ID: 905166336

View in Genome Browser
Species Human (GRCh38)
Location 1:36085293-36085315
Sequence GGATCCAGGACTGGGTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905166326_905166336 4 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166336 1:36085293-36085315 GGATCCAGGACTGGGTGCCCGGG 0: 1
1: 0
2: 0
3: 35
4: 275
905166331_905166336 -9 Left 905166331 1:36085279-36085301 CCTGACACAGGCAGGGATCCAGG 0: 1
1: 0
2: 3
3: 33
4: 281
Right 905166336 1:36085293-36085315 GGATCCAGGACTGGGTGCCCGGG 0: 1
1: 0
2: 0
3: 35
4: 275
905166330_905166336 -8 Left 905166330 1:36085278-36085300 CCCTGACACAGGCAGGGATCCAG 0: 1
1: 0
2: 1
3: 16
4: 237
Right 905166336 1:36085293-36085315 GGATCCAGGACTGGGTGCCCGGG 0: 1
1: 0
2: 0
3: 35
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905166336 Original CRISPR GGATCCAGGACTGGGTGCCC GGG Intronic
900163268 1:1234605-1234627 GGATCGAGGGCTGGGGACCCCGG + Exonic
900290737 1:1922553-1922575 GGCTCCAGGCCAGGGAGCCCTGG - Intronic
900692310 1:3988033-3988055 GGCTCCAGGACAGGTGGCCCAGG + Intergenic
900916783 1:5644973-5644995 GGACACAGCACTGGGTCCCCTGG - Intergenic
901055375 1:6446658-6446680 GTATCCCGGGCAGGGTGCCCTGG + Intronic
901824143 1:11849621-11849643 GGAACCAGGACTGGATCCCCAGG + Intergenic
901844770 1:11974886-11974908 GGAGGCTGGACTGGGTTCCCTGG - Exonic
903012662 1:20342542-20342564 GGCTCCAGGCCTGGGTCTCCTGG - Exonic
903307700 1:22424827-22424849 AGCTCCAGGACTTGGTGACCGGG - Intergenic
903705086 1:25279820-25279842 GGGTCCAGGCATGGGCGCCCGGG + Intronic
905166336 1:36085293-36085315 GGATCCAGGACTGGGTGCCCGGG + Intronic
905812091 1:40920121-40920143 GAATCCAGGCCTGGGTGACTGGG - Intergenic
906114362 1:43346598-43346620 GGATCCAGAAAGGGGAGCCCAGG - Exonic
907999705 1:59668319-59668341 GGACCCATCACTGGGTGGCCAGG + Intronic
908009259 1:59758963-59758985 GGATCCAGTACAGGGGGCTCAGG + Intronic
910177865 1:84450428-84450450 GAATCCAGGGCTGGGTGCAGTGG + Intergenic
910550373 1:88467485-88467507 GGATCCGGCACTGGGGCCCCAGG - Intergenic
913144466 1:115976341-115976363 AGATCCGGGGCTGGATGCCCTGG - Intergenic
913610593 1:120506222-120506244 GGATCCAGGAGTGGGGCCACTGG - Intergenic
914580597 1:149016017-149016039 GGATCCAGGAGTGGGGCCACTGG + Intronic
915038202 1:152946371-152946393 AGAGCCAGGACTGGGGCCCCAGG + Intergenic
915091556 1:153429680-153429702 GGGACCAGGACTGGGTGCCTGGG + Intergenic
916340993 1:163734810-163734832 AGACCCAGGACTGGGTGCAGTGG - Intergenic
919778223 1:201207569-201207591 GGCTCCAGGCCTGGGTGCTCAGG + Exonic
920842205 1:209564309-209564331 GGGTGCAGGACTGGGCCCCCAGG - Intergenic
922567415 1:226610046-226610068 GCATTCAGTACTGGGTGCCATGG + Intergenic
922677079 1:227559785-227559807 GGACCCAGGACCGTGGGCCCTGG + Intergenic
1063017883 10:2096451-2096473 GGAGACAAGACTGGATGCCCAGG + Intergenic
1063913317 10:10854502-10854524 GGATCCCGGAGTGGGTTCCTTGG - Intergenic
