ID: 905166338

View in Genome Browser
Species Human (GRCh38)
Location 1:36085295-36085317
Sequence ATCCAGGACTGGGTGCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905166326_905166338 6 Left 905166326 1:36085266-36085288 CCGAGATCGATGCCCTGACACAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 905166338 1:36085295-36085317 ATCCAGGACTGGGTGCCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 122
905166330_905166338 -6 Left 905166330 1:36085278-36085300 CCCTGACACAGGCAGGGATCCAG 0: 1
1: 0
2: 1
3: 16
4: 237
Right 905166338 1:36085295-36085317 ATCCAGGACTGGGTGCCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 122
905166331_905166338 -7 Left 905166331 1:36085279-36085301 CCTGACACAGGCAGGGATCCAGG 0: 1
1: 0
2: 3
3: 33
4: 281
Right 905166338 1:36085295-36085317 ATCCAGGACTGGGTGCCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905166338 Original CRISPR ATCCAGGACTGGGTGCCCGG GGG Intronic
901055377 1:6446660-6446682 ATCCCGGGCAGGGTGCCCTGGGG + Intronic
902281549 1:15378376-15378398 AGCCAGGACTGTGTCCCTGGAGG + Intronic
904306766 1:29594892-29594914 AGCCAGGACTGGAAGCCCTGTGG - Intergenic
905166338 1:36085295-36085317 ATCCAGGACTGGGTGCCCGGGGG + Intronic
905390491 1:37633239-37633261 ACCCAGGACTGGGTGTGGGGAGG + Intronic
906293755 1:44636547-44636569 CTCCAGCACTGGGGGCCCTGAGG + Intronic
908901887 1:68965020-68965042 TTCCAGGACTGGCTTCCAGGTGG - Intergenic
912373641 1:109192830-109192852 GTCCAGGCCTGTGTGCCCTGTGG + Exonic
915239199 1:154507787-154507809 AGCCAGGACTAGGTGCCAGGTGG - Intronic
915462080 1:156076379-156076401 TTCCAGGACAGGGTGACCAGAGG + Exonic
918356467 1:183709894-183709916 AACCAGGAATGGGTGCCAGAGGG - Intronic
919786181 1:201259931-201259953 TTCCAGGACTGGGAGGCTGGCGG + Intergenic
920025014 1:202987994-202988016 ATCCAGGTCTGGTTGACCTGTGG - Intergenic
922567417 1:226610048-226610070 ATTCAGTACTGGGTGCCATGGGG + Intergenic
1063087006 10:2828970-2828992 ATTCAGGACTGAGTTCCAGGTGG + Intergenic
1063097043 10:2917581-2917603 CTCCAGGCCTGGGTGACAGGGGG + Intergenic
1069876990 10:71569049-71569071 CTCCAGCCCTGGGTGCCTGGTGG + Intronic
1070328707 10:75403562-75403584 ATCCAGGTCCAGGTACCCGGTGG - Intergenic
1072944525 10:99798001-99798023 ATCCAGGACAGGGTGCGCATGGG + Intronic
1073403419 10:103277014-103277036 ATCCAGGAGTGGGGGCGGGGAGG - Intergenic
1075488571 10:122847386-122847408 AGGCAGGACTGGGTGTCCTGGGG + Intronic
1075601728 10:123774184-123774206 ATCCTGGTCAGGGTGGCCGGTGG + Intronic
1079975349 11:27084086-27084108 ACCCAGGAGTGGATGCCCAGAGG + Intronic
1080434355 11:32226075-32226097 GTCCAGGAGGGGGTGCCAGGGGG - Intergenic
1084329675 11:68423135-68423157 ATGCACAGCTGGGTGCCCGGCGG + Intronic
1084589000 11:70079357-70079379 AACCAGGCCTGGGCGCCCAGGGG - Intronic
1085033145 11:73284691-73284713 AGAGAGGACTGGGTGCACGGGGG - Intronic
1085803180 11:79610826-79610848 ATCCAGGAGTGGCTGCCATGCGG + Intergenic
1087014581 11:93543102-93543124 ACCCAGGCCTGGGCGCCCGGCGG - Intronic
1089351109 11:117822254-117822276 ATGTGGGAATGGGTGCCCGGTGG - Intronic
1090045524 11:123328854-123328876 CCCCAGGACTGGTTGACCGGTGG - Intergenic
1091280720 11:134380121-134380143 ATGCAGGGCTGGGTGCCTGTTGG + Intronic
1091337531 11:134783671-134783693 TCCCAGGACTGGGTGCCAAGAGG + Intergenic
1091393241 12:138691-138713 CTCCAGGCCTGGGGGCCCCGCGG - Exonic
1092909694 12:13135892-13135914 AGCGAGGCGTGGGTGCCCGGAGG - Intronic
1104793482 12:131499171-131499193 ACCCAGGCCTGGGTGCAAGGTGG - Intergenic
1104899651 12:132181964-132181986 CTCCAGGCCTGGGGGCCCCGGGG + Intergenic
1107891982 13:44921889-44921911 GTGCAGGACTGGGTTCCCAGGGG - Intergenic
1109142188 13:58727535-58727557 ACCCAGGAGTGAGGGCCCGGTGG - Intergenic
1111239324 13:85454555-85454577 TTCCAGTTCTGGGTGCCTGGTGG + Intergenic
1119532659 14:75373877-75373899 ATCCTGGACTGGCTGCCCAATGG + Intergenic
1120044289 14:79789314-79789336 TTGCAGGACTTGGTGCCTGGAGG + Intronic
1120398312 14:83996072-83996094 ATCCAACACTGGGTGCTGGGCGG + Intergenic
1121311818 14:92939459-92939481 ACCCAGGGCTGGGGGGCCGGTGG - Exonic
1121323868 14:93008506-93008528 ATCCAGGGCTGGCTGCCAGGAGG + Intronic
1122266685 14:100549963-100549985 TTCCAGGCCTGGGGGCCTGGGGG + Intronic
1122899816 14:104777800-104777822 TTCCAGGCCTGGGGGCCAGGAGG + Intronic
1127091589 15:55472322-55472344 ATAAAGGACTGGAGGCCCGGGGG + Intronic
1128658087 15:69477204-69477226 ACCAAGGGCTGGGTGCCCAGAGG - Intergenic
1129756529 15:78102430-78102452 ATCCAGGGGTAGGTGCCCAGAGG + Intronic
1130648780 15:85750564-85750586 ATCCTGGCCTGGGTCCGCGGTGG + Intergenic
1131108736 15:89751191-89751213 ATCCAGGACTCGGAGAGCGGCGG + Exonic
1131270949 15:90947387-90947409 ATCCAGGACTGAGTGCCCCAGGG - Intronic
1131465590 15:92652771-92652793 TTCCAGGACTCGGTGCCCGCAGG + Intronic
1131836106 15:96392697-96392719 AGCCAGGACTGGATCCCAGGTGG + Intergenic
1132793593 16:1706957-1706979 ATTCAGGGCTGGGGGCACGGAGG - Intronic
1139967538 16:70754127-70754149 AGACAGGACTGTGTGCCAGGAGG - Intronic
1140758817 16:78092635-78092657 ATCCACGACAGGCTGCCCTGAGG - Intergenic
1141713820 16:85715739-85715761 ATCCAGGACTGGCTGCGGAGGGG + Intronic
1142299808 16:89249979-89250001 AACCAGGAGTGGGTGCATGGGGG - Intergenic
1142324651 16:89406789-89406811 GTCCAGGACAGGGTGCCCTCCGG + Intronic
1143601484 17:7949021-7949043 ATCCAGTATTGGGTAACCGGGGG + Intronic
1146658406 17:34648837-34648859 ATCCAGGACTGGAGGACCAGTGG + Intergenic
