ID: 905166335

View in Genome Browser
Species Human (GRCh38)
Location 1:36085292-36085314
Sequence GGGATCCAGGACTGGGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905166331_905166335 -10 Left 905166331 1:36085279-36085301 CCTGACACAGGCAGGGATCCAGG 0: 1
1: 0
2: 3
3: 33
4: 281
Right 905166335 1:36085292-36085314 GGGATCCAGGACTGGGTGCCCGG 0: 1
1: 0
2: 5
3: 22
4: 412
905166326_905166335 3 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166335 1:36085292-36085314 GGGATCCAGGACTGGGTGCCCGG 0: 1
1: 0
2: 5
3: 22
4: 412
905166330_905166335 -9 Left 905166330 1:36085278-36085300 CCCTGACACAGGCAGGGATCCAG 0: 1
1: 0
2: 1
3: 16
4: 237
Right 905166335 1:36085292-36085314 GGGATCCAGGACTGGGTGCCCGG 0: 1
1: 0
2: 5
3: 22
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905166335 Original CRISPR GGGATCCAGGACTGGGTGCC CGG Intronic
900000684 1:13281-13303 CGTGTCCAGGACAGGGTGCCGGG - Intergenic
900418241 1:2544797-2544819 GGGCTCCAGGACAGCCTGCCTGG + Intergenic
900432275 1:2607944-2607966 GGGATAAAGGGCTGGGTTCCCGG + Intronic
900458078 1:2786947-2786969 GGGATTCAGGCCTTGGGGCCTGG - Intronic
900610198 1:3541509-3541531 GGGCACCTGGCCTGGGTGCCAGG + Intronic
901780723 1:11593006-11593028 GAGAGCCAGGACTGGCAGCCTGG - Intergenic
901883325 1:12206683-12206705 GGGGTCCAGGAGTGGGGCCCAGG - Intronic
902547526 1:17199255-17199277 AGGATCCTGCCCTGGGTGCCAGG + Intergenic
902712064 1:18247277-18247299 TGGAGGCAAGACTGGGTGCCTGG + Intronic
902776603 1:18678910-18678932 GGGCTCTGGGACTGGCTGCCTGG + Intronic
902925757 1:19694726-19694748 TGGAGCCTGGCCTGGGTGCCAGG + Intronic
903500305 1:23796836-23796858 GGGACCTAGGAGTGGGAGCCAGG - Intronic
903885245 1:26537216-26537238 GGCATCCTGGCCTGGGTGACAGG - Intronic
903970868 1:27118055-27118077 GCCAACCAGGACTGGGTCCCGGG + Intronic
905107976 1:35575220-35575242 GGGCTGCAGCACTGGGAGCCTGG + Intronic
905166335 1:36085292-36085314 GGGATCCAGGACTGGGTGCCCGG + Intronic
905386257 1:37606277-37606299 GAGGGCCAAGACTGGGTGCCAGG + Intergenic
905499810 1:38427466-38427488 GGGATCTGGGAGTGGCTGCCAGG - Intergenic
905789602 1:40783259-40783281 GGGGTCGAGCACTGTGTGCCTGG - Intergenic
905812092 1:40920122-40920144 AGAATCCAGGCCTGGGTGACTGG - Intergenic
905886432 1:41494430-41494452 GGGTTCCAAGGCTGGGTGGCAGG - Intergenic
905990609 1:42334744-42334766 GGGATCCACGTCTGGTTCCCCGG + Intronic
906108453 1:43308315-43308337 GGGACTCAGGTTTGGGTGCCAGG + Intronic
906108469 1:43308365-43308387 GGGACTCAGGTTTGGGTGCCAGG + Intronic
906108485 1:43308415-43308437 GGGACTCAGGTTTGGGTGCCAGG + Intronic
906297778 1:44659614-44659636 AGGAGCCAGGGCTGGGTGTCTGG - Intronic
907425403 1:54376106-54376128 GGGGTCCAGGAGTGGATGGCTGG - Intronic
908901888 1:68965023-68965045 GGCTTCCAGGACTGGCTTCCAGG - Intergenic
909729460 1:78874672-78874694 GGGCTCTAGGAGTGGCTGCCGGG - Intergenic
910625598 1:89303167-89303189 GGGAACCAGGGCTGTGCGCCCGG - Intergenic
911057689 1:93722181-93722203 GGGATCCGGTACCGGGAGCCAGG - Intronic
915091555 1:153429679-153429701 TGGGACCAGGACTGGGTGCCTGG + Intergenic
915463580 1:156083043-156083065 GGGGGCCAGGAAAGGGTGCCAGG + Intronic
917872584 1:179255248-179255270 GGAATCCAGAAGTGGGAGCCTGG + Intergenic
918187996 1:182144479-182144501 GGGAAACAGGCCTGGGAGCCAGG + Intergenic
919311647 1:195917330-195917352 GGGATTCAGGGCTGGGAGACAGG - Intergenic
921050226 1:211505871-211505893 GGGCTCCAGGTCAGGGTGCATGG - Intergenic
922535167 1:226374299-226374321 GGGAGCTTGGACTTGGTGCCAGG + Exonic
923474482 1:234319919-234319941 GGGCTCCAGGACTTGGGACCAGG - Intronic
1063035182 10:2280017-2280039 GGAAGGCAGGACTGGGTCCCGGG - Intergenic
1065535428 10:26710808-26710830 AGGATACAGGACTGGGTAGCAGG + Intronic
1065535844 10:26714001-26714023 AGGATACAGGACTGGGTAGCAGG - Intronic
1065869150 10:29941264-29941286 GGGATCCAGGAGTAGGCACCAGG - Intergenic
1066064075 10:31749961-31749983 GGTGTGCAGGGCTGGGTGCCAGG - Intergenic
1066064187 10:31750433-31750455 GGGAGCCTGGACTGGCTGCAGGG - Intergenic
