCAGGATTGG - Intergenic
932167776 2:69523965-69523987 AACAGGGAGGGAGCCAGGAAAGG - Intronic
932581398 2:72994739-72994761 CCCAGGCAGGGCTCCAGGCATGG + Intronic
934502386 2:94870929-94870951 CACAGGGAGGGTTCCAGGCCAGG - Intergenic
934556443 2:95289304-95289326 CCCAGGCTGGCATCCAGGCCTGG + Exonic
934569758 2:95361777-95361799 CACAGGCACTGTTCCAGGGCTGG + Intronic
935191273 2:100780582-100780604 CACAGGCAGAAATGCAGGAAAGG - Intergenic
936527926 2:113254787-113254809 CACAGTCAAGGACCCAGGAGAGG - Intronic
937337295 2:121069826-121069848 CACAGACAGGGCACAAGGACAGG - Intergenic
937933187 2:127221053-127221075 CACAGGGAGGGATGGAGCACGGG + Intergenic
937933491 2:127223365-127223387 CTCAGGCAGGGATTGAGGAAAGG + Intergenic
938263722 2:129912003-129912025 CACAGGCAGGGGTTGAGGATGGG - Intergenic
938794169 2:134704525-134704547 CACCTGCAGGGAGCCAGGACTGG - Intronic
940612367 2:156007055-156007077 CCCAGGCTGGCATCCAGGGCAGG + Intergenic
940766539 2:157796079-157796101 CACAGGCAGGGAACCATGCCTGG - Intronic
941415821 2:165219831-165219853 CACTGGCATGGAACCAGGAATGG + Intergenic
942189044 2:173453236-173453258 CAGAGGGAGGGAGCCAGGGCTGG + Intergenic
942506150 2:176643808-176643830 CACAGGGAGGCTCCCAGGACAGG + Intergenic
945069902 2:205979328-205979350 GACAGGAAGGGATCTAGGACAGG - Intergenic
946039702 2:216773216-216773238 CACTGGCAGGGAGCCAAGACAGG - Intergenic
946165240 2:217859502-217859524 CCCAGGCAGGGCTCCAGGAGGGG + Intronic
946200486 2:218068290-218068312 CAGGGGCAGGGATCCTGGACAGG + Intronic
948771462 2:240253260-240253282 CAGAGGCATGGAAACAGGACAGG - Intergenic
949035395 2:241813765-241813787 CACAGCCAGGGATCCTGCAGGGG - Intronic
1168891981 20:1300690-1300712 CACAGGACCGGCTCCAGGACCGG + Exonic
1171421506 20:25020745-25020767 CAAAGGCAGGGATGGAGCACTGG + Intronic
1172610878 20:36251685-36251707 CACAGCCTGGGAGGCAGGACAGG - Intronic
1172882117 20:38208871-38208893 CACAGAGAGGGAAGCAGGACTGG + Intergenic
1173653002 20:44679258-44679280 CACAGACAGGGGCCCAGGATCGG - Intergenic
1174657305 20:52182304-52182326 CACAAACAGGACTCCAGGACTGG + Intronic
1174745615 20:53058801-53058823 CAGATGCAGAGATCCAGGTCTGG + Intronic
1175138274 20:56841265-56841287 CAGAGGCAGTGATGCAGGACAGG - Intergenic
1175264224 20:57692772-57692794 AAAAGGCAGAGATCCAGGCCAGG + Intronic
1175605382 20:60308315-60308337 AGCAGGAAGGGATTCAGGACCGG + Intergenic
1176623623 21:9074235-9074257 CACAGGGAGGGTCCCAGGCCAGG + Intergenic
1179024105 21:37666190-37666212 CACAGGCAGAGATCTGGGAATGG + Intronic
1179374890 21:40841584-40841606 CGCAGGCAAGGCTCCGGGACCGG - Intronic
1179403862 21:41109340-41109362 CACAGGCAGGATGACAGGACGGG + Intergenic
1179642742 21:42757988-42758010 CACAGGCAGGAAGCCACGCCGGG + Intronic
1180171955 21:46064136-46064158 CACAGGCACTGATCCTGGACGGG - Intergenic
1182120538 22:27783587-27783609 CACAGGCGCAGAGCCAGGACAGG - Intronic
1183001604 22:34864200-34864222 CAGAGGCAGGGAGCAAGGAATGG - Intergenic
1183369317 22:37423488-37423510 CACAGCGATGGAACCAGGACTGG - Intronic
1183954605 22:41371881-41371903 CAGAGGCAGGGGTACAGGAGGGG + Intronic
