ID: 905168789

View in Genome Browser
Species Human (GRCh38)
Location 1:36098374-36098396
Sequence CCGGGTTTCACGGGTCGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905168789_905168803 7 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168803 1:36098404-36098426 TTGGGCCCAGTTGGTCCAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 240
905168789_905168809 22 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168809 1:36098419-36098441 CCAGGGGGTCCATGGGCCCCAGG 0: 1
1: 0
2: 1
3: 51
4: 407
905168789_905168797 -2 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168797 1:36098395-36098417 GGCTCACCCTTGGGCCCAGTTGG 0: 1
1: 0
2: 3
3: 17
4: 195
905168789_905168799 4 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168799 1:36098401-36098423 CCCTTGGGCCCAGTTGGTCCAGG 0: 1
1: 1
2: 1
3: 95
4: 981
905168789_905168807 15 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168807 1:36098412-36098434 AGTTGGTCCAGGGGGTCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 95
905168789_905168802 6 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168802 1:36098403-36098425 CTTGGGCCCAGTTGGTCCAGGGG 0: 1
1: 1
2: 0
3: 18
4: 165
905168789_905168806 14 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168789_905168801 5 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168801 1:36098402-36098424 CCTTGGGCCCAGTTGGTCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905168789 Original CRISPR CCGGGTTTCACGGGTCGCCC TGG (reversed) Exonic