1066953942 10:42148451-42148473 GGGATCCAGGACAGGATAACAGG + Intergenic
1067582427 10:47454075-47454097 GGCCTCCAGCACTGGGTGGCAGG - Intergenic
1067717115 10:48698208-48698230 GGAATGCAGGACTTGATGCCAGG + Intronic
1067747069 10:48943936-48943958 GGGATCCAGGACAGGAACCCAGG - Intronic
1068506867 10:57911663-57911685 CTGATCCAAGACTGGGTGTCAGG - Intergenic
1069747830 10:70727026-70727048 TGGATCCAGATATGGGTGCCAGG + Intronic
1069785228 10:70983608-70983630 GGGATCACGGACTGTGTACCAGG + Intergenic
1069839889 10:71333194-71333216 GGTCTGCAGCACTGGGTGCCTGG + Intronic
1069928420 10:71866916-71866938 GGGGTCCAGTACTGGGTGGTGGG - Intergenic
1069992692 10:72324991-72325013 TGGATGCAGGGCTGGGTGCCTGG + Intergenic
1070474958 10:76820954-76820976 GGGCTCCAGGAGTGGCTGCCAGG - Intergenic
1070510652 10:77157827-77157849 GTGATCCTGGAGAGGGTGCCAGG - Intronic
1070603015 10:77878837-77878859 GGGAGCCAGGACTGGATGAGTGG - Intronic
1071564487 10:86664755-86664777 GGGCTCCAGGACAGGGTGCGGGG - Intronic
1072309395 10:94139736-94139758 GGGAGCCAGGGCTGGGTGGGAGG + Intronic
1072955635 10:99885605-99885627 GGGATCTGGGCCTGGGGGCCTGG + Intronic
1073338763 10:102729586-102729608 GGGTTCCCAGACTGGGTGTCTGG + Intronic
1073394649 10:103207950-103207972 GGGCTCTAGGAGTGGCTGCCGGG - Intergenic
1073403420 10:103277017-103277039 GGCATCCAGGAGTGGGGGCGGGG - Intergenic
1074317233 10:112370742-112370764 TGGATCCAGCACTGGGTCACAGG - Intergenic
1074364390 10:112846188-112846210 AGGATTCAGGCCTTGGTGCCTGG - Intergenic
1075081155 10:119384785-119384807 AGGAGCCTGGACTGGGAGCCAGG - Intronic
1075214030 10:120516314-120516336 GGGATCCAGGTTTGGAAGCCTGG - Intronic
1075418899 10:122286259-122286281 GGGCTCCAGCACTGGGTGCCAGG - Intronic
1077121021 11:908575-908597 GGGGTCAAAGACTGGGTGCCTGG - Intronic
1077146653 11:1049532-1049554 GGGCTCCCGGGCTGGGAGCCAGG + Intergenic
1077415147 11:2421299-2421321 GGGAGCCAGGGGTGGGTGCTGGG + Intronic
1077562699 11:3273963-3273985 TGGAACCAGTACTTGGTGCCCGG + Intergenic
1077568593 11:3319782-3319804 TGGAACCAGTACTTGGTGCCCGG + Intergenic
1077766352 11:5163611-5163633 GGGCTCTAGGAGTGGCTGCCAGG + Intronic
1077797747 11:5509210-5509232 GTGATCCAGGACTTGGGCCCTGG + Exonic
1078106491 11:8361317-8361339 GGGAGGCAGGACAGGGGGCCAGG - Intergenic
1078678124 11:13446196-13446218 GGTATACAGGAGTGGGTGTCAGG - Intronic
1080875499 11:36270942-36270964 AGGATTCAGGACAGAGTGCCTGG + Intergenic
1081642540 11:44766206-44766228 GGAATCCAAGACAGGGTGGCCGG + Intronic
1081799433 11:45847711-45847733 GGGACCCGGGGCTGGGTGGCGGG + Intronic
1083378366 11:62244311-62244333 GGGACCCAGGACTGAGAGGCTGG - Intronic
1084122156 11:67075968-67075990 GGGGTCCAGGGCTGGGGGTCTGG - Intergenic
1084214467 11:67639962-67639984 GGGGTCCAGGCCTGGCTGACTGG + Intergenic
1084354223 11:68626527-68626549 GGGCTCTAGGAGTGGCTGCCGGG - Intergenic
1089008639 11:115114125-115114147 GAGATTCAGGACTTGGTGCAGGG + Intergenic
1089678930 11:120108793-120108815 GGCATCCAATAATGGGTGCCTGG - Intergenic
1089953332 11:122549335-122549357 GGGCTCTAGGAGTGGCTGCCGGG - Intergenic
1090549941 11:127808682-127808704 GGCATCCTGGGCTGGGTGGCTGG + Intergenic
1091207291 11:133830575-133830597 GGGATCCAGGACCAGGGGCAGGG + Intergenic
1091701591 12:2666974-2666996 TTTATCCAGGACTGGGTCCCTGG - Intronic
1093741644 12:22695222-22695244 AGAAACCAAGACTGGGTGCCAGG + Intergenic
1094017748 12:25883152-25883174 GGGATCCAAGACTGAATGACTGG - Intergenic
1094400709 12:30058362-30058384 GGGGTCTAGGAGTGGCTGCCAGG - Intergenic
1094818762 12:34209215-34209237 GGCATCCAGGCCAGGGTGGCAGG - Intergenic
1095970987 12:47901910-47901932 GGGTCCCAGGACAGGGTGGCCGG + Intronic
1095998992 12:48113458-48113480 GGGATCTGGGAGTGGCTGCCAGG + Intronic
1096233833 12:49912601-49912623 GGGAGGCAGGACTGGGTCACTGG + Intergenic
1097170801 12:57111520-57111542 GGGGTCCAGGCCTTGGAGCCAGG + Intronic
1097417024 12:59326547-59326569 GGGATCTGGGAGTGGCTGCCAGG + Intergenic
1098496632 12:71143268-71143290 GGGAGCCAGGAAATGGTGCCAGG + Intronic