1184527095 22:45030781-45030803 GAGATCCAGGGATCCAGGACAGG + Intergenic
1184607363 22:45581824-45581846 GAGAGGCAGGGAGCCAGGAAGGG + Intronic
1184871878 22:47245780-47245802 GGCAGGCAGTGTTCCAGGACAGG + Intergenic
1185017504 22:48353305-48353327 CACAGGCATGCATCCAGGCAGGG - Intergenic
1185121786 22:48975634-48975656 CCCAGCCCGGGATCCAGGCCCGG + Intergenic
1185153418 22:49179393-49179415 CACAGGCAGGGAGCCAGGGTGGG - Intergenic
950450135 3:13060717-13060739 CCCCGGCGGGGCTCCAGGACCGG + Intronic
950503174 3:13377184-13377206 CAGCGGCAGGGCTCCAGGATAGG - Intronic
953708117 3:45246362-45246384 CAGAGGCCTGGATCCAGGTCTGG - Intergenic
954713203 3:52514934-52514956 GAAGGGCAGGGATCCAGGCCTGG + Intronic
956186876 3:66570948-66570970 CACAGAAAGGGAATCAGGACAGG - Intergenic
956249844 3:67224457-67224479 CAGAAGCAAGGATCCAGTACCGG + Intergenic
959436486 3:106321022-106321044 CGGATGCAGGGATCCAGGAATGG + Intergenic
959584011 3:108009081-108009103 CAGAGCCAGGGAACCAGGCCAGG + Intergenic
961336671 3:126184486-126184508 CACAGGCCCTGATCCAGGAGAGG + Intronic
961351749 3:126308565-126308587 CACAGACAGAGAACCAGGGCAGG - Intergenic
961501643 3:127340467-127340489 CACAGGGAGGGATGCAGAATTGG - Intergenic
961786781 3:129352300-129352322 CACAGAGAAGGACCCAGGACAGG - Intergenic
962234065 3:133692959-133692981 CCCAGGCAGGGCTCCTGCACTGG + Intergenic
964419440 3:156486160-156486182 CACAGGCAGGGATCCTTGGTGGG - Intronic
964925864 3:161955921-161955943 GTCAGGCAGGGATTCAGGAAGGG + Intergenic
968303639 3:197634380-197634402 CAAAGGAACTGATCCAGGACAGG - Intergenic
968456111 4:700856-700878 CACAGCCAGAGCTCCAGGATGGG - Intergenic
968622876 4:1611584-1611606 CACAGGCAGGTACCAAGGCCTGG + Intergenic
968944045 4:3654369-3654391 CACAGGTGGGCAGCCAGGACCGG - Intergenic
969330418 4:6471239-6471261 CTCGGGCAGGGCTCCAGCACAGG + Intronic
969373714 4:6749756-6749778 CACAGGCAGGGAGACAGGGAGGG - Intergenic
972669719 4:41203723-41203745 CACAGGAAGGGAACCAGGCCTGG - Intronic
972944389 4:44236326-44236348 CAGATGCAGGGTTCCAGGATGGG + Intronic
973232471 4:47857734-47857756 CACAGTCAGGGAACTAGAACAGG - Intronic
976215833 4:82714627-82714649 AACAGGCAAGGAGCCAGGTCTGG + Intronic
980725190 4:136749552-136749574 CACAAGCTGGGTTCCAGGTCAGG + Intergenic
981047950 4:140282495-140282517 CACAGGAAGGGAAACAGAACTGG - Intronic
981767202 4:148264525-148264547 AACATGCAGGGATCAAAGACAGG + Intronic
982139465 4:152304200-152304222 CACAGGGAGGGGTCCGGGCCTGG + Intergenic
984391259 4:179137011-179137033 CTCAGCCATGGATCCAGGATTGG + Intergenic
985419065 4:189765150-189765172 CCAGGGCAGGGATCCAGGGCAGG + Intergenic
986350821 5:6878064-6878086 CTCAGGCAGGGATGCAGGCACGG + Intergenic
987060487 5:14238512-14238534 CAGCGGCAGGAATCCATGACAGG - Intronic
992284117 5:75215070-75215092 AACAGGCAGAGAACCAGAACAGG + Intronic
992673864 5:79085806-79085828 CACAGACAGGAAACCAGGAGAGG + Intronic
997049980 5:130368447-130368469 CACAGGCAAGGAATCAGGAAGGG - Intergenic
999503808 5:152174527-152174549 AGCAGGCAGGAAACCAGGACAGG - Intergenic
