ID: 905166337

View in Genome Browser
Species Human (GRCh38)
Location 1:36085294-36085316
Sequence GATCCAGGACTGGGTGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905166330_905166337 -7 Left 905166330 1:36085278-36085300 CCCTGACACAGGCAGGGATCCAG 0: 1
1: 0
2: 1
3: 16
4: 237
Right 905166337 1:36085294-36085316 GATCCAGGACTGGGTGCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 148
905166331_905166337 -8 Left 905166331 1:36085279-36085301 CCTGACACAGGCAGGGATCCAGG 0: 1
1: 0
2: 3
3: 33
4: 281
Right 905166337 1:36085294-36085316 GATCCAGGACTGGGTGCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 148
905166326_905166337 5 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166337 1:36085294-36085316 GATCCAGGACTGGGTGCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905166337 Original CRISPR GATCCAGGACTGGGTGCCCG GGG Intronic
900517477 1:3089741-3089763 GATCCAGGACTTGCATCCCGAGG + Intronic
904034565 1:27551838-27551860 GAGACAGGACGGGCTGCCCGTGG + Exonic
905166337 1:36085294-36085316 GATCCAGGACTGGGTGCCCGGGG + Intronic
905225066 1:36473567-36473589 CATCCTGGACTGCGTGCCCAAGG - Exonic
905386259 1:37606279-37606301 GGGCCAAGACTGGGTGCCAGGGG + Intergenic
907313515 1:53553282-53553304 GAACCAAGACTGGGTGCACCTGG - Intronic
915091557 1:153429681-153429703 GGACCAGGACTGGGTGCCTGGGG + Intergenic
916053652 1:161052848-161052870 GATGAAGGATTGGGTGCCTGAGG - Intronic
918356468 1:183709895-183709917 GAACCAGGAATGGGTGCCAGAGG - Intronic
919778224 1:201207570-201207592 GCTCCAGGCCTGGGTGCTCAGGG + Exonic
922748872 1:228061580-228061602 GCTCCAGGCCTTGGTGCCAGTGG - Intergenic
922770121 1:228177116-228177138 CAGCCAGGAGTGGGTGCCTGTGG + Exonic
1063097042 10:2917580-2917602 GCTCCAGGCCTGGGTGACAGGGG + Intergenic
1068506865 10:57911661-57911683 GATCCAAGACTGGGTGTCAGGGG - Intergenic
1069551739 10:69368826-69368848 GCTCCAGGCCTGGGTGCTCCAGG - Intronic
1070794286 10:79207876-79207898 GATCCAGGACAGGTTGGCCCTGG - Intronic
1070818878 10:79343196-79343218 GATCCAGGACTGGCTGTGCATGG + Intergenic
1072944524 10:99798000-99798022 GATCCAGGACAGGGTGCGCATGG + Intronic
1074364388 10:112846186-112846208 GATTCAGGCCTTGGTGCCTGGGG - Intergenic
1075461635 10:122620428-122620450 GACCCAGGACTAGGTTCCCAGGG - Intronic
1075488570 10:122847385-122847407 GAGGCAGGACTGGGTGTCCTGGG + Intronic
1075536620 10:123276895-123276917 CATCCAGGTGTGGGTGCCCAGGG + Intergenic
1077020952 11:416973-416995 GATCCAGGCTTGGGCGACCGAGG + Intronic
1077186408 11:1237279-1237301 CATCCAGGACTGTGTGCCGTGGG - Intronic
1077416869 11:2428046-2428068 GAGTCAGGACAGGGTGCCAGTGG + Intergenic
1077497858 11:2895227-2895249 GCTCCAGGGCTGGCTGCCCCAGG + Intronic
1079098837 11:17528269-17528291 TATCCAGGGCTGGCTGCCCAGGG - Intronic
1080875501 11:36270944-36270966 GATTCAGGACAGAGTGCCTGGGG + Intergenic
1083488602 11:62998807-62998829 ACTCTGGGACTGGGTGCCCGGGG + Intronic
1083893460 11:65608321-65608343 CATCCAGGCGTAGGTGCCCGCGG + Exonic
1084589001 11:70079358-70079380 GAACCAGGCCTGGGCGCCCAGGG - Intronic
1092355887 12:7794851-7794873 GTTCCAGGATTGGGTGCACCAGG - Exonic