1065972378 10:30815859-30815881 GGTGCCAGGGCTGGGTGCACTGG + Intergenic
1067095412 10:43296282-43296304 GGATCATAGACTGGGTGCACTGG + Intergenic
1068506866 10:57911662-57911684 TGATCCAAGACTGGGTGTCAGGG - Intergenic
1069679283 10:70272423-70272445 GCATCCAGGCCTGGGTTCACTGG - Intronic
1070724216 10:78777453-78777475 GGACCCTGGCATGGGTGCCCAGG + Intergenic
1070734248 10:78852566-78852588 GGGTCCAGGACCCGGTGCTCTGG + Intergenic
1072278466 10:93845203-93845225 GGAACCAGGGCTGTGTGCACAGG + Intergenic
1072915182 10:99533380-99533402 GGATTCAGGGCTGTGTCCCCAGG + Exonic
1073069158 10:100782494-100782516 GGATCTTGGACTGTGGGCCCAGG - Intronic
1073211755 10:101809426-101809448 GGATTCAAGGCTGGGTGCACTGG + Intronic
1073717239 10:106121388-106121410 GGATCCAGGCCCGGGTGCAGTGG + Intergenic
1074364389 10:112846187-112846209 GGATTCAGGCCTTGGTGCCTGGG - Intergenic
1075418898 10:122286258-122286280 GGCTCCAGCACTGGGTGCCAGGG - Intronic
1075461636 10:122620429-122620451 TGACCCAGGACTAGGTTCCCAGG - Intronic
1075488569 10:122847384-122847406 TGAGGCAGGACTGGGTGTCCTGG + Intronic
1075536619 10:123276894-123276916 TCATCCAGGTGTGGGTGCCCAGG + Intergenic
1075960900 10:126567069-126567091 GGAGCCACAGCTGGGTGCCCTGG + Intronic
1076476669 10:130758442-130758464 GGACCCAGGTCTGGGTGACCTGG - Intergenic
1076678076 10:132158300-132158322 AGCTCCAGGAGTGGGGGCCCTGG + Intronic
1076705130 10:132297276-132297298 GCAGCGAGGACTGGCTGCCCTGG - Intronic
1076768616 10:132651218-132651240 GGATCCAGGCCGGGGGACCCAGG - Intronic
1076768657 10:132651310-132651332 GGATCCAGGCCGGGGGACCCAGG - Intronic
1076873336 10:133204156-133204178 GAAGCCAGGACCAGGTGCCCCGG + Intronic
1077121020 11:908574-908596 GGGTCAAAGACTGGGTGCCTGGG - Intronic
1077186409 11:1237280-1237302 ACATCCAGGACTGTGTGCCGTGG - Intronic
1077501216 11:2910555-2910577 GGCACCAGGCCGGGGTGCCCTGG + Intronic
1078001221 11:7497709-7497731 GGGTTCAGGACAGGGTGCCATGG + Intronic
1079098838 11:17528270-17528292 GTATCCAGGGCTGGCTGCCCAGG - Intronic
1080807101 11:35663294-35663316 GGGTCCAGGCCTGGGAGCCGTGG - Exonic
1080875500 11:36270943-36270965 GGATTCAGGACAGAGTGCCTGGG + Intergenic
1083146912 11:60766861-60766883 GAATCCAGCCCTGGGAGCCCAGG - Intronic
1083488601 11:62998806-62998828 GACTCTGGGACTGGGTGCCCGGG + Intronic
1084589002 11:70079359-70079381 TGAACCAGGCCTGGGCGCCCAGG - Intronic
1084793997 11:71492019-71492041 GGTCCCTGGCCTGGGTGCCCAGG + Intronic
1085625371 11:78067795-78067817 GAATCCAGGAATTGGTGCTCAGG - Exonic
1086469845 11:87096391-87096413 GGCTCCGTGACTGGGTTCCCAGG - Intronic
1089189098 11:116641385-116641407 GAATCCAGGACTGGGACACCTGG + Intergenic
1089555197 11:119312231-119312253 GGACCCAGGACAGGGGGACCAGG - Intronic
1092086804 12:5769291-5769313 GGAACCAGGACTGGCTGGCCTGG + Intronic
1092170164 12:6369413-6369435 GGATCAAGGGCTGGGAGCCCAGG - Intronic