999674305 5:153983512-153983534 CACAGGAAGGAAACCAGGACAGG - Intergenic
1003692647 6:8369679-8369701 GACAGACAGGGACCCAGGGCAGG + Intergenic
1004184048 6:13406792-13406814 CACAGGCAGCCAACCAGAACAGG - Intronic
1005680855 6:28207072-28207094 CTCAGGCAGTGCTCCAGTACTGG + Intergenic
1006593145 6:35172742-35172764 CACAGGCAGGGTTCAAAGCCTGG + Intergenic
1006856763 6:37138898-37138920 CACTGACAGGGAAACAGGACAGG + Intergenic
1007493045 6:42239404-42239426 CAGAGGCAGGGAGCCAAGATGGG - Intronic
1007752137 6:44077056-44077078 CACAGGCAGGGCTCCTGGCTGGG - Intergenic
1007762037 6:44138910-44138932 GAAAGGCAGGAAGCCAGGACAGG + Intronic
1011998489 6:93623213-93623235 CACAGGCAAGGGTCCAGGGTAGG - Intergenic
1013006790 6:106081390-106081412 CACAGGCAGGGCTGCAGCTCAGG - Intergenic
1017295590 6:152790046-152790068 GACAGGAAAGGATGCAGGACAGG - Intergenic
1017295593 6:152790063-152790085 GACAGGAAAGGATGCAGGACAGG - Intergenic
1017295596 6:152790080-152790102 GACAGGAAAGGATGCAGGACAGG - Intergenic
1018434599 6:163749130-163749152 CACGGGCTGTGCTCCAGGACAGG - Intergenic
1019271239 7:150233-150255 CACAGGCAGGGCGGCAGGCCAGG + Intergenic
1019996184 7:4725789-4725811 AACAGGCTGGGATCCAGGCAAGG + Intronic
1020078406 7:5273740-5273762 CACAGGGTGGGATCCTTGACTGG - Intergenic
1020858101 7:13453502-13453524 CCCAGGCAGGTATTCAGCACTGG + Intergenic
1021639230 7:22721928-22721950 CACAGGAAGGGCTGCAGGCCTGG + Intergenic
1021809090 7:24385923-24385945 CACAAGGTGGGATCCAGGATAGG - Intergenic
1022510746 7:30933547-30933569 CACAGGCGGGCAGGCAGGACTGG - Intergenic
1022521157 7:31007816-31007838 CACAGCCGGAGATGCAGGACAGG - Intergenic
1024153602 7:46598142-46598164 CACAGACAGTGACCCAGGACTGG - Intergenic
1025200488 7:56958453-56958475 CACAGGGTGGGATCCTTGACTGG + Intergenic
1025481935 7:60992929-60992951 CCCGGGCTGGGATCCAGGAGCGG + Intergenic
1025671456 7:63618479-63618501 CACAGGGTGGGATCCTTGACTGG - Intergenic
1025815103 7:64903647-64903669 CCCAGGGAGGGCTCCAGGCCAGG - Intronic
1026991302 7:74587518-74587540 CGCAGGCAGGGAGCCAGGGCCGG - Intronic
1028980475 7:96962515-96962537 GACAGGCAGGTGTCCAGAACTGG - Intergenic
1029331105 7:99856317-99856339 CAAAGTCAGGAATGCAGGACTGG + Intronic
1032405079 7:131650023-131650045 CACAGCCAGGGATCCCCGGCAGG - Intergenic
1033087680 7:138357399-138357421 CACAGGCAGGGAGGCAGGGAGGG - Intergenic
1034490603 7:151391284-151391306 CAGGGGCAGGGAGCCAGGGCAGG - Intronic
1035110420 7:156476846-156476868 CACAGACAGGGATTCTGGGCTGG - Intergenic
1035376242 7:158408467-158408489 CACAGGCAGGGACCCACCTCCGG - Intronic
1035593254 8:834276-834298 CACACGCTGGCATACAGGACTGG - Intergenic
1037671133 8:21016235-21016257 CACAGGCTGGGGTTCAGCACTGG + Intergenic
1037767520 8:21781283-21781305 CACAGGGAGGGATCCCTGAAGGG - Intronic
1038696607 8:29812270-29812292 CAAGGGCAGGGCACCAGGACCGG - Intergenic
1038981531 8:32764338-32764360 CACAGGAAGAAATCCAGGCCAGG + Exonic
1039465492 8:37782595-37782617 GACAGGCAGGGGCCCAGGAAAGG + Intergenic
1039854680 8:41402228-41402250 CACAGCCAAGGCTCCTGGACTGG - Intergenic
1042960034 8:74293814-74293836 CACAGGCAGTGGTCCAAGCCTGG - Intronic