1092368482 12:7896836-7896858 GTTCCAGGATTGGGTGCACCAGG + Intergenic
1092368720 12:7898659-7898681 GTTCCAGGATTGGGTGCACCAGG - Intergenic
1097718445 12:62993944-62993966 CCTCCAAGACTGGGTGCCCCTGG + Intergenic
1101827410 12:108231254-108231276 GATCCAGGCCTGGAGGCCCCAGG - Intronic
1103392447 12:120584518-120584540 GGTCCAAGACTGGGAGGCCGCGG - Intergenic
1104892326 12:132146178-132146200 GATCCAGGAGTGGCTGCCTGGGG - Intronic
1114049710 14:18913164-18913186 GAGCCAGGGCTGGGTCCCCAAGG - Intergenic
1114112852 14:19488766-19488788 GAGCCAGGGCTGGGTCCCCAAGG + Intergenic
1118839665 14:69500980-69501002 GATCCAGGATGGGGTGGGCGGGG + Intronic
1119645617 14:76346409-76346431 GAGCCAGGGATGGGTGCCCCGGG - Intronic
1121148142 14:91604624-91604646 GTTCCAGGACTGGGTGCACCAGG + Intronic
1121774370 14:96580867-96580889 GATTCAGGGCTGGGTTCCAGAGG - Intergenic
1125032225 15:35084415-35084437 GTTCCAGGATTGGGTGCACCAGG + Intergenic
1126392764 15:48177848-48177870 GAGCCGGGGCTGGGGGCCCGGGG - Intronic
1126680086 15:51193741-51193763 GGTCCAGGAATGGATGCCTGAGG + Intergenic
1129908923 15:79209931-79209953 GTTCCCGCTCTGGGTGCCCGAGG + Intergenic
1131270950 15:90947388-90947410 AATCCAGGACTGAGTGCCCCAGG - Intronic
1131283652 15:91040220-91040242 CCTGCAGGACTGGGTGCCAGAGG - Intergenic
1135199313 16:20423159-20423181 GTCTCAGGACTGAGTGCCCGAGG + Intronic
1138952450 16:61929599-61929621 GATACAAGACTGGGTGCACTGGG + Intronic
1139526690 16:67521167-67521189 AATCCAGGACTGGCCGCCAGGGG + Intronic
1141507413 16:84486982-84487004 GATCGAGGACTGGGTGTTCAGGG - Exonic
1142068777 16:88077866-88077888 GATCCTGGGCTGGGTCCCCTTGG + Intronic
1142120439 16:88383970-88383992 GGACAAGGACTGGGTGGCCGCGG - Intergenic
1142304445 16:89277758-89277780 GATCCAGGAGCGGGCGCCCTCGG - Intronic
1143023865 17:3929867-3929889 GGTCCAGGATTGGGTTCCAGGGG - Intronic
1144788150 17:17843183-17843205 GCTCAAGGCCTGGGTGCCCTGGG + Intergenic
1147386720 17:40086908-40086930 GAGCCTGTACTGGGTGACCGGGG - Intronic
1147671640 17:42180167-42180189 GATCCCGGCCAGGGTTCCCGAGG + Intronic
1148769988 17:50061058-50061080 GATCCTGGGCTGGGAGCCAGAGG + Intronic
1151347803 17:73513961-73513983 GAGGGAGGTCTGGGTGCCCGGGG + Intronic
1151399730 17:73848284-73848306 GAGCCTGGACTGTGTGCCCCTGG - Intergenic
1151679490 17:75615987-75616009 GGCCCAGGACTGGGGACCCGAGG + Intergenic
1154215853 18:12415662-12415684 GACCCTGGACTGGCTGCCAGAGG - Intronic
1160819973 19:1053351-1053373 GGTACAGCACTGGGTGCCCGGGG + Exonic
1161709304 19:5838845-5838867 GCTCCAGGACAGGATGCCCTGGG - Exonic
1162757009 19:12866572-12866594 GAACCAGGACTGGGCTCCTGTGG + Intronic
1162846866 19:13399605-13399627 GATCCATCTCTGGGTGCCTGTGG - Intronic
1163442045 19:17327276-17327298 TATCCCGGGCTGGGTGGCCGAGG - Exonic
1165142066 19:33705603-33705625 GATGCGGGTGTGGGTGCCCGTGG + Intronic
1165993723 19:39830624-39830646 GATCCTGGGCTGGGTGCCGAGGG - Intronic
1167888734 19:52522880-52522902 CCTCCAGGACTGGATCCCCGGGG + Intergenic
1168189594 19:54727961-54727983 GATCTAGGACTGGAAGCCCCAGG + Intronic
1168204298 19:54837926-54837948 GATCCAGGACTTGGAGACCCAGG + Intronic
1168284278 19:55322660-55322682 GCTCCAGGACTGAGAGCCCCAGG - Exonic