1098629089 12:72705734-72705756 GGGATCTGGGAGTGGCTGCCAGG - Intergenic
1101278367 12:103226007-103226029 GGGATCTGGGAGTGGCTGCCAGG + Intergenic
1102993364 12:117330509-117330531 GGGGTCCTGGCCTGGGGGCCTGG + Exonic
1104056759 12:125236639-125236661 GGGAACCAGGACTCTGTCCCAGG - Intronic
1104207705 12:126656278-126656300 GGCAGCCTGGACTGGGGGCCTGG + Intergenic
1104257638 12:127154178-127154200 GGGCTCTAGGAGTGGCTGCCGGG - Intergenic
1104546968 12:129721630-129721652 GGGGTCCAGGACTGCCTGCTGGG + Intronic
1104549043 12:129739182-129739204 AGGATGCAGGACTGGGACCCGGG - Intronic
1104566598 12:129890451-129890473 GGGAGCCAGGGTTGGGTGCCAGG - Intronic
1104732793 12:131117646-131117668 GTGACCCAGGACTGGCTGACTGG - Intronic
1104892328 12:132146180-132146202 CTGATCCAGGAGTGGCTGCCTGG - Intronic
1104988060 12:132608438-132608460 GGGCTCCAGGATCAGGTGCCAGG - Intronic
1105896755 13:24723214-24723236 GGGATCCAGGGCTGACTGCTTGG - Intergenic
1107408479 13:40137362-40137384 GGTATCCAAGTCTGGGTCCCTGG + Intergenic
1107994903 13:45850449-45850471 GGCAGGCAGGACTGAGTGCCGGG - Intronic
1113456279 13:110451079-110451101 GGGATGCACTACTGGGTGGCAGG - Intronic
1113520731 13:110938724-110938746 GGGAGCATGGACTTGGTGCCAGG - Intergenic
1114007560 14:18331619-18331641 GGGATCCAGGAGTTGGGCCCTGG + Intergenic
1114484169 14:23053336-23053358 GGTCTGCAGGCCTGGGTGCCAGG - Intronic
1115296200 14:31830017-31830039 GGGCTCCAGATCGGGGTGCCTGG - Intronic
1116703259 14:48265701-48265723 GGGCTCTGGGACTGGCTGCCAGG + Intergenic
1118937226 14:70299129-70299151 GGGCTCTAGGAGTGGCTGCCGGG + Intergenic
1120398311 14:83996069-83996091 TGGATCCAACACTGGGTGCTGGG + Intergenic
1120539529 14:85736300-85736322 GGGCTCCAGGAGTGGCTGCCAGG + Intergenic
1120618286 14:86733734-86733756 GGGATCTGGGAGTGGCTGCCAGG - Intergenic
1121289445 14:92762253-92762275 GGGCTCTAGGACTGGCTGCTGGG - Intergenic
1121323867 14:93008503-93008525 CAGATCCAGGGCTGGCTGCCAGG + Intronic
1121446248 14:93981033-93981055 GGCAGCCAGGGCTGGGAGCCAGG - Intergenic
1121820193 14:96959615-96959637 GGGATCCAGTCCTGAGTGCAGGG + Intergenic
1122070697 14:99203814-99203836 GGGATAGAGGGCTGGGGGCCGGG + Intronic
1122411051 14:101526394-101526416 GGGCTCCGGGACAGCGTGCCGGG + Intergenic
1202939644 14_KI270725v1_random:135488-135510 GGGATCCAGGACAGGATAACAGG + Intergenic
1123393495 15:19900405-19900427 GGGATCCAGGACAGGATAACAGG - Intergenic
1123439548 15:20280767-20280789 TGGTTCCAGGTCTGGGTGCTGGG + Intergenic
1124596117 15:31092458-31092480 GGGGTCCAGGTCCGGCTGCCTGG - Intronic
1125503870 15:40255614-40255636 GGGAGCCAGGATAGGGTGCTGGG + Intronic
1125715846 15:41819528-41819550 GGGCTCCAGGGTTGGGTGGCGGG + Intronic
1126392766 15:48177850-48177872 GGGAGCCGGGGCTGGGGGCCCGG - Intronic
1126493654 15:49266699-49266721 TAGATCCAGGAGTGGGTACCTGG - Intronic
1127867306 15:63042994-63043016 GGGATCCAGCCGGGGGTGCCAGG - Intronic
1128263173 15:66246879-66246901 GTGATCCAGGACTGGAAACCAGG + Intronic
1128606480 15:69039999-69040021 GGTATCCAGCCCTGGGTGCTGGG + Intronic
1129463292 15:75710606-75710628 GGCATCCAGGTCAGGGGGCCTGG - Intronic
1129771485 15:78206041-78206063 GGGCTGCAGGACAGGGTGCTGGG + Intronic
1130014227 15:80174853-80174875 GGGACCCAGCACTGTGTCCCTGG - Intronic
1130772469 15:86938585-86938607 GGTATCCTGGACTAGGTGCTTGG - Intronic
1131389306 15:92034162-92034184 GGGATCCAGGAGAGGGATCCTGG + Intronic
1132452823 15:101977664-101977686 CGTGTCCAGGACAGGGTGCCGGG + Intergenic
1132497508 16:270840-270862 GGGATCCTTGACTGGGTGCCCGG - Intronic
1132569620 16:638431-638453 GGGAGGCAGGACGGGGTGCTGGG - Intronic
1132701152 16:1222675-1222697 GGGATCCGGTGCTGGGTGACCGG - Exonic
1132905669 16:2281419-2281441 GGGAGTCCGGACTGGGGGCCAGG + Exonic
1133063523 16:3190294-3190316 GGGACTCAGGACGGGGTACCCGG - Intergenic
1133324179 16:4933358-4933380 GGGACCCAGGTCTGGGTGGAGGG + Intronic
1133411616 16:5573598-5573620 TGGGTCCAGGACTGGGACCCAGG - Intergenic
1134090714 16:11390349-11390371 CGGCTGCAGGCCTGGGTGCCCGG - Exonic
1134197137 16:12167964-12167986 GGGTTCCAGAACAGGGTGCCAGG - Intronic
1134342148 16:13355895-13355917 GGGCTCCGGGAGTGGCTGCCAGG + Intergenic
1136173955 16:28505044-28505066 GGAAGCCAGGACTGGATTCCAGG + Intronic
1136696073 16:32083419-32083441 GGGATCCAGGACAGGATAACAGG + Intergenic
1136715786 16:32279961-32279983 GGGATCCAGGACAGGATAACAGG - Intergenic
1136752127 16:32649806-32649828 GGGATCCAGGACAGGATAACAGG + Intergenic
1136796567 16:33026671-33026693 GGGATCCAGGACAGGATAACAGG + Intergenic
1136822467 16:33330656-33330678 GGGATCCAGGACAGGATAACAGG - Intergenic
1136829030 16:33387195-33387217 GGGATCCAGGACAGGATAACAGG - Intergenic
1136834096 16:33485977-33485999 GGGATCCAGGACAGGATAACAGG - Intergenic
1136845620 16:33573631-33573653 TGGTTCCAGGCCTGGGTGCTGGG - Intergenic
1136902389 16:34052210-34052232 GGGATCCAGGACAGGGTAACAGG - Intergenic
1136909947 16:34136572-34136594 GGCATCCAGGCCAGGGTGGCAGG - Intergenic
1136957884 16:34804960-34804982 GGGATCCAGGACAGGATAACAGG - Intergenic
1138492071 16:57382658-57382680 GCCTTCCAGGACTGGGGGCCTGG + Exonic
1138551434 16:57750986-57751008 GGCATCCAGCACTGAGGGCCGGG - Intronic
1139446242 16:67000452-67000474 GGGGCCCAGGACTGGGAGGCAGG - Intronic
1139468324 16:67165659-67165681 GGGATGGGGGACTCGGTGCCGGG + Intronic
1139526688 16:67521165-67521187 TGAATCCAGGACTGGCCGCCAGG + Intronic
1139967539 16:70754130-70754152 GGAAGACAGGACTGTGTGCCAGG - Intronic
1140452180 16:75079819-75079841 GGGTACCAGGACTGGGTCCAAGG + Intronic
1140478011 16:75248635-75248657 GGGCTCAAGTCCTGGGTGCCCGG + Intronic
1141554539 16:84828195-84828217 GGGCTCCAGGGCTGGCAGCCCGG - Intronic
1141771775 16:86093983-86094005 GGGAGGCAGGCCTGGGTCCCGGG + Intergenic
1142214083 16:88822335-88822357 GGGATACATCACTGGGGGCCAGG + Intronic
1142361660 16:89630543-89630565 GGGAACCAGGACTGGGAACTGGG + Intronic
1203010820 16_KI270728v1_random:238543-238565 GGGATCCAGGACAGGATAACAGG + Intergenic
1203054268 16_KI270728v1_random:909790-909812 GGGATCCAGGACAGGATAACAGG + Intergenic
1203107328 16_KI270728v1_random:1422284-1422306 TGGTTCCAGGCCTGGGTGCTGGG - Intergenic
1142750879 17:1986876-1986898 GGCTTCCAGGCCTGGGTTCCAGG + Intronic
1143023867 17:3929869-3929891 AGGGTCCAGGATTGGGTTCCAGG - Intronic
1143477444 17:7211008-7211030 GGGAACAAGAAATGGGTGCCAGG + Intronic
1143563181 17:7707110-7707132 GGGTCTCAGGACTGGGTCCCAGG - Intronic
1144715401 17:17431833-17431855 TGGAACCAGGAGGGGGTGCCTGG + Intergenic
1145057450 17:19712815-19712837 GTCCTCCAGGACTGGGTGCTCGG + Intronic
1145094130 17:20009731-20009753 GGGACCCGGGACTGAGAGCCAGG + Intronic
1145690408 17:26732809-26732831 GGGATCCAGGACAGGATAACAGG - Intergenic
1147445394 17:40472180-40472202 TCGATCCAGGCCTGGGTCCCTGG - Intergenic
1147591913 17:41689209-41689231 GGGATCAAGGCCTGGGCCCCGGG + Intronic
1147758310 17:42782253-42782275 AAGATCCAGGACTAGGCGCCAGG - Intronic
1147915243 17:43881829-43881851 GGGATCCAGGATTAGGTGCCAGG - Intronic
1151362439 17:73596690-73596712 GGGACACAGGACAGGGTGGCTGG + Intronic
1152293091 17:79451923-79451945 GGGTGCCAGTACTGGGTGGCAGG - Intronic
1154529910 18:15332343-15332365 GGGATCCAGGAGTTGGGCCCTGG - Intergenic
1155393461 18:25361767-25361789 TGGGTCCAGCACTGGGTGCTTGG - Intergenic
1158450158 18:57557021-57557043 GGGACCCTGGACTGGGTCCTGGG + Intronic
1159003527 18:62993095-62993117 GGAATCCAGGAGTGGCCGCCCGG - Intergenic
1159131385 18:64283787-64283809 GAAATCCAGGGCTGGGTGCAGGG + Intergenic
1160988967 19:1852873-1852895 AGGATCCAGGGATGGGTGCCTGG - Exonic
1161218063 19:3104619-3104641 GGGATCCAGCACTGTGGACCAGG + Intronic
1161404281 19:4082992-4083014 GGGTGGCAGGACTGGGTGACAGG - Intergenic
1161596779 19:5154641-5154663 GGGACCCAGGACTGGGCCCTGGG + Intergenic
1162088153 19:8261021-8261043 GGGCTCCAGGACAGTGTCCCAGG + Intronic
1163689260 19:18729954-18729976 GGGGTCACGCACTGGGTGCCAGG + Intronic
1163900193 19:20093948-20093970 GGGTTCTAGGAGTGGCTGCCGGG + Intronic
1163944421 19:20522404-20522426 GGGCTCTAGGAGTGGCTGCCAGG + Intergenic