1094317629 12:29149897-29149919 GGGACCAGGACTGGGCGCCCTGG - Intronic
1095207727 12:39457365-39457387 GGATCCTAGATTGGGTCCCCTGG - Intergenic
1095970988 12:47901911-47901933 GGTCCCAGGACAGGGTGGCCGGG + Intronic
1096280035 12:50244915-50244937 ACATCCAGGGCTGGGTGTCCTGG + Intronic
1099917666 12:88915436-88915458 GGACCCTGGACTGTATGCCCTGG + Intergenic
1103060865 12:117857345-117857367 AGATCCTGGACTGGGTGCAGTGG - Intronic
1104800961 12:131555021-131555043 GGCTTCAGGAGTGGGTGCTCTGG - Intergenic
1104892327 12:132146179-132146201 TGATCCAGGAGTGGCTGCCTGGG - Intronic
1105477321 13:20739875-20739897 GGATCCAGCACTGGGGCCACAGG + Intronic
1105601947 13:21895364-21895386 GGATCCATGCCTGTGTGCCGAGG + Intergenic
1106893031 13:34266944-34266966 GGATCCAAGGCTGGGTGCGATGG - Intergenic
1107460474 13:40597313-40597335 GGCTCCAAGGCTGGGTGACCAGG - Intronic
1107891984 13:44921891-44921913 GAGTGCAGGACTGGGTTCCCAGG - Intergenic
1108567449 13:51714578-51714600 GGTTCCAGGCCTGGGTGCAGTGG - Intronic
1112171525 13:96977365-96977387 GGCTACAGGACTGGGGGCCATGG + Intergenic
1113631944 13:111893964-111893986 GGCTCCAGGGCTGGGGTCCCCGG - Intergenic
1113933817 13:113982608-113982630 GGCTCCGGGAGTGCGTGCCCAGG - Intronic
1114681809 14:24491193-24491215 GGTTCCAATCCTGGGTGCCCTGG + Intergenic
1114747410 14:25164521-25164543 ACATACAGGACTGGGTGCCATGG - Intergenic
1119208417 14:72811889-72811911 CGCTCCAGGGCTGGGTGCCCTGG - Intronic
1119645618 14:76346410-76346432 TGAGCCAGGGATGGGTGCCCCGG - Intronic
1119941240 14:78643853-78643875 GGATCAAGGGCTGGGTGCAGTGG + Intronic
1120240809 14:81947616-81947638 GGCTCCAGGAATGGGAGCCAAGG + Intergenic
1121620433 14:95344047-95344069 GGATCCAGGGCCGGGTGCGGTGG + Intergenic
1123006949 14:105328332-105328354 GGACCCAGTAGTGGGTGACCTGG + Intronic
1123679141 15:22745187-22745209 GGCCCCAGGACTGGGGACCCCGG - Intergenic
1123991557 15:25687331-25687353 GGGAGCAGGACTGGGTGGCCTGG + Intronic
1124331360 15:28819637-28819659 GGCCCCAGGACTGGGGACCCCGG - Intergenic
1125548722 15:40528418-40528440 GGAGCCAGGACTGGGTCTCAAGG + Intergenic
1125722510 15:41852066-41852088 GGAGCCAGTGCTGGGAGCCCGGG - Intronic
1126392765 15:48177849-48177871 GGAGCCGGGGCTGGGGGCCCGGG - Intronic
1127816162 15:62610980-62611002 GGATGCAGGAGGGGGTGCCATGG - Intronic
1127846417 15:62875175-62875197 GGATACAGGACTGAGAGCTCAGG - Intergenic
1127961543 15:63894362-63894384 GGGTCCCGGCCTGGGCGCCCGGG - Intergenic
1128671138 15:69575571-69575593 GGATCTAGGGCTGCGTTCCCTGG + Intergenic
1128672569 15:69585598-69585620 GGAGCCTGGACTGGGAGTCCTGG + Intergenic
1129542270 15:76360093-76360115 GGATCCCTGAGTTGGTGCCCAGG - Intronic
1129984718 15:79908044-79908066 GGCACCAGGACCGGGTTCCCTGG + Intronic
1130335350 15:82952903-82952925 GCACCGAGGACTGGGTGGCCCGG - Intronic