925979872 2:9167905-9167927 CATCCAGAGCTGGGTGCCCAGGG + Intergenic
926157451 2:10464869-10464891 GACCCAGGCCTGGGTCCCAGCGG + Intergenic
927109605 2:19854973-19854995 GATGCAGGGCCGGGTGCCAGTGG - Intergenic
927993015 2:27461499-27461521 TCTCCAGGGCTGGGTGCCCCTGG + Exonic
931506821 2:62937712-62937734 GATCCAAGACTGGGTGGAGGTGG + Intronic
933758536 2:85659502-85659524 GACACAGGGCTGGGGGCCCGTGG + Intronic
934759197 2:96844217-96844239 GGTGCAGGAGTGGGTGTCCGAGG - Intronic
935149138 2:100417743-100417765 GATCCGGGCCTGGGGTCCCGCGG - Intergenic
937878802 2:126849855-126849877 GATCCACCACTGGGTCCCCCAGG + Intergenic
938116876 2:128608290-128608312 GCTCCTGGACTTGGTGCCCTCGG - Intergenic
938288519 2:130137392-130137414 GATCCAGGGCTGGGTCCCCAAGG + Intergenic
938306939 2:130262916-130262938 GAGCCAGGAGTGGGTACCCCAGG - Intergenic
938468012 2:131535542-131535564 GAGCCAGGGCTGGGTCCCCAAGG - Intergenic
946705287 2:222452612-222452634 GTTCCAGAACTGGGTGCACCAGG + Intronic
947701154 2:232235129-232235151 GAGCCAGGCCCGGCTGCCCGGGG + Intronic
1169213250 20:3779058-3779080 GAGCCTGGCCTGGGGGCCCGTGG - Intronic
1170429455 20:16263233-16263255 AGTCCAGGAATGGGTGCCCTAGG + Intergenic
1171034781 20:21706084-21706106 GACCCAGGACTGGGTCGCCCAGG - Intronic
1173016982 20:39234691-39234713 ATTCCAGGACTGGCTGCCTGAGG + Intergenic
1174357162 20:50006037-50006059 GCACCAAGACTGGGTGCCCAGGG + Intergenic
1177212569 21:18088416-18088438 GCTCTAGGTCTGGGTGCCCATGG + Intronic
1179480076 21:41671408-41671430 GTTCCAGGCCTGGGTGCCCCAGG - Intergenic
1179531048 21:42019931-42019953 GGTCCGGGGCTGGGTGCCCCCGG - Intergenic
1180009543 21:45040503-45040525 GGTCCAGGACAGGGGGCCAGGGG - Intergenic
1180468188 22:15635540-15635562 GAGCCAGGGCTGGGTCCCCAAGG - Intergenic
1181471221 22:23141432-23141454 GATTCAGGCCTGGGTGACCTTGG + Intronic
1183152117 22:36046081-36046103 GAGCCAGCACTGGGTGTCAGAGG - Intergenic
1183391448 22:37547513-37547535 GAGCCAGGACTGGGGCCCAGAGG - Intergenic
1183472475 22:38016962-38016984 GAGCCAGGCCGGGGTGCCGGGGG + Intronic
950535452 3:13575681-13575703 GAGGCAGGACTGGGGGCCAGGGG + Intronic
950825036 3:15809632-15809654 GATCCAGGACTTGGTGACAGTGG - Intronic
954370797 3:50168724-50168746 GATCCAGGAAGGGGTGGCCCCGG - Intronic
960936509 3:122907451-122907473 GATGCAGGAGTGGGTGCTCCAGG - Intergenic
961962035 3:130865116-130865138 GATGCAAGATTGGGTGCCCATGG - Intronic
969652778 4:8477766-8477788 GCTGCAGGACTGGGGGGCCGAGG - Intronic
969709031 4:8832097-8832119 GATGCAGGCCTGGGTGCAGGAGG - Intergenic
976470485 4:85422791-85422813 GCACCAGGACTGGGTCTCCGGGG - Intergenic
984481584 4:180310352-180310374 GAACCAGGACTGGAAGCCTGAGG - Intergenic
985472126 5:53138-53160 GATCCAGGACCGGGTCAGCGCGG - Intergenic
986064602 5:4223283-4223305 TGTCCAGGCCTCGGTGCCCGGGG + Intergenic
987516656 5:18918628-18918650 GCTCCAGGCTTGGATGCCCGTGG + Intergenic
987590443 5:19918938-19918960 GATTGAGGACTGGTTGCCAGAGG + Intronic
995693888 5:114858120-114858142 TGGCCAGGCCTGGGTGCCCGGGG - Intergenic
998060858 5:139117817-139117839 GTTCCAGGACTGAGTGACTGGGG + Intronic
1002762692 6:214270-214292 CATCCAGGAGTGTGTGCCTGAGG - Intergenic