1164258795 19:23551650-23551672 GGGCTCTAGGAGTGGCTGCCAGG - Intronic
1166183012 19:41121975-41121997 AGCCTCCTGGACTGGGTGCCTGG + Exonic
1166316260 19:41991789-41991811 GGGAGGAAGGACTGGGAGCCTGG + Intronic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166822331 19:45588066-45588088 GGGACCTTGGACTGGTTGCCTGG + Intronic
1167299329 19:48670183-48670205 GAGATACAGGACTGGCTGCAGGG + Intronic
1168136497 19:54355653-54355675 GGGATCCAAGGATGGGTGGCAGG - Intronic
1168351883 19:55680682-55680704 GGGGTCCAGGAGGGGGTCCCTGG + Intronic
1168707316 19:58477459-58477481 GAGATCCAGGCCTGGGTGCGCGG + Exonic
1202670058 1_KI270709v1_random:41467-41489 GGGATCCAGGACAGGATAACAGG - Intergenic
925755998 2:7133200-7133222 GGGAACCAGCACAGGGGGCCAGG - Intergenic
926815517 2:16795265-16795287 GGGATCTGGGAGTGGCTGCCAGG + Intergenic
927645369 2:24873805-24873827 GGGATCCAGGGCTGGGAGGGTGG - Intronic
927844192 2:26462970-26462992 TGAATCCAGGAGTGAGTGCCTGG - Intronic
927868726 2:26609712-26609734 GGGCTCCAGGTCTGGGCGCAAGG + Intronic
927932502 2:27054080-27054102 CTGATCCAGGACTGTGTGGCAGG - Intronic
929546826 2:42861436-42861458 AGGATCCAGGGATGGGTGCCTGG + Intergenic
931289746 2:60862043-60862065 AGGAGAGAGGACTGGGTGCCTGG - Intergenic
931457675 2:62424927-62424949 GGGAACCAAGACTGGCAGCCAGG - Intergenic
932582434 2:73000533-73000555 GGGGTCCAGGCCTGGCTTCCAGG - Intronic
932766597 2:74474548-74474570 AGGATTCAGGACTGGTTCCCAGG + Exonic
932910843 2:75804796-75804818 GGGAGCCAGGATTGGCTGCTGGG - Intergenic
934852971 2:97712999-97713021 GGGAGCCAGGGCTGGGAGGCCGG - Intergenic
935978757 2:108605970-108605992 GGCAACCAGGCCTGGGGGCCAGG + Intronic
936935145 2:117832818-117832840 GGGATCCAGGAATGTATCCCTGG + Intergenic
937012806 2:118576780-118576802 GGGAGCCAGAACTGGGTGGGTGG + Intergenic
937037872 2:118796789-118796811 CTGAGCCAGGAGTGGGTGCCTGG - Intergenic
937379457 2:121363381-121363403 GGAACCCAGAACTGGGTGCTTGG - Intronic
937449449 2:121989789-121989811 GGGATCCAGGGCTGAGAACCTGG + Intergenic
938290259 2:130145164-130145186 GGCATCCAGGGCTGGGCGCCGGG + Intergenic
938466271 2:131527781-131527803 GGCATCCAGGGCTGGGCGCCGGG - Intronic
938517988 2:132036917-132036939 GGGATCCAGGACAGGATAACAGG + Intergenic
940884136 2:158974196-158974218 GGGATTCAGAAATGGGGGCCAGG + Intronic
941992195 2:171568422-171568444 TGGCTTCAGGACTGGGTGGCAGG - Intergenic
946406014 2:219492497-219492519 GGGATCCAGGACTGGGACATGGG + Intronic
948266863 2:236641308-236641330 GAGACACAGGACTGGATGCCGGG + Intergenic
949040780 2:241849204-241849226 GGGGTCCAGGACTGGGCTCCAGG + Intergenic
1169195505 20:3680342-3680364 GGGAGCTGGGACTGGGTACCGGG - Intronic
1169614058 20:7418877-7418899 GGGATCCTGGATTGGATCCCAGG - Intergenic
1170790576 20:19505869-19505891 GGGCCCCAGGACTGTGGGCCTGG + Intronic
1171771115 20:29324290-29324312 GGCATCCAGGCCAGGGTGGCAGG + Intergenic
1171905419 20:30895274-30895296 GGCATCCAGGCCAGGGTGGCAGG - Intergenic
1172331666 20:34079967-34079989 GGCATCCAGGGTTGGGTGCCCGG - Exonic
1172932439 20:38596040-38596062 GGGCTCTAGGAGTGGCTGCCGGG + Intergenic
1173503834 20:43571881-43571903 GGGCTCCTGGACTGGATGTCAGG - Intronic
1173616262 20:44405436-44405458 AGGATCTTGGGCTGGGTGCCAGG - Intronic
1173781754 20:45762180-45762202 GGGCTCTAGGAGTGGCTGCCGGG - Intronic
1174288041 20:49485794-49485816 GGGAGCCAGGCATGGGAGCCAGG - Intergenic
1175225460 20:57441618-57441640 GGGATGCAGGAGTGGGAGCGGGG - Intergenic
1175500008 20:59443014-59443036 GGGATCCATGCCTGGATGCAGGG - Intergenic
1176078188 20:63258662-63258684 GGAACCCAGGCCTGGGTTCCCGG + Intronic
1176302905 21:5107220-5107242 GACGACCAGGACTGGGTGCCTGG - Intergenic
1176583545 21:8551597-8551619 GGGATCCAGGACAGGATAACAGG - Intergenic
1176767501 21:13036133-13036155 GGGATCCAGGAGTTGGGCCCTGG + Intergenic
1178670151 21:34582890-34582912 GGCACCCAGGACTGGCTGCTGGG + Intronic
1178805382 21:35834784-35834806 GGGAGCCAGGAGAGGGTGGCGGG + Intronic
1179854119 21:44154703-44154725 GATGACCAGGACTGGGTGCCTGG + Intergenic