1133060324 16:3170715-3170737 GGATCCAGGACTGAGTACTCTGG - Intergenic
1133063522 16:3190293-3190315 GGACTCAGGACGGGGTACCCGGG - Intergenic
1133285826 16:4690276-4690298 GGATCCAGCCCTGGGTCACCAGG - Exonic
1133411615 16:5573597-5573619 GGGTCCAGGACTGGGACCCAGGG - Intergenic
1134090713 16:11390348-11390370 GGCTGCAGGCCTGGGTGCCCGGG - Exonic
1135648676 16:24186584-24186606 AGATCTAGGACTGGCAGCCCTGG - Intronic
1136449920 16:30348072-30348094 GCATTCAGGCCTGGGTGCCATGG + Intergenic
1137636983 16:49995547-49995569 GAATCCAGGAATGGGTACCCTGG + Intergenic
1137669890 16:50272796-50272818 GGAGACAGGCCTGGGGGCCCAGG - Intronic
1137715330 16:50594977-50594999 GGGTCCAGGCATGGGGGCCCAGG - Intronic
1138272421 16:55704858-55704880 GGCTCCAAGCCTGGGTCCCCTGG + Intronic
1138952449 16:61929598-61929620 TGATACAAGACTGGGTGCACTGG + Intronic
1139526689 16:67521166-67521188 GAATCCAGGACTGGCCGCCAGGG + Intronic
1140380474 16:74482392-74482414 GGATCCAGCACTGGCTGCTTTGG + Intronic
1140478012 16:75248636-75248658 GGCTCAAGTCCTGGGTGCCCGGG + Intronic
1141281252 16:82631615-82631637 GGAGCCAGGCCTGGGATCCCAGG - Intronic
1141331468 16:83115390-83115412 GAATCCAGGACTAGGATCCCAGG + Intronic
1141507414 16:84486983-84487005 TGATCGAGGACTGGGTGTTCAGG - Exonic
1141554538 16:84828194-84828216 GGCTCCAGGGCTGGCAGCCCGGG - Intronic
1142176285 16:88646916-88646938 GGAAAGAGGCCTGGGTGCCCTGG - Intronic
1142233084 16:88908956-88908978 GGATCCAGAGCCAGGTGCCCAGG - Intronic
1143023866 17:3929868-3929890 GGGTCCAGGATTGGGTTCCAGGG - Intronic
1144788149 17:17843182-17843204 TGCTCAAGGCCTGGGTGCCCTGG + Intergenic
1145960192 17:28882704-28882726 GGATCAAGGGCTGGCTCCCCAGG + Intronic
1145998304 17:29117024-29117046 GTATGGAGGAATGGGTGCCCAGG - Intronic
1146123146 17:30212293-30212315 GGCCCCAGAACTGGGTGCCAAGG + Intronic
1146629279 17:34458420-34458442 GTGTCCAGGACTTGGTGGCCTGG + Intergenic
1147915242 17:43881828-43881850 GGATCCAGGATTAGGTGCCAGGG - Intronic
1148106224 17:45120447-45120469 GGATCCAGGTGTGGGTGCTCAGG + Exonic
1148115375 17:45172049-45172071 GGAGCCAGGCCTGGGTCCCTCGG + Intergenic
1149607829 17:57937140-57937162 GGAACCATGGCAGGGTGCCCAGG - Intronic
1150742983 17:67794628-67794650 TGATCCTGGGCTGGGTGCCATGG + Intergenic
1151541713 17:74768009-74768031 GGAACCAGGGGTGGGTGGCCAGG + Intronic
1152508056 17:80765610-80765632 GGATTCAAAGCTGGGTGCCCAGG + Intronic
1152711020 17:81870704-81870726 GGACCCCGGCCTGGGTGTCCCGG - Intronic
1155285851 18:24288478-24288500 GGAGGCAGGACTGGGTGCAGTGG + Intronic
1156468797 18:37364485-37364507 GGATCCAGCACTGGGGCTCCAGG + Intronic
1160678201 19:401499-401521 GTGACCAGGACTGGGTGCCACGG + Intergenic
1160819972 19:1053350-1053372 TGGTACAGCACTGGGTGCCCGGG + Exonic
1160981340 19:1817953-1817975 GGATCCAGGCCTGGGCGTCCTGG - Intronic
1160988966 19:1852872-1852894 GGATCCAGGGATGGGTGCCTGGG - Exonic