1006521992 6:34576163-34576185 GATACAGGACTGGGCTCCGGGGG + Intergenic
1006924303 6:37646047-37646069 GAGCCAGGACTGGGGGCCAGCGG + Intronic
1007336249 6:41157146-41157168 GCTCCAGGACAGGGAGCCAGTGG + Intergenic
1007417399 6:41700000-41700022 GATGCAGGACAGGGTCCCGGAGG - Intronic
1009486037 6:64223117-64223139 GTTCCAGGACGGGGTGCACTGGG - Intronic
1013422582 6:109979502-109979524 GTTCCAGTACTTGGTGCCCTCGG + Exonic
1016532755 6:145076295-145076317 TGTCTAGGGCTGGGTGCCCGTGG + Intergenic
1019104991 6:169660449-169660471 GCTCCAGGGCTGAGTGCCCGAGG + Intronic
1019496085 7:1341295-1341317 GATCCAGGGCTGGGGGCACAGGG - Intergenic
1022312802 7:29212972-29212994 GTTCCAGGACTGGGTGCACCAGG - Intronic
1022522100 7:31015038-31015060 GATCCAGGGCTGGGTGGGTGGGG + Intergenic
1024272737 7:47655007-47655029 GAGCCAGGGCTGGGCGCCTGTGG - Intergenic
1024701296 7:51906902-51906924 GACCCAGGACTGGGGGGCTGTGG + Intergenic
1026797760 7:73377195-73377217 GAACCAGCACTGGGTGTCCAGGG + Intergenic
1029331107 7:99856327-99856349 AATGCAGGACTGGGTCCCCTAGG + Intronic
1029724096 7:102390840-102390862 GATCCAGAACTGGGCACCCAGGG - Intronic
1031978135 7:128106671-128106693 GGTCCAGGACAGGGTGGCTGAGG + Intergenic
1033513649 7:142085124-142085146 GATCCTGGAATGGGTTCCAGAGG + Intronic
1034391543 7:150791461-150791483 GAGCCAGGAGTGGGGGCCCTGGG + Exonic
1035395368 7:158531416-158531438 GATCCAGGCCTGCGAGCCCAGGG + Intronic
1037684254 8:21125017-21125039 GGTCCAGGACTGGGTCCACTTGG + Intergenic
1041163772 8:55071745-55071767 CATCCATGACTGGGTCCCCCTGG - Intergenic
1049397071 8:142405843-142405865 AATCAAGGACTGAGTGCCCGTGG - Intergenic
1049655516 8:143795291-143795313 GACCCTGCACTGGGGGCCCGAGG - Exonic
1049803755 8:144529877-144529899 GCTCCAGGACAGTGGGCCCGGGG - Exonic
1055906134 9:81295235-81295257 CTTCCAGGACTGGGTCCCCCTGG - Intergenic
1056870357 9:90271928-90271950 GATCCGGGACTGTGTGGCCTCGG + Intergenic
1058029053 9:100175753-100175775 GTTCCAGGTCTGGTTGCCCCAGG - Intronic
1058029062 9:100175812-100175834 GTTCCAGGATTGGGTGCACCAGG - Intronic
1059474421 9:114532901-114532923 GATATAGAACTGGGTGTCCGAGG + Intergenic
1060593725 9:124835289-124835311 GCTCCAGGTCTGGGTGTACGGGG + Intergenic
1061391957 9:130321662-130321684 CAGCCAGGACTGAGAGCCCGGGG - Intronic
1061980702 9:134101918-134101940 CAGCCAGGCCTCGGTGCCCGGGG + Intergenic
1062033797 9:134373784-134373806 GACTCTGGACTGGGTGCCCCTGG + Intronic
1062579057 9:137221627-137221649 GCTCCAGGACAGGGCGCCCAGGG + Intergenic
1187205395 X:17176708-17176730 GAGCCATGACTGGGTACCCTTGG - Intergenic
1189670910 X:43407880-43407902 GTTCCAGGACTGGGTGCACCAGG + Intergenic
1190745655 X:53320622-53320644 GACCCAGGGCTGGGTTCTCGTGG + Exonic
1191603252 X:63033240-63033262 GATCCAGGAATGGGTGTGTGAGG - Intergenic
1191805809 X:65133103-65133125 CCTCCAGGACTGCCTGCCCGAGG - Intergenic
1191873754 X:65772955-65772977 GTTCCAGGACTGGGTGCACCAGG + Intergenic
1194857910 X:98956722-98956744 GAGCCTGGAATGGGGGCCCGAGG + Intergenic
1196016334 X:110944369-110944391 GAGGCAGGGCTGGGTGCGCGGGG - Intronic
1199716775 X:150512334-150512356 ACTCAAGGACTGGGTGCCCAGGG - Exonic