1179876679 21:44272334-44272356 GGGAACAGGGACTGGCTGCCCGG + Intergenic
1180009545 21:45040505-45040527 TGGGTCCAGGACAGGGGGCCAGG - Intergenic
1180188566 21:46152018-46152040 GGGGTCCAGGACTCAGTTCCTGG + Intronic
1180189872 21:46157729-46157751 GGGATCCATGTCTGGAGGCCAGG + Intergenic
1180266355 22:10528528-10528550 GGGATCCAGGACAGGATAACAGG - Intergenic
1180338837 22:11601389-11601411 GGCATCCAGGCCAGGGTGGCAGG - Intergenic
1180432067 22:15262429-15262451 GGGATCCAGGAGTTGGGCCCTGG + Intergenic
1180514629 22:16130365-16130387 GGGATCCAGCAGTTGGGGCCTGG + Intergenic
1180560974 22:16614016-16614038 GGGCTCCAGGAGTGGCTGTCGGG - Intergenic
1181003567 22:19999132-19999154 GGGCTCCAGGGCTGGGAGTCTGG - Intronic
1181362385 22:22348012-22348034 GGGATCCAGGACTGAATCTCAGG + Intergenic
1181440047 22:22931101-22931123 GGGGTCCAGGCTTTGGTGCCTGG - Intergenic
1181515042 22:23405417-23405439 GAGATCGGGGCCTGGGTGCCCGG + Intergenic
1181608958 22:23999925-23999947 GGGAACCAGGCCTGGGGGCCTGG - Intergenic
1182093108 22:27609392-27609414 GGAATAGAGGCCTGGGTGCCTGG + Intergenic
1182181794 22:28357173-28357195 GGAATCCTGGACTTGGAGCCAGG - Intronic
1182503639 22:30766523-30766545 GGGCTCCAGGCCTGAATGCCTGG - Intronic
1182767285 22:32766703-32766725 GGAATCCTAGACTGGGTACCTGG - Intronic
1183216560 22:36484035-36484057 GGAAGCCAGGACTGGCAGCCTGG + Intergenic
1183472473 22:38016960-38016982 TGGAGCCAGGCCGGGGTGCCGGG + Intronic
1184273427 22:43397494-43397516 GTGATCCAGGATTGAGTTCCTGG - Intergenic
1184407431 22:44308079-44308101 TGGAGCCAGGACTTGGTCCCAGG - Intronic
1184479624 22:44738869-44738891 GGGACCCAGGCCTGGGGGACAGG + Intronic
1184646119 22:45896373-45896395 GGGATGCAGAACTGGATGCTGGG + Intergenic
1184696048 22:46139682-46139704 TGGTTCCAGGCCTGGGTGCTGGG + Intergenic
1184956205 22:47888175-47888197 GGGAACCAGGTCTGTGTGCCTGG + Intergenic
1185277386 22:49955721-49955743 GGGACCCAGGCCGAGGTGCCAGG + Intergenic
1185331722 22:50255008-50255030 GGGATCTAGGACTCTGAGCCTGG + Intronic
1185346094 22:50311454-50311476 GGGCTCCAGGACTGGGAGCCAGG + Exonic
1203324782 22_KI270738v1_random:3824-3846 GGGATCCAGGACAGGATAACAGG + Intergenic
952043680 3:29291459-29291481 GAGTTCCAGATCTGGGTGCCAGG + Intronic
952338123 3:32422348-32422370 CGGGCCCAGGGCTGGGTGCCAGG + Intronic
953501037 3:43434724-43434746 GGGAACCAGGACTGGCTAACAGG + Intronic
953788598 3:45929493-45929515 TGGATTCAGGGCTGGGGGCCTGG + Intronic
954157557 3:48694998-48695020 GGGCTCCAGGGATGGCTGCCAGG + Intronic
954214617 3:49117327-49117349 GGGACCCAGGAGCTGGTGCCGGG - Exonic
954328566 3:49877097-49877119 GGGATGCAGGCCTGGGAGGCTGG + Intergenic
958678690 3:97297197-97297219 GGGAGCCAGGAGTGGCTCCCCGG - Intronic
961002947 3:123386241-123386263 GGGAGCCAGGGCTCAGTGCCTGG - Intronic
961269408 3:125677818-125677840 GGCATCCAGGCCAGGGTGGCAGG + Intergenic
961442419 3:126960885-126960907 GGGAGACAGGACTCGATGCCAGG + Intergenic
961772148 3:129257906-129257928 GGGAACTAGGCCTGGGTTCCCGG + Intronic
962253527 3:133854425-133854447 GGGATCGTGGACTGGCTGGCAGG - Intronic
962318456 3:134373134-134373156 GGGGCGCATGACTGGGTGCCAGG - Intronic
962660664 3:137597860-137597882 GGGCTCCGGGAGTGGCTGCCAGG - Intergenic
962937986 3:140099270-140099292 GGGGAGCAGGACTGGGTCCCCGG + Intronic
966279334 3:178209918-178209940 GGGCTCTAGGAGTGGCTGCCGGG - Intergenic
966838621 3:184069330-184069352 GGGACCCGGGACTGGGTTGCTGG - Intergenic
966860228 3:184227624-184227646 GGGAGCCAGTGCTGGCTGCCTGG - Intronic
967303460 3:188038911-188038933 GGGAAGCAGGATTGGGTGGCAGG + Intergenic
967359639 3:188614885-188614907 AGGCACCAGGCCTGGGTGCCAGG - Intronic
967986237 3:195097629-195097651 GGGCTCCAGGCCAGGCTGCCTGG - Intronic
969392796 4:6902202-6902224 GGGGCCCTGGGCTGGGTGCCAGG + Intergenic
969699970 4:8762509-8762531 GGGAGCCAGGACGGGGCTCCAGG + Intergenic
973730323 4:53816605-53816627 GGAATCCAGGCCAGGGTGCTGGG + Intronic
974078016 4:57185279-57185301 GGGATGTAGGAGTGGGAGCCTGG - Intergenic
975533633 4:75426228-75426250 GGGACCCTGGACTTGGAGCCAGG - Intergenic