1161048519 19:2150182-2150204 GTGTCCAGGACGAGGTGCCCAGG - Intronic
1161190098 19:2949764-2949786 GGGGCCAGGACTGGGACCCCAGG + Intergenic
1161236317 19:3199985-3200007 GGAGGCAGGACTGGGTGCGGTGG - Intronic
1161709305 19:5838846-5838868 GGCTCCAGGACAGGATGCCCTGG - Exonic
1163859276 19:19732733-19732755 GGCTCCAGGACCGGGGGCCGAGG + Intronic
1165065474 19:33225839-33225861 GGGCCCGGGACTGGGGGCCCCGG + Exonic
1165993724 19:39830625-39830647 GGATCCTGGGCTGGGTGCCGAGG - Intronic
1166183013 19:41121976-41121998 GCCTCCTGGACTGGGTGCCTGGG + Exonic
1167875295 19:52407171-52407193 GCATTCTGGACTGGGTGCCCAGG - Intronic
1167884850 19:52492378-52492400 GGATGCGGGACTGAGTGCTCAGG - Intronic
1167914124 19:52726185-52726207 GGATGCGGGACTGGGTGCTCAGG + Intronic
1168319307 19:55499812-55499834 GAGTCCAGGCCTGGGGGCCCTGG - Exonic
925912372 2:8582303-8582325 GGCTCTGGGCCTGGGTGCCCAGG - Intergenic
925979871 2:9167904-9167926 ACATCCAGAGCTGGGTGCCCAGG + Intergenic
926036483 2:9639936-9639958 GGTTCCAGGACCTGGTGCCACGG - Intergenic
926128614 2:10286589-10286611 GGGGCCAGGGCTGTGTGCCCAGG - Intergenic
926144943 2:10391196-10391218 AAATCCAGGACTGGGCCCCCAGG - Intronic
926699010 2:15790341-15790363 GGATGCTGTACTTGGTGCCCAGG + Intergenic
929828123 2:45326054-45326076 TGTTGCAGGACTGGGTACCCAGG + Intergenic
929916904 2:46143889-46143911 GGATCCAGGCCTGAGTGCAAAGG - Intronic
931446683 2:62332724-62332746 GGATCCAGCCCTAGGTACCCGGG + Intergenic
932318251 2:70800860-70800882 GGTGCCAGGACTGGGATCCCAGG - Intergenic
932489834 2:72113654-72113676 TCTTCCAGGACTGGTTGCCCTGG - Intergenic
937037871 2:118796788-118796810 TGAGCCAGGAGTGGGTGCCTGGG - Intergenic
938290260 2:130145165-130145187 GCATCCAGGGCTGGGCGCCGGGG + Intergenic
938466270 2:131527780-131527802 GCATCCAGGGCTGGGCGCCGGGG - Intronic
946277783 2:218643934-218643956 CACTCCAGGACTGGGTGCCAAGG - Exonic
1169262790 20:4149855-4149877 GGAGCCAGCAGTAGGTGCCCTGG + Intronic
1172547638 20:35773733-35773755 GAATCCAGCGCTGGGGGCCCAGG - Intronic
1173058080 20:39635770-39635792 ACATCCAGGACCAGGTGCCCTGG - Intergenic
1173896246 20:46552907-46552929 GGATCCAGGCCAGGGTGGCCTGG - Intergenic
1174357161 20:50006036-50006058 GGCACCAAGACTGGGTGCCCAGG + Intergenic
1174555258 20:51390655-51390677 AGCTCCAGGGCTAGGTGCCCTGG + Exonic
1174602488 20:51736028-51736050 GGCTCCGGGAATGGGTGGCCAGG + Intronic
1175215759 20:57391187-57391209 GGATCCGGGCCTGGGGGCGCTGG - Intergenic
1175307971 20:57991022-57991044 GGAACAAGGACAGGCTGCCCTGG - Intergenic
1175381925 20:58569458-58569480 GGGTCTGGGACTGGGTACCCAGG - Intergenic
1179545632 21:42110982-42111004 GTACCCAGGACTGGGTGACAAGG - Exonic
1179829093 21:43984954-43984976 GGCTCAAGGACTGGGTGCAGAGG - Exonic
1180009544 21:45040504-45040526 GGGTCCAGGACAGGGGGCCAGGG - Intergenic
1180840586 22:18957161-18957183 AGATCGGGGCCTGGGTGCCCAGG - Intergenic
1180883803 22:19225323-19225345 GGATGCAGCACTGGCTGCCTTGG - Intronic
1181060902 22:20281613-20281635 AGATCAGGGCCTGGGTGCCCAGG + Intronic
1181515043 22:23405418-23405440 AGATCGGGGCCTGGGTGCCCGGG + Intergenic
1181689169 22:24548888-24548910 GGGGCCAGGGCTGGGGGCCCAGG - Intronic
1183121344 22:35732338-35732360 GGCACCAGGAGTGGGTGTCCAGG + Intergenic
1183357021 22:37365019-37365041 GGGTCCAGGACAGGCTGCCCAGG + Intergenic
1183357482 22:37367422-37367444 GGGCCCAGGACAGGCTGCCCAGG + Intergenic
1183472474 22:38016961-38016983 GGAGCCAGGCCGGGGTGCCGGGG + Intronic
1183548476 22:38467946-38467968 GGCTCCCGGACTGGGCGGCCCGG - Intergenic
1183828894 22:40407744-40407766 GGAACCAAAGCTGGGTGCCCTGG - Intronic
1184071601 22:42150641-42150663 GCATTGAGGACTGGGTGGCCAGG + Intergenic
1184611746 22:45608329-45608351 GGAACCAGGACAAGGTGACCAGG - Intergenic
1184956206 22:47888176-47888198 GGAACCAGGTCTGTGTGCCTGGG + Intergenic
950914822 3:16633763-16633785 GGGTCCAGGCCTGTGAGCCCAGG - Intronic
951711174 3:25585946-25585968 GGAGCCAGGACTGGGTGGGCAGG + Intronic
953574705 3:44103804-44103826 GAATCCAGCAGTGAGTGCCCAGG + Intergenic
954180695 3:48879249-48879271 GGCTTCAGGACTGGGTGCAGTGG - Intronic
954539069 3:51381908-51381930 GGGCCCAGGAGTGGGAGCCCAGG + Exonic
956995960 3:74826263-74826285 GGAACCTGGTCTGGGTGCCTTGG - Intergenic
958000154 3:87740107-87740129 GGAAACTGGTCTGGGTGCCCTGG + Intergenic
961013484 3:123450058-123450080 GGAGCTAGGACTGGGGGCGCTGG - Intergenic
961375194 3:126460541-126460563 GGTGCCAGGACTGTGTGCCTCGG - Intronic
961743169 3:129046541-129046563 AGCTCCAGGCCTGGGTGGCCGGG - Intergenic
961772149 3:129257907-129257929 GGAACTAGGCCTGGGTTCCCGGG + Intronic
962284772 3:134076509-134076531 GGCTCCAGGACCGGGCCCCCAGG + Intronic
963169009 3:142232350-142232372 GGATCCAGGAGAGGGAGTCCAGG - Intergenic
963268761 3:143265522-143265544 GGCTCCAGGCCTAGGTGCCCAGG - Exonic
966647199 3:182259779-182259801 GGCTCCAGCACAGGCTGCCCAGG - Intergenic
967361494 3:188636584-188636606 GGCTCCAGCTCTGGGGGCCCAGG + Intronic
968313242 3:197701204-197701226 GTATGAAGGACTGGGTGACCAGG + Intronic
968702219 4:2062503-2062525 GGCTCCAGGACAGGGGGCCGAGG + Intronic
969101964 4:4776140-4776162 GCATCCAGGAATGGCTGCACAGG - Intergenic
969570980 4:8008119-8008141 GGGACAAGGACTGGGTGTCCAGG + Exonic
971027272 4:22600603-22600625 GGAAACAGGTCTGGGTGCCTTGG - Intergenic
973322582 4:48825227-48825249 GGAGTCAGGACTGGGGCCCCAGG - Intronic
976470486 4:85422792-85422814 GGCACCAGGACTGGGTCTCCGGG - Intergenic
977507765 4:97923438-97923460 GGATCCAGCACTGGGGCCACAGG - Intronic
977777600 4:100939304-100939326 GGATCCAGGTCTTGGAGCCGTGG - Intergenic
979052436 4:115951741-115951763 GGAACCTGGTCTGGGTGCCTTGG - Intergenic
981446666 4:144847287-144847309 GGATCCTGGAATGGGTGCAATGG + Intergenic
982128922 4:152209363-152209385 GGATACATGATTGGGTGTCCAGG + Intergenic
982812724 4:159846503-159846525 GGTTAGAGGACTGGGAGCCCTGG - Intergenic
986064601 5:4223282-4223304 GTGTCCAGGCCTCGGTGCCCGGG + Intergenic
986468871 5:8053515-8053537 GCATCCAGGCCTGGGTCCCAGGG - Intergenic
986517523 5:8579864-8579886 GGATCCAGGAGTGGGAGCTATGG - Intergenic
990126811 5:52529101-52529123 AGATCCAGTGCTGGATGCCCAGG - Intergenic
991979521 5:72216676-72216698 GGATGCAAGGCTGGGTGCCAAGG + Intergenic
997235289 5:132268929-132268951 AAATACAGGACTGGGGGCCCAGG + Intronic
1002061321 5:176627621-176627643 GGAGCCAGAACTGGGTGTCTAGG + Intronic
1002434606 5:179222908-179222930 GGCAACAGGACTGGGTGCTCTGG - Intronic
1002542516 5:179915534-179915556 GGAACCAGGCCTGGAAGCCCAGG + Intronic
1003197687 6:3929600-3929622 GCAGTCAGCACTGGGTGCCCTGG - Intergenic
1006373694 6:33660063-33660085 GGATCCAGGACTGAGGGCAGAGG + Intronic
1006642497 6:35496507-35496529 GGGCCCGGGACTGGGCGCCCCGG + Intronic
1007703947 6:43780089-43780111 GGAGGCAGGGCTGGGTGTCCTGG - Intronic
1009486038 6:64223118-64223140 GGTTCCAGGACGGGGTGCACTGG - Intronic
1013975291 6:116070408-116070430 GATTCCAGGACTGGGATCCCAGG + Intergenic
1016852102 6:148630817-148630839 ATATCCAGGACTGGGTGCTGTGG - Intergenic
1017317881 6:153053382-153053404 GGATCCATTACTGGGTGTTCGGG + Intronic
1018960157 6:168441853-168441875 GGAACCAGGTCTGGGAGCGCCGG + Intronic
1019287523 7:231188-231210 GGAGACAGGAGTGGGTGCGCTGG + Intronic
1019496086 7:1341296-1341318 TGATCCAGGGCTGGGGGCACAGG - Intergenic
1019970506 7:4536810-4536832 GGAGCCAAGGCTGGGTGCCATGG + Intergenic
1020509794 7:9039845-9039867 GGAACCAGGACTGGAACCCCAGG + Intergenic
1020617455 7:10476977-10476999 GGACACAGGACTGGAAGCCCAGG - Intergenic
1021567453 7:22029057-22029079 GGATCCAGCACTGGGGCCGCAGG - Intergenic
1021922228 7:25496964-25496986 GGAGCCAGGGCTGGGAACCCAGG + Intergenic
1022118817 7:27286996-27287018 GTTTCCAGGGCTGGGTGCCGTGG - Intergenic
1026533537 7:71221133-71221155 GGCTCCAGGGCTGGGGTCCCAGG - Intronic
1026740457 7:72975709-72975731 GAAACCAGCACTGGGTGTCCAGG + Intergenic
1026797759 7:73377194-73377216 GGAACCAGCACTGGGTGTCCAGG + Intergenic
1026927961 7:74206894-74206916 GCGTCCAGGACTGGGGGCCAAGG + Intronic
1026977368 7:74506825-74506847 GGACCCACAACTGGGGGCCCTGG + Intronic
1027103274 7:75389361-75389383 GAAACCAGCACTGGGTGTCCAGG - Intergenic
1029693043 7:102195432-102195454 GGCTCCAGGCCTGGTGGCCCCGG + Intronic
1029724097 7:102390841-102390863 AGATCCAGAACTGGGCACCCAGG - Intronic
1029991556 7:104967176-104967198 GGATCCAGGATTGGGTGGGTGGG + Intergenic
1032083139 7:128869901-128869923 CGCTCCAGGCCTGGGGGCCCCGG + Intronic
1032384874 7:131514894-131514916 CCATCCAGGGCTGGGTGCCATGG - Intronic
1032467021 7:132152499-132152521 GGATCAAGCACTGGGGGACCTGG - Intronic
1033551023 7:142448100-142448122 GGAGTCAGGGCTGGGTGCCATGG - Intergenic
1034391542 7:150791460-150791482 GGAGCCAGGAGTGGGGGCCCTGG + Exonic
1034405957 7:150902580-150902602 GGCTCCAGGAGAGGGTGGCCTGG - Intergenic
1035158604 7:156934615-156934637 GGATCCCGCACTGGGAGGCCTGG + Intergenic
1035280111 7:157773040-157773062 GGATCCAGGCCTGGGTGAGAAGG + Intronic
1035282796 7:157787947-157787969 GGAGCCAGCACCGGGTCCCCTGG + Intronic
1035395367 7:158531415-158531437 AGATCCAGGCCTGCGAGCCCAGG + Intronic
1035438118 7:158874650-158874672 TTATCCAGGGCTGGGTCCCCAGG + Intronic
1035487466 7:159237189-159237211 TGATCCAGCACTGGGTGGCCTGG - Intergenic
1035684994 8:1517398-1517420 GGACCAAGCACTGGGCGCCCAGG - Intronic
1037985699 8:23289242-23289264 GGAACCAGGGCTGGGACCCCCGG + Intronic
1044250771 8:90001768-90001790 GGAGCGAGGACAGGGTGTCCCGG + Intronic
1044999938 8:97869894-97869916 GTCTCCAGGACTGGGGGCACAGG + Intronic
1047886382 8:129254431-129254453 GGATGCAGGACTTGGTGCCAGGG - Intergenic
1048926704 8:139278094-139278116 GCATCTATGACAGGGTGCCCGGG + Intergenic
1049063657 8:140296026-140296048 GGTTGCAGGACTCGATGCCCAGG - Intronic
1049306356 8:141906356-141906378 GGAGCCAGGACTGGAAGCCAGGG + Intergenic
1049362666 8:142219705-142219727 GGAGGCAGGACTGGATGCCCGGG + Intronic
1049708576 8:144053762-144053784 GGCTGCAGGTCTGGGAGCCCAGG - Intronic
1049733790 8:144192628-144192650 GGTGGCAGGAGTGGGTGCCCAGG + Intronic
1049764152 8:144345565-144345587 GGCTCCAGGACTGGGTGGCATGG + Intergenic
1049803756 8:144529878-144529900 GGCTCCAGGACAGTGGGCCCGGG - Exonic
1053393511 9:37752341-37752363 GGATCCAGCACTGGGGCCGCAGG - Intronic
1059029205 9:110672057-110672079 TCATCCAGGACTGTGTGTCCTGG - Intronic
1060593724 9:124835288-124835310 GGCTCCAGGTCTGGGTGTACGGG + Intergenic
1060724008 9:125995528-125995550 GGAGACAGTTCTGGGTGCCCCGG + Intergenic
1060759512 9:126235543-126235565 GGAACCCGGGCTGGGTCCCCAGG - Intergenic
1061391958 9:130321663-130321685 GCAGCCAGGACTGAGAGCCCGGG - Intronic
1061980701 9:134101917-134101939 GCAGCCAGGCCTCGGTGCCCGGG + Intergenic
1062156407 9:135051256-135051278 GGATCCAGGAGTGGGGACACGGG - Intergenic
1062245191 9:135562488-135562510 GGGTCCAGGACTGGGTGGGTTGG + Intronic
1062385763 9:136310930-136310952 GGGCACAGGGCTGGGTGCCCGGG - Intergenic
1062579056 9:137221626-137221648 GGCTCCAGGACAGGGCGCCCAGG + Intergenic
1187014222 X:15309678-15309700 AGATCCAGGGCTGGGTGCAGTGG + Intronic
1187364123 X:18652379-18652401 GGATCCAAGGCTGGGTGCAGTGG + Intronic
1187479906 X:19645901-19645923 GGATACAGGAATGGAGGCCCAGG + Intronic
1187500944 X:19838260-19838282 GGATCCCTGACTGTGTGTCCTGG - Intronic
1193653671 X:84171051-84171073 GGTTGCAGGACTGAGGGCCCTGG - Intronic
1195577450 X:106467623-106467645 GGACCCAGGAGTGGGAGCCGAGG - Intergenic
1199716776 X:150512335-150512357 GACTCAAGGACTGGGTGCCCAGG - Exonic
1200077103 X:153556657-153556679 GGACCCAGGATTGTGTCCCCAGG + Intronic