ID: 905168806

View in Genome Browser
Species Human (GRCh38)
Location 1:36098411-36098433
Sequence CAGTTGGTCCAGGGGGTCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 76, 4: 282}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905168796_905168806 -5 Left 905168796 1:36098393-36098415 CCGGCTCACCCTTGGGCCCAGTT 0: 1
1: 0
2: 0
3: 13
4: 170
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168788_905168806 17 Left 905168788 1:36098371-36098393 CCTCCAGGGCGACCCGTGAAACC 0: 1
1: 0
2: 1
3: 2
4: 49
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168784_905168806 28 Left 905168784 1:36098360-36098382 CCACCCCTGGTCCTCCAGGGCGA 0: 1
1: 0
2: 1
3: 22
4: 206
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168786_905168806 24 Left 905168786 1:36098364-36098386 CCCTGGTCCTCCAGGGCGACCCG 0: 1
1: 0
2: 0
3: 5
4: 117
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168792_905168806 4 Left 905168792 1:36098384-36098406 CCGTGAAACCCGGCTCACCCTTG 0: 1
1: 0
2: 2
3: 8
4: 112
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168789_905168806 14 Left 905168789 1:36098374-36098396 CCAGGGCGACCCGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168791_905168806 5 Left 905168791 1:36098383-36098405 CCCGTGAAACCCGGCTCACCCTT 0: 1
1: 0
2: 1
3: 8
4: 82
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168785_905168806 25 Left 905168785 1:36098363-36098385 CCCCTGGTCCTCCAGGGCGACCC 0: 1
1: 0
2: 0
3: 20
4: 192
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168787_905168806 23 Left 905168787 1:36098365-36098387 CCTGGTCCTCCAGGGCGACCCGT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282
905168795_905168806 -4 Left 905168795 1:36098392-36098414 CCCGGCTCACCCTTGGGCCCAGT 0: 1
1: 0
2: 2
3: 24
4: 258
Right 905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG 0: 1
1: 0
2: 2
3: 76
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905168806 Original CRISPR CAGTTGGTCCAGGGGGTCCA TGG Exonic
900580188 1:3404959-3404981 CATTTGGACCAGGGGGTGTAGGG - Intronic
900938846 1:5784800-5784822 CTGTGGGGCCAGGGGGACCAGGG - Intergenic
903938917 1:26915268-26915290 CAATTGGGCCAGTGGGTCCAGGG - Intronic
904282997 1:29434362-29434384 CAGCTGGTCCATGGGGACCTAGG + Intergenic
904509558 1:30992489-30992511 CACATGTTCCATGGGGTCCAAGG + Exonic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905169114 1:36099197-36099219 CAGGGGGTCCTGGGGGTCCCCGG + Exonic
905353905 1:37367599-37367621 CAGTGGGTCCAGTGAGTCCCTGG + Intergenic
906048324 1:42850332-42850354 CAGTAGGTCCTGGAGGTCCCAGG + Intronic
906057936 1:42930656-42930678 CAGCTGGTGCAGGGTGCCCAGGG + Exonic
906243430 1:44256711-44256733 CATTTGGTACTGGGGGTCCCAGG + Intronic
907780185 1:57559642-57559664 CAGTGGGTCCAGTGGGTCCCCGG + Intronic
909660974 1:78081581-78081603 CAGTTGGCCCTGGGTATCCATGG - Intronic
910127570 1:83860755-83860777 CAGGTGGTCCGGGGCGTCCCGGG + Intergenic
911860006 1:102934457-102934479 CTATTGGACCAGGAGGTCCAGGG + Exonic
911864918 1:103006279-103006301 CCGTTGGACCAGGGGGACCCTGG + Exonic
911883407 1:103269268-103269290 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
911980289 1:104558401-104558423 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
912130069 1:106589242-106589264 CAGTGGGTCCAGTGGGTTCCTGG - Intergenic
912733477 1:112130014-112130036 TAGTGGGTCCAGTGGGTCCCTGG - Intergenic
915526430 1:156479220-156479242 CAGTGGCCTCAGGGGGTCCAAGG - Intronic
916285153 1:163098321-163098343 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
916610817 1:166389726-166389748 CATTTGGTCAAGGGTTTCCATGG - Intergenic
917669303 1:177257284-177257306 CAGCTGGTGCAGGGTCTCCAGGG - Exonic
918755886 1:188338981-188339003 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
920077586 1:203348454-203348476 CACTTGGTCCAGCCGGACCATGG + Intronic
1063189889 10:3683539-3683561 CAGTGGGTGCAGGTGGGCCATGG + Intergenic
1064545861 10:16449327-16449349 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
1066656662 10:37703831-37703853 CAGGTGTGCCAGGGGGTCCTCGG + Intergenic
1067068672 10:43117454-43117476 CACCTGGTCCAAGGGGTCCTGGG + Intronic
1067125711 10:43513756-43513778 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1067960356 10:50840989-50841011 TAGTTGGATGAGGGGGTCCATGG - Intronic
1068447040 10:57137407-57137429 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