976470487 4:85422793-85422815 GGGCACCAGGACTGGGTCTCCGG - Intergenic
977161104 4:93636892-93636914 GGGACACTGGACTGGGAGCCTGG - Intronic
977581562 4:98730306-98730328 GGGACCCAGGACTTGGTGATTGG + Intergenic
978621200 4:110636307-110636329 GGCATCCAGGCCTGGCTCCCAGG + Intronic
979614066 4:122721726-122721748 AGGTTCCAAGGCTGGGTGCCAGG + Intergenic
981091573 4:140737548-140737570 GGGATCCACATCTGGGTACCAGG + Intronic
982183186 4:152767836-152767858 GGAATACAGGACTAGGTGACAGG + Intronic
983493176 4:168412538-168412560 GGGATCCAGGGCTTGGAGTCAGG - Intronic
985770630 5:1807975-1807997 GGGAGACAGGACTGGGAGTCGGG + Intronic
986468872 5:8053516-8053538 GGCATCCAGGCCTGGGTCCCAGG - Intergenic
989353871 5:40518904-40518926 GAGATCTAAAACTGGGTGCCAGG - Intergenic
990937333 5:61164302-61164324 GGCATCCAGGACTGGTTTCGTGG - Intergenic
990984964 5:61632759-61632781 GGGATTCAGGCCTGGGAGCCAGG - Intergenic
992451973 5:76883711-76883733 GGGCTCCGGGAGTGGCTGCCAGG + Intronic
992886511 5:81165449-81165471 GGGGTCCAGTACTGGAGGCCTGG - Intronic
993087241 5:83378353-83378375 AGGATCCAGGACTGCCTGGCAGG + Intergenic
996315038 5:122152251-122152273 GGAATCCAGGCCTGCGGGCCGGG - Exonic
997733625 5:136197912-136197934 GGCTTCCAGGATAGGGTGCCTGG + Intergenic
997770600 5:136549648-136549670 GGGCTCTAGGAATGGCTGCCAGG + Intergenic
997772616 5:136568675-136568697 GGGCTCTAGGAGTGGCTGCCAGG + Intergenic
997775334 5:136599311-136599333 GGGAAGCAAGACGGGGTGCCAGG - Intergenic
997885768 5:137628499-137628521 GCTGTCCAGGACTGGATGCCAGG - Intronic
999221196 5:149979233-149979255 GGCATCCAGGAGTCAGTGCCAGG + Intronic
999322595 5:150624705-150624727 GGGACCCCGGGCTGGGAGCCGGG - Intronic
999366145 5:151024730-151024752 GGGAAGCAGGACTGAGAGCCAGG - Intronic
999976179 5:156914263-156914285 GGAATCCAGCAATGGGTGGCTGG - Intergenic
1001325142 5:170718640-170718662 GGGATCTAGGACTGTGGGCTGGG - Intronic
1005343726 6:24868536-24868558 GGGGTTCAGGGCTGGGTGTCAGG + Intronic
1005831279 6:29673018-29673040 GGGTTCCAGTGATGGGTGCCTGG + Exonic
1006305950 6:33218756-33218778 AGGATCCAGAACTGGAGGCCAGG + Intergenic
1006515609 6:34544127-34544149 GGCAGCCTGGACTTGGTGCCCGG - Exonic
1006729112 6:36222353-36222375 GAGCTCAAGGACTGGCTGCCTGG - Intronic
1007412953 6:41675336-41675358 GGGATCCAGGCCTGGTCTCCAGG + Intergenic
1007975688 6:46098963-46098985 GGGAACCAGCACTGGCTGCGGGG + Intergenic
1008030261 6:46687604-46687626 GGGATTGAGCACTGGGGGCCAGG - Intergenic
1008537613 6:52518662-52518684 GGGATCCAGGATGGGGAGTCAGG + Intronic
1010193288 6:73214873-73214895 GAGGACCAGGACTTGGTGCCAGG - Intronic
1010475934 6:76287317-76287339 GGGATCCAGCAAAGGGTGCAAGG - Intergenic
1010781125 6:79947254-79947276 GGGCTCCTGGACTCGGAGCCGGG - Exonic
1011626074 6:89284993-89285015 GGGATACGGGGCTGTGTGCCTGG - Intronic
1015024665 6:128519567-128519589 GGCATCGAGGTCTGGGCGCCTGG - Intronic
1015269684 6:131325785-131325807 GGGCTCCGGGAGTGGCTGCCAGG - Intergenic
1018372376 6:163179919-163179941 GGGACACTGGACGGGGTGCCTGG - Intronic
1018956920 6:168416369-168416391 GGGGTCCAGGAATGGGTCCAAGG - Intergenic
1022375815 7:29809926-29809948 GGCATCCAGGAGAGAGTGCCAGG + Intronic
1022710017 7:32841231-32841253 GGGCTCCGGGAGTGGCTGCCAGG + Intergenic
1022804737 7:33810199-33810221 GGGCTTAAGGACTGGGTGCATGG + Intergenic
1024222425 7:47299001-47299023 GGGACCCAGGGCTGGGTGGGGGG + Intronic
1024984516 7:55183604-55183626 GGGAAGCAGGTCTGGGTTCCAGG - Intronic
1025320580 7:58089124-58089146 GGGATCCAGGACAGGATAACAGG - Intergenic
1025478887 7:60958113-60958135 GGGATCCAGGACAGGATAACAGG - Intergenic
1025482102 7:60993763-60993785 GGGATCCAGGACAGGATAACAGG - Intergenic
1025553168 7:62274581-62274603 GGGATCCAGGACAGGATAACAGG + Intergenic
1025840614 7:65142264-65142286 GGGATCCAGGACAGGATAACAGG - Intergenic
1025878100 7:65507900-65507922 GGGATCCAGGACAGGATAACAGG + Intergenic
1025882437 7:65553695-65553717 GGGATCCAGGACAGGATAACAGG + Intergenic
1025891006 7:65648908-65648930 GGGATCCAGGACAGGATAACAGG - Intergenic
1029991555 7:104967175-104967197 AGGATCCAGGATTGGGTGGGTGG + Intergenic
1031204744 7:118742272-118742294 AGGATACAGGAATGGGAGCCTGG - Intergenic
1032465799 7:132144045-132144067 GGGGCCCAGGGCTAGGTGCCAGG + Intronic
1032683302 7:134207645-134207667 GGGATCGGGGGCTGGGAGCCTGG + Intronic
1032855366 7:135829407-135829429 GGGATCACAGACTGGATGCCAGG + Intergenic
1033566636 7:142585218-142585240 GGGATCCTGGATTAGGTGCTAGG + Intergenic
1033829164 7:145231651-145231673 GGGTTCCAGCATTGGCTGCCAGG + Intergenic
1034488224 7:151379517-151379539 GGGAACCAGGCCTGGGTTCAGGG + Intronic
1036372155 8:8170989-8171011 GGGCTCTAGGAGTGGCTGCCAGG - Intergenic
1036878746 8:12494652-12494674 GGGCTCTAGGAGTGGCTGCCAGG + Intergenic
1037957149 8:23068795-23068817 GGGAGCCAGGCCTGGGCCCCGGG - Exonic
1038846931 8:31238707-31238729 GGAATTCAGGAGTGGGTTCCAGG + Intergenic
1042303177 8:67307963-67307985 GGGCTCCAAGAGGGGGTGCCTGG - Intronic
1047886383 8:129254432-129254454 GGGATGCAGGACTTGGTGCCAGG - Intergenic
1048863939 8:138745346-138745368 AAGATTCAGAACTGGGTGCCTGG - Intronic
1049306355 8:141906355-141906377 AGGAGCCAGGACTGGAAGCCAGG + Intergenic
1049362665 8:142219704-142219726 GGGAGGCAGGACTGGATGCCCGG + Intronic
1049462793 8:142737826-142737848 GGGCCACAGGACAGGGTGCCTGG + Intergenic
1049761453 8:144333730-144333752 GGGATCCGGGCCGGGGGGCCGGG - Exonic
1049803757 8:144529879-144529901 GGGCTCCAGGACAGTGGGCCCGG - Exonic
1053707607 9:40770096-40770118 GGGATCCAGGAGTTGGGCCCTGG - Intergenic
1054417520 9:64890882-64890904 GGGATCCAGGAGTTGGGCCCTGG - Intergenic
1055480389 9:76703666-76703688 GTGATCCATCACTGGATGCCAGG - Exonic
1056044710 9:82704039-82704061 GGGCTCCGGGAGTGGCTGCCAGG + Intergenic
1057306653 9:93916394-93916416 TGGATCCGGGCCTGGGTGCAGGG - Intergenic
1057723076 9:97548441-97548463 GGGATCCTGGAGGGGGTGGCAGG + Intronic
1057910641 9:99017403-99017425 AAGATCCTGGACTGGGGGCCAGG + Intronic
1058990362 9:110249870-110249892 GTGAGCCAGGACTGGAAGCCAGG + Intronic
1060089611 9:120731354-120731376 TGCATGCAGGACTGGCTGCCTGG + Intergenic
1060226225 9:121792707-121792729 GGGCTCTAGGAGTGGCTGCCAGG - Intergenic
1060931435 9:127491806-127491828 GGCGTCCTGGACTGGATGCCTGG + Intronic
1060981308 9:127794046-127794068 GGTAGCCAGGAGTGGGTGGCAGG - Intergenic
1061087693 9:128408942-128408964 GCCAGGCAGGACTGGGTGCCAGG - Intergenic
1061404197 9:130384624-130384646 GGGATTTAGGACTGGGGGCTGGG + Intronic
1061453616 9:130681970-130681992 GGGATGCCGGCCTGGGCGCCCGG - Exonic
1061884703 9:133585655-133585677 GGGCCCCAGGACGGGGAGCCTGG + Intronic
1061942757 9:133892015-133892037 GGGACAAAGGACGGGGTGCCAGG + Intronic
1061980700 9:134101916-134101938 GGCAGCCAGGCCTCGGTGCCCGG + Intergenic
1062033352 9:134371960-134371982 CTGGTGCAGGACTGGGTGCCAGG + Intronic
1062149076 9:135008116-135008138 GGGAAACAGGACTGGGGGGCTGG - Intergenic
1062156408 9:135051257-135051279 GGGATCCAGGAGTGGGGACACGG - Intergenic
1062331727 9:136047899-136047921 GGGAGCCAGGGCTGGGTGTCGGG - Intronic
1062459101 9:136655440-136655462 GAGATGCAGGACAGGGTGCTGGG + Intergenic
1062564963 9:137160201-137160223 GGGCTTCGGGACTGGGGGCCGGG + Intronic
1185717098 X:2351681-2351703 GGGTTCCAGCACTGAGAGCCAGG - Intronic
1188410501 X:29866272-29866294 CTGCTCCAGGACTGGGGGCCAGG + Intronic
1189985396 X:46549014-46549036 GGGATGCAGGAGTGGGAGACAGG - Intergenic
1190290580 X:48989555-48989577 AGGGGCCAGGACTGGGAGCCTGG - Intronic
1195016921 X:100789746-100789768 GGGATCTGGGAGTGGCTGCCAGG + Intergenic
1196496894 X:116333207-116333229 GGGCTCCGGGAGTGGCTGCCAGG - Intergenic
1198599376 X:138267635-138267657 GGGCTCTAGGAGTGGCTGCCAGG + Intergenic
1198698484 X:139369702-139369724 GGGCTACAGGACTGGTTGGCAGG + Intergenic
1199673050 X:150162478-150162500 GGTATCCAGGACTGGGGCTCAGG + Intergenic
1200036419 X:153334414-153334436 GGGGTGCAGGACTGTGTGCGGGG + Intronic
1200118305 X:153778820-153778842 GGGATCCAGCAGGGGCTGCCTGG - Intronic
1201937157 Y:19421351-19421373 GGGCTCTAGGAGTGGCTGCCTGG - Intergenic