1044283314 8:90381400-90381422 CACAGGAAGGGACACAGGATGGG + Intergenic
1045443685 8:102239208-102239230 CACAGGCTGGGAGGCAGGGCAGG - Intergenic
1045834842 8:106507799-106507821 CAAAGGAAGGGATGCAGGAAAGG - Intronic
1047703582 8:127474354-127474376 CACAGGAAAGGATGCAGGAGAGG - Intergenic
1047956914 8:129983615-129983637 GGCAGGAAGGGATCCAGGGCAGG + Intronic
1048091346 8:131243779-131243801 CACAGACAGGATTCCAGGCCAGG - Intergenic
1048706817 8:137162889-137162911 CACAGGCAGGCAGGCAGGAAGGG - Intergenic
1048878409 8:138854488-138854510 CAGAGGCAGGGCTCAAGGCCAGG + Intronic
1050028192 9:1357332-1357354 CCCTGGCAGGGCTCCAGGAAAGG - Intergenic
1052894540 9:33734950-33734972 CACAGGCAGGGAAGCACGAAGGG + Intergenic
1052984001 9:34472336-34472358 CAGAGGCAGGTATCCAGCAAAGG + Intronic
1053019514 9:34685152-34685174 GACAGGCAGGGCTCCTGGAAAGG - Intergenic
1055764268 9:79644706-79644728 CACAGGGAAGGGCCCAGGACTGG - Intronic
1056210788 9:84363279-84363301 CACAGGCAGTGATGTAGGAGAGG + Intergenic
1056678383 9:88696234-88696256 CACACACAGGGGTCCATGACTGG - Intergenic
1056950651 9:91038220-91038242 CAGAGCCAGGGACTCAGGACTGG + Intergenic
1057242930 9:93428177-93428199 CACAGGCAAGGACCCAGCAGGGG - Intergenic
1057724351 9:97557555-97557577 CACTGGCAGGGTAGCAGGACAGG - Intronic
1058105361 9:100964196-100964218 CCCAGGCAGTTCTCCAGGACGGG + Intergenic
1058801647 9:108550260-108550282 CAGAGTCAGGCCTCCAGGACTGG + Intergenic
1059009397 9:110440320-110440342 CAGAGGCAGGGAGCCATGAATGG - Intronic
1059433286 9:114262474-114262496 CAGAGGCAGGGACACAGGAGTGG - Intronic
1060173525 9:121480574-121480596 GACAGGAAGGAATCAAGGACTGG + Intergenic
1060221509 9:121766439-121766461 GTCAGGCAGGGGCCCAGGACAGG - Intronic
1060241193 9:121904743-121904765 AACGGGCAGGGATCCTGGTCAGG - Intronic
1061212603 9:129202578-129202600 CCCAGGCAGGGAGACAGGCCAGG - Intergenic
1061714384 9:132509793-132509815 GACAGGCAGGGAGCCATAACTGG + Intronic
1062008252 9:134252588-134252610 CACAGGCAGAGGTCAAGGAATGG + Intergenic
1062251362 9:135596993-135597015 CAGATGGAGGGAACCAGGACAGG - Intergenic
1062378441 9:136275375-136275397 AACAGGCAGGGACACAGGGCAGG + Intergenic
1203746807 Un_GL000218v1:44663-44685 CACAGGGAGGGTCCCAGGCCAGG + Intergenic
1203563300 Un_KI270744v1:74817-74839 CACAGGGAGGGTCCCAGGCCAGG - Intergenic
1186488147 X:9949964-9949986 CACAGGGAGGGATGAAGAACTGG + Intergenic
1188860001 X:35244677-35244699 CTCAGTCTGGGATCCAGGGCAGG + Intergenic
1192560411 X:72124330-72124352 CTGAGGCAGGTATCCAGGAGGGG + Intergenic
1192585234 X:72313882-72313904 CACAGCCAGGAATATAGGACTGG + Intergenic
1192698274 X:73442109-73442131 CACAAGCAAGGACCCAGCACAGG + Intergenic
1195981010 X:110578304-110578326 CACAGGCAGGCACACATGACAGG - Intergenic
1198062118 X:133056510-133056532 CACAGGCAGAGATTTGGGACAGG + Intronic
1199679122 X:150213456-150213478 CACAGGCAAGGGTCCAGGTTTGG + Intergenic
1199855864 X:151758433-151758455 TTCAGGCAGAGAACCAGGACAGG + Intergenic
1201160134 Y:11159677-11159699 CACAGGGAGGGTCCCAGGCCAGG + Intergenic