1146678958 17:34793359-34793381 ATCCAGCACAGGGAGCCCGCCGG - Intergenic
1147386719 17:40086907-40086929 AGCCTGTACTGGGTGACCGGGGG - Intronic
1147758309 17:42782250-42782272 ATCCAGGACTAGGCGCCAGGAGG - Intronic
1149648102 17:58255004-58255026 AGCCAGGAGTGGGAGCCAGGTGG - Intronic
1149648186 17:58255610-58255632 AGCCAGGAGTGGGAGCCAGGCGG + Intronic
1157097305 18:44697570-44697592 TTGCAGGACTGGGTGCTTGGAGG - Intronic
1163711987 19:18852440-18852462 ATCCGGGCCTGGCAGCCCGGTGG + Intronic
1164669654 19:30065211-30065233 AACCAGGCCTTGGTGCCCCGGGG - Intergenic
1167299330 19:48670186-48670208 ATACAGGACTGGCTGCAGGGAGG + Intronic
1168687162 19:58355937-58355959 AGACAGGCCTGGGTGGCCGGTGG + Exonic
926271764 2:11372020-11372042 ATCCAGCAGTGGGTGCCCTGAGG - Intergenic
928270172 2:29848686-29848708 ATTCTGGAATGGGTGCCAGGAGG + Intronic
933811896 2:86037861-86037883 ATGCAGGAATGGAGGCCCGGGGG - Intronic
934988087 2:98901547-98901569 ATCCAGGATAAGGTGCCCTGTGG - Intronic
936163594 2:110102416-110102438 AGGCAGGACTGTGTGCCCTGAGG + Intronic
937012580 2:118575399-118575421 ACTCAGGACTGGGTGCTGGGTGG + Intergenic
937361252 2:121231589-121231611 CTCCTGGGCTGGGTGCCCGGTGG - Intronic
942529265 2:176891158-176891180 AGCCATTACTGGGTGCCCAGAGG - Intergenic
943725932 2:191251273-191251295 CTCCAGGACTGGATGCCCTGTGG - Intronic
947521578 2:230849952-230849974 ATCCAGGTCTGGGGGCCCCTCGG - Intergenic
947701155 2:232235130-232235152 AGCCAGGCCCGGCTGCCCGGGGG + Intronic
1171848472 20:30291811-30291833 CTCCCGGACGGGGTGCCGGGCGG + Intergenic
1172284572 20:33731893-33731915 TTCCAGGGCTGGGGGCTCGGCGG + Exonic
1172512012 20:35507396-35507418 ACACAGGGCTGGGTGCCCTGTGG - Intronic
1174357163 20:50006038-50006060 CACCAAGACTGGGTGCCCAGGGG + Intergenic
1175171065 20:57081915-57081937 ATCCAGTATTGGGCTCCCGGTGG - Intergenic
1179971945 21:44840963-44840985 ATCCAGGGCTGTGTGCCTTGGGG - Intergenic
1180715287 22:17867634-17867656 ACCCAGGACAGGGTGCTCTGGGG + Intronic
1182181793 22:28357170-28357192 ATCCTGGACTTGGAGCCAGGAGG - Intronic
1182767282 22:32766700-32766722 ATCCTAGACTGGGTACCTGGGGG - Intronic
1183472476 22:38016963-38016985 AGCCAGGCCGGGGTGCCGGGGGG + Intronic
1184567140 22:45298843-45298865 ATCCAGGTCTGGCGCCCCGGGGG + Intergenic
1184650971 22:45919342-45919364 AGCCAGGACTTGGTGGTCGGTGG - Intergenic
1185326032 22:50226352-50226374 ATCCACGACTGGGTGTACAGCGG - Exonic
949413094 3:3786960-3786982 AGCCAGGACTGGGTGCTGGTTGG - Intronic
950825035 3:15809631-15809653 ATCCAGGACTTGGTGACAGTGGG - Intronic
953788599 3:45929496-45929518 ATTCAGGGCTGGGGGCCTGGTGG + Intronic
968439718 4:617111-617133 TGCCATGACTGGGTCCCCGGAGG + Intergenic