1069192471 10:65507558-65507580 CAGTGGGTCCAGTGAGTCCCTGG - Intergenic
1069632000 10:69902789-69902811 CACTTGGTCCAGGGGGGCCTGGG - Exonic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1071942952 10:90608966-90608988 CAGTGGGTCCGGTGGGTCCCTGG - Intergenic
1072569948 10:96649844-96649866 CAGTAGGTGGAGGGGGTCCGTGG - Intronic
1073081811 10:100865281-100865303 CTGTTTGTCCTGGGGGCCCAAGG + Intergenic
1073510380 10:104039102-104039124 CAGGTGATCCAGGTGTTCCAGGG - Exonic
1073557181 10:104464710-104464732 CAGTGGGTCCAGTGGGACCCCGG + Intergenic
1076042017 10:127258504-127258526 CACTTGGTCCAGGCGTACCATGG - Intronic
1076927573 10:133500415-133500437 CAGTGGGTCCAGTGGGTCTCTGG - Intergenic
1077338110 11:2014378-2014400 TGGTTGGTCCAGGGGTCCCATGG - Intergenic
1077912725 11:6587122-6587144 CAATTGGTCCATGGCGGCCATGG - Intronic
1078439498 11:11352208-11352230 CAGTTTGTCCAGGAAATCCAAGG + Exonic
1080453974 11:32401924-32401946 CAGTTGGTTCCAGGGGTCCTGGG + Intronic
1081608889 11:44546662-44546684 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1083213934 11:61206788-61206810 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083216818 11:61225617-61225639 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083219700 11:61244443-61244465 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1084586781 11:70066976-70066998 CAGTCTGTCCGGGGTGTCCAGGG + Intergenic
1084670599 11:70604428-70604450 CAGTGAGTCCAGGAGGGCCAGGG + Intronic
1086948249 11:92865745-92865767 CAGTTGAGCCTGGGGCTCCATGG + Intronic
1087291254 11:96322952-96322974 CAGATTCTCCAGGGGTTCCAAGG - Intronic
1088191830 11:107235706-107235728 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1088407771 11:109499867-109499889 CAGTAGGTCCAGTGGGTTCCTGG - Intergenic
1089688245 11:120170251-120170273 CAGAGGGTCCAGGGGCTCCCGGG - Exonic
1089729856 11:120512745-120512767 CAGCTGGGACAGGGGGTTCAAGG + Intronic
1090268183 11:125367937-125367959 CAGCTGGGCCTGGGGGTCGATGG - Exonic
1091256591 11:134192796-134192818 CAGCTGGTCCAGGAACTCCAGGG + Exonic
1202821094 11_KI270721v1_random:69560-69582 TGGTTGGTCCAGGGGTCCCATGG - Intergenic
1092381221 12:7998645-7998667 CAGTGAGTCCAGTGGGTCCCCGG + Intergenic
1094102370 12:26778048-26778070 CAGTGGGTCCAGTGAGTCCCAGG + Intronic
1095039089 12:37422462-37422484 CAGTTGTTCCACGGTTTCCAAGG - Intergenic
1095981552 12:47977346-47977368 CAGTTGGACCAGCGGGGCCAGGG + Exonic
1095981884 12:47978722-47978744 CAGAAGGACCAGGGGGACCAGGG + Exonic
1095981889 12:47978731-47978753 CAGGGGGACCAGGGGGTCCAGGG + Exonic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1097564809 12:61253648-61253670 CAGAGGGTCCAGTGGGTCCCCGG - Intergenic
1097843519 12:64343967-64343989 CAGTGGGTCCAGTGGGCCCCTGG - Intronic
1097934277 12:65227796-65227818 CAGTTCTTCCAGTGGGGCCAAGG + Intronic
1098749689 12:74278308-74278330 CGGTGGGTCCAGTGGGTCCCTGG + Intergenic
1098832064 12:75375237-75375259 CAGTGGGGCCAGTGGGTCCCTGG - Intronic
1099183957 12:79497879-79497901 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1100529435 12:95450294-95450316 GCGTTGCTGCAGGGGGTCCAGGG + Intergenic
1103035448 12:117652842-117652864 CAGTGGGTCCAGTGGGTCTCCGG + Intronic
1103396360 12:120610232-120610254 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1103910565 12:124349826-124349848 CACTCGGTCCAGGGGCACCAGGG + Intronic
1103942502 12:124508655-124508677 CACGTGGGGCAGGGGGTCCACGG + Intronic
1107655197 13:42585727-42585749 CAGTCTGGCCAGGGGGTCTATGG - Intronic
1107983740 13:45757173-45757195 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1107988193 13:45794008-45794030 CAGTGGGTCCAGGTGTTCCTTGG - Intronic
1108149806 13:47521513-47521535 GGGTTGGTCCAGGGGGTCCTCGG + Intergenic
1109293070 13:60498929-60498951 CAGTGGGTCCAGTGGGTACGCGG + Intronic
1113455664 13:110446812-110446834 CAGGTAGTCCAGGGGGCCCTGGG - Exonic
1113456173 13:110450423-110450445 CAGGTGGTCCAGGGAGCCCGGGG - Exonic
1113456177 13:110450432-110450454 CATCAGGTCCAGGTGGTCCAGGG - Exonic
1113461408 13:110484918-110484940 GAGGTGGTCCTGGGGGCCCAGGG - Exonic
1114758418 14:25285074-25285096 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1115130541 14:30048053-30048075 CAGTGGATCCAGTGGGTCCTTGG + Intronic
1116058745 14:39895727-39895749 CAGTGGGTCCAGTGTGTCCTTGG + Intergenic
1116067925 14:40007966-40007988 CAGTGGGTCCATTