ID: 905168789

View in Genome Browser
Species Human (GRCh38)
Location 1:36098374-36098396
Sequence CCGGGTTTCACGGGTCGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905168789_905168797 -2 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168797 1:36098395-36098417 GGCTCACCCTTGGGCCCAGTTGG 0: 1
1: 0
2: 3
3: 17
4: 195
905168789_905168807 15 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168807 1:36098412-36098434 AGTTGGTCCAGGGGGTCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 95
905168789_905168799 4 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168799 1:36098401-36098423 CCCTTGGGCCCAGTTGGTCCAGG 0: 1
1: 1
2: 1
3: 95
4: 981
905168789_905168806 14 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168789_905168801 5 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168801 1:36098402-36098424 CCTTGGGCCCAGTTGGTCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 170
905168789_905168809 22 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168809 1:36098419-36098441 CCAGGGGGTCCATGGGCCCCAGG 0: 1
1: 0
2: 1
3: 51
4: 407
905168789_905168802 6 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168802 1:36098403-36098425 CTTGGGCCCAGTTGGTCCAGGGG 0: 1
1: 1
2: 0
3: 18
4: 165
905168789_905168803 7 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168803 1:36098404-36098426 TTGGGCCCAGTTGGTCCAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905168789 Original CRISPR CCGGGTTTCACGGGTCGCCC TGG (reversed) Exonic
901292695 1:8136608-8136630 CAGGGTTTCACATGTTGCCCAGG - Intergenic
901360090 1:8690684-8690706 CCTAGTTTCACGGGTCACACAGG + Intronic
905168789 1:36098374-36098396 CCGGGTTTCACGGGTCGCCCTGG - Exonic
906038695 1:42769352-42769374 CAGGGTTTCACATGTCGCCCAGG - Intronic
908428899 1:64036560-64036582 CCTGGTTTCAAGGATCTCCCAGG - Intronic
908891535 1:68854347-68854369 CAGGGTTTCACCAGTTGCCCAGG + Intergenic
912879118 1:113390932-113390954 CCGGGCTGCGCGGGCCGCCCAGG + Intronic
915286046 1:154853013-154853035 CAGGGTTTCACATGTCACCCAGG + Intronic
918312516 1:183295191-183295213 ACGGGTTCCACGTGTCGGCCAGG + Intronic
919901658 1:202048306-202048328 CAGGGTTTCACCTGTCACCCAGG + Intergenic
920141469 1:203817938-203817960 CAGGGTTTCACGTGTTGGCCAGG + Intronic
1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG + Intergenic
1065170941 10:23028116-23028138 CAGGGTTTCACTTGTTGCCCAGG - Intronic
1065473903 10:26113277-26113299 CGGGGTTTCACTGTTTGCCCAGG - Intronic
1066348998 10:34619239-34619261 CGGGGTTTCACGTGTTGGCCAGG + Intronic
1069630506 10:69894549-69894571 CAGGGTCTGACGGGTCCCCCAGG + Exonic
1071241383 10:83709302-83709324 CATGGTTTCCCGGGTCACCCTGG + Intergenic
1071535761 10:86428260-86428282 CAGGGTTTCACAGGTTGGCCAGG - Intergenic
1072879878 10:99216218-99216240 CAGAGTTTCACTGGTTGCCCAGG + Intronic
1073123345 10:101134942-101134964 CGGGGTTTCGCGGGTCCCACTGG + Intronic
1075334404 10:121598106-121598128 CCGGGCTTCACGCGTACCCCAGG + Exonic
1077384780 11:2263677-2263699 CGGGGTCTCAGGGGTGGCCCAGG - Intergenic
1080629420 11:34060002-34060024 CGGGGTTTCACAGGTTGGCCAGG - Intronic
1081613666 11:44578252-44578274 CCTGGTTTGCTGGGTCGCCCAGG + Intronic
1083119770 11:60500044-60500066 CGGGGTTTCACGGGTTAGCCAGG - Intronic
1083458961 11:62798406-62798428 CGGAGTTTCACTCGTCGCCCAGG - Intronic
1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG + Intronic
1084620909 11:70270062-70270084 GCGGGTTTCCCGAGTCGCCCGGG + Intergenic
1085171814 11:74456122-74456144 CAGGGTTTCACATGTTGCCCAGG - Exonic
1085316203 11:75546567-75546589 CAGGGTTTCACCAGTTGCCCAGG - Intergenic
1087200023 11:95335820-95335842 CTGGGTCTCAGGGGACGCCCTGG - Intergenic
1091599786 12:1911212-1911234 CAGGGTTTCACGTGTTGGCCAGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1097097399 12:56560443-56560465 CAGGGTTTCACCTGTTGCCCAGG + Intronic
1098443519 12:70542692-70542714 CAGGGTTTCACGTGTTGGCCAGG - Intronic
1099468281 12:83014528-83014550 CAGGGTTTCACATGTTGCCCAGG + Intronic
1102724270 12:115045149-115045171 CGGAGTTTCACTTGTCGCCCAGG - Intergenic
1115231011 14:31160859-31160881 CAGGGTTTCACTAGTTGCCCAGG + Intronic
1115594664 14:34897755-34897777 CAGGGTTTCACCTGTCGCCCAGG - Intergenic
1116906403 14:50407941-50407963 CGGGGTTTCACGTGTTGGCCAGG + Intronic
1122020201 14:98831654-98831676 CCGGGTTTACCTGGTCGCCCAGG - Intergenic
1122702484 14:103599147-103599169 CGGAGTTTCACTCGTCGCCCAGG - Intronic
1125712072 15:41795137-41795159 CAGGGTTTCACTTGTCACCCAGG - Intronic
1126140990 15:45438537-45438559 CAGGGTTTCACATGTTGCCCAGG - Intronic
1132521352 16:391206-391228 CGGGGTTTCACTGGTTGGCCGGG + Intergenic
1132603619 16:784597-784619 CAGGGTTTCAGGGCTGGCCCCGG + Intergenic
1138127978 16:54454497-54454519 CGGGGTTTCACCTGTTGCCCAGG - Intergenic
1138254872 16:55547121-55547143 CGGAGTTTCACTCGTCGCCCAGG - Intronic
1138454980 16:57115971-57115993 CTGGGTCTCAGGGGTGGCCCTGG - Intronic
1139897215 16:70297236-70297258 CAGAGTTTCACTCGTCGCCCAGG + Intronic
1141022033 16:80506418-80506440 CAGGGTTTCACGTGTTTCCCAGG + Intergenic
1141727664 16:85800117-85800139 CCGGGTTTTGCGGGGCTCCCGGG + Intronic
1143643322 17:8212681-8212703 CGGGGTTTCACAGGTTGCCCAGG - Intergenic
1144895381 17:18527285-18527307 CGGAGTTTCACTCGTCGCCCAGG + Intergenic
1146318761 17:31830274-31830296 CGGAGTTTCACTCGTCGCCCAGG - Intergenic
1147207497 17:38848262-38848284 CAGAGTTTCACTGGTTGCCCAGG + Exonic
1149493438 17:57101366-57101388 CAGGGTTTCACATGTTGCCCAGG + Intronic
1150378521 17:64702040-64702062 TGGGGTTTCACTGGTTGCCCAGG - Intergenic
1150595714 17:66602721-66602743 TCAGGTTTCACGGGTGGCCTTGG + Intronic
1152012120 17:77725097-77725119 GCGGGTTTCAGGGGCCGCCCAGG + Intergenic
1152866843 17:82729231-82729253 CCGTGTTTGAGGGGTCACCCAGG + Intronic
1153911345 18:9708590-9708612 CCTGGTTCCCCGGGTCCCCCTGG + Intronic
1157831326 18:50859441-50859463 CAGGGTTTCACTGGTTGGCCAGG - Intergenic
1158466306 18:57693330-57693352 CCGGCTTGCAAGGTTCGCCCTGG + Intronic
1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG + Exonic
1160940244 19:1617495-1617517 CCGGGTTTTGGGGGTGGCCCAGG - Intronic
1161126719 19:2561968-2561990 TCCTGTTTCTCGGGTCGCCCCGG - Intronic
1162578854 19:11515480-11515502 CAGAGTTTCACTCGTCGCCCAGG + Intronic
1162765960 19:12919512-12919534 CTGGGTTCCACGGGGCGCCCAGG + Intergenic
1163030652 19:14541972-14541994 CCGGGTTTCACATGTTGGCCAGG + Intronic
1165051757 19:33146268-33146290 CGGAGTTTCACTCGTCGCCCAGG - Intronic
1165359255 19:35324732-35324754 CCGAGTTTCACTTGTTGCCCAGG - Intronic
1166731860 19:45063895-45063917 CCTGGTTTCCCGGGTCGCTGTGG + Intronic
928965931 2:36975376-36975398 CAGGGTTTCACGTGTTGCCCAGG - Intronic
929479668 2:42293132-42293154 CAGGGTCTCACGCGTCACCCAGG + Intronic
929974607 2:46620255-46620277 CAGGGTTTCACATGTTGCCCAGG - Intronic
930034276 2:47075850-47075872 AGGGGCTTCAGGGGTCGCCCTGG - Exonic
931465697 2:62484961-62484983 CAGGGTTTCACCTGTCACCCAGG + Intergenic
937575145 2:123411004-123411026 CAGGGTCTCACTTGTCGCCCAGG + Intergenic
938155261 2:128932316-128932338 CAGGGTTTCACGTGTTGGCCAGG + Intergenic
942398449 2:175576536-175576558 CAGGGTTTCACCTGTTGCCCAGG + Intergenic
946266597 2:218548532-218548554 CAGGGTTTCACATGTTGCCCAGG + Intronic
946883541 2:224200486-224200508 GCTGGTTTCACCGGTCACCCCGG + Intergenic
1168998490 20:2149645-2149667 CTGGGTTCCCCGGGTCTCCCTGG - Intronic
1174465303 20:50712685-50712707 CCGGGTCTCACTAGTTGCCCTGG - Intergenic
1175997337 20:62817597-62817619 CCGGGCTTCCCGGGCGGCCCTGG - Exonic
1178109010 21:29352243-29352265 CGGGGTTTCACGTGTTGGCCAGG + Intronic
1181272251 22:21665988-21666010 CCGGGTTCCGCGGCGCGCCCCGG - Exonic
1182871459 22:33651187-33651209 CCGGGTTTCACCGGTTAGCCAGG - Intronic
1183820963 22:40345819-40345841 CAGGGTTTCACGTGTTGCCCAGG + Intergenic
953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG + Intronic
954632537 3:52055277-52055299 CCGGGTCTCTCGGGACCCCCAGG - Intronic
961161604 3:124731178-124731200 CAGGGTCTCACTTGTCGCCCAGG - Intronic
966380468 3:179339449-179339471 CAGAGTTTCACTCGTCGCCCAGG - Intergenic
966848214 3:184146860-184146882 CAGAGTTTCACTTGTCGCCCAGG - Intronic
968341439 3:197959179-197959201 CGGAGTTTCACTCGTCGCCCAGG - Intronic
975176312 4:71293370-71293392 CTGGGTTTCACATGTTGCCCAGG - Intronic
976668338 4:87624390-87624412 CGGAGTTTCACGTGTTGCCCAGG + Intergenic
983019722 4:162660446-162660468 CAGGGTTTCACCTGTCACCCAGG + Intergenic
983570870 4:169206982-169207004 CAGGGTTTCACTCGTCACCCAGG + Intronic
984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG + Intergenic
985512072 5:318655-318677 CTGGGTTTCCCGGGTTCCCCGGG - Intronic
985617854 5:934966-934988 CAGGGTTTCACGTGTTGTCCAGG - Intergenic
989124355 5:38036908-38036930 CAGGGTTTCACCTGTTGCCCAGG - Intergenic
990305416 5:54489889-54489911 CGGGGTTTCACATGTTGCCCAGG - Intergenic
992434915 5:76746707-76746729 CAAGGTCTCACGGGTTGCCCAGG - Intergenic
993903078 5:93597210-93597232 CCCGGTTCCACGGCTCCCCCTGG - Intergenic
995917740 5:117269848-117269870 CGGGGTTTCACGTGTTGGCCAGG - Intergenic
999393296 5:151210350-151210372 CGGGGTTTCACAGGTTGGCCAGG - Intronic
1008658398 6:53640519-53640541 CAAGGTCTCACGGGTTGCCCAGG + Intergenic
1010414671 6:75600036-75600058 CGGAGTTTCACTTGTCGCCCAGG - Intergenic
1018768015 6:166949308-166949330 CAGGGTTTCACAGGTTGGCCAGG - Intronic
1019197276 6:170290031-170290053 CGGGGTCTCACGGGTAGCCGGGG - Intronic
1019289467 7:243243-243265 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289483 7:243297-243319 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289542 7:243512-243534 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289558 7:243566-243588 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289574 7:243620-243642 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289590 7:243674-243696 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019289606 7:243728-243750 CCGGGTGGCACAGGTCTCCCGGG - Intronic
1019358502 7:593277-593299 CCGGGTCTCCCGCGTCCCCCAGG + Intronic
1019442773 7:1055823-1055845 CCTGGCCTCACGGGGCGCCCAGG - Intronic
1021882034 7:25104481-25104503 CAGAGTTTCACTGGTTGCCCAGG + Intergenic
1026615484 7:71899167-71899189 CGGAGTTTCACTCGTCGCCCAGG + Intronic
1029462665 7:100705509-100705531 CCAGGCTTCACGGGTCCCCAAGG - Intergenic
1029551944 7:101241244-101241266 CGGAGTTTCACTCGTCGCCCAGG + Intronic
1030768608 7:113443449-113443471 CAGGGTTTCACTGGTTTCCCAGG - Intergenic
1032003056 7:128278100-128278122 CAGGGTTTCACGTGTTGGCCAGG - Intergenic
1033677873 7:143561635-143561657 CAGGGTTTCACATGTTGCCCAGG - Intergenic
1033693964 7:143767802-143767824 CAGGGTTTCACATGTTGCCCAGG + Intergenic
1035265608 7:157689047-157689069 CCGGGATTCACGGGTGGACGCGG - Intronic
1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG + Intergenic
1047392700 8:124466207-124466229 CGGAGTTTCACTGGTTGCCCAGG - Intergenic
1048849918 8:138635026-138635048 CCAGGTTTCATGGGGCCCCCAGG - Exonic
1049433837 8:142577258-142577280 CCGGGGTTCAGGGGCCGTCCTGG - Intergenic
1052913939 9:33909460-33909482 TGGGGTTTCACTCGTCGCCCAGG - Intronic
1053314299 9:37038145-37038167 CGGGGTTTCAGGCGGCGCCCGGG + Intergenic
1056067066 9:82947515-82947537 CTGGGTTTTATGGGTCTCCCTGG + Intergenic
1060661575 9:125408092-125408114 GCGGGACTCACGGGGCGCCCCGG + Intergenic
1061530267 9:131206335-131206357 CGGGGTTTCACATGTTGCCCAGG + Intronic
1062177769 9:135173699-135173721 CCGGGTCTCAGGGGTCCCACGGG + Intergenic
1062404104 9:136386458-136386480 CGGAGTTTCACTCGTCGCCCAGG + Intronic
1187862988 X:23699476-23699498 CAGGGTTTCACTTGTTGCCCAGG + Intergenic
1189385795 X:40535981-40536003 CAGGGTTTCACATGTTGCCCAGG - Intergenic
1190078837 X:47338998-47339020 CGGGGTTTCACGTGCTGCCCAGG + Intergenic
1190717671 X:53117639-53117661 CGGAGTTTCACTTGTCGCCCAGG + Intergenic
1190733606 X:53240798-53240820 CAGAGTTTCACTTGTCGCCCAGG + Intronic
1192125230 X:68495659-68495681 CAGGGTTTCACCTGTTGCCCAGG + Intergenic
1201289206 Y:12406481-12406503 CAGGGTCTCACTCGTCGCCCAGG - Intergenic
1201295023 Y:12454944-12454966 CAGGGTTTCACTTGTTGCCCGGG - Intergenic