969571457 4:8011125-8011147 ATTCAGGCCTGGGTCCCCAGAGG + Intronic
969660499 4:8524831-8524853 AGCCAGGAATGAGTGCACGGAGG - Intergenic
970852299 4:20616510-20616532 TTCCAGGAGTGTGTGCCTGGAGG + Intronic
976470484 4:85422790-85422812 CACCAGGACTGGGTCTCCGGGGG - Intergenic
981620865 4:146697185-146697207 ATCCAGGACTGGGTAGGAGGTGG + Intergenic
985858785 5:2452763-2452785 ATCCAGGTCTGTGTGACCCGTGG - Intergenic
985908794 5:2863364-2863386 ATCCAGGAATGTGGGCCCTGGGG + Intergenic
987948940 5:24651554-24651576 TTTCAGGGCTGGGTTCCCGGAGG + Intergenic
995693887 5:114858119-114858141 GGCCAGGCCTGGGTGCCCGGGGG - Intergenic
996575076 5:124970586-124970608 AAGCAGGACTGGGTGTCAGGAGG + Intergenic
997354428 5:133253318-133253340 AGCCAGGCCTGGGGGCCAGGTGG - Intronic
999216101 5:149936586-149936608 TTCCAGGACTGAGTACCCAGTGG - Intronic
1002443246 5:179275060-179275082 ATCAAGGGCACGGTGCCCGGTGG + Intronic
1006509157 6:34512422-34512444 ATCCAGGGCTGGGGGCCGGCAGG + Intronic
1006515608 6:34544124-34544146 AGCCTGGACTTGGTGCCCGGCGG - Exonic
1015024664 6:128519564-128519586 ATCGAGGTCTGGGCGCCTGGTGG - Intronic
1015790180 6:136957914-136957936 ACCCGGGACTGGGTGGTCGGGGG - Intergenic
1016875206 6:148857849-148857871 ATCCAGGTCTGGGTGGCTAGTGG + Intronic
1018190293 6:161304393-161304415 TTACAGGACTGGCTGCCAGGTGG + Intergenic
1018666277 6:166141240-166141262 ACCCAGGACTGGATGCCAGGTGG - Intergenic
1019104992 6:169660450-169660472 CTCCAGGGCTGAGTGCCCGAGGG + Intronic
1019224248 6:170497020-170497042 CTCCAGGACTGGGTCCTCAGTGG + Intergenic
1026896163 7:74011157-74011179 ATCCAGGACTGGCTGGTCGGTGG - Intergenic
1032623422 7:133561887-133561909 ATCCAGCTCTGGGTGGCGGGTGG - Intronic
1035395369 7:158531417-158531439 ATCCAGGCCTGCGAGCCCAGGGG + Intronic
1039553575 8:38460700-38460722 TTCCAGGAGTTGGTGCCAGGAGG - Intronic
1041044336 8:53877391-53877413 GCCCAGGACTAGCTGCCCGGCGG + Intronic
1047247887 8:123160567-123160589 AGCCAGGTCTGGGAGCCGGGAGG - Intergenic
1049397070 8:142405842-142405864 ATCAAGGACTGAGTGCCCGTGGG - Intergenic
1051774851 9:20622251-20622273 AGCCATGCCTGGGGGCCCGGAGG + Exonic
1059844047 9:118251218-118251240 ATCCAGGACTGGTTACGGGGAGG - Intergenic
1060409746 9:123392371-123392393 AGCCAGGACTTGGTCTCCGGAGG + Intronic
1061391956 9:130321661-130321683 AGCCAGGACTGAGAGCCCGGGGG - Intronic
1061626652 9:131844374-131844396 ATGCAGGACTCGGTGGCCAGAGG + Intergenic
1062598554 9:137309998-137310020 AACCAGGTCTGGGTCCCCCGTGG + Intronic
1187270605 X:17776334-17776356 GTCCAGGACAGGGTGCCCCTTGG + Intergenic
1187319902 X:18229391-18229413 GTCCAGGACAGGGTGCCCCTTGG - Intergenic
1200125103 X:153809772-153809794 AGCCAGGACAGGCTGCCCGGTGG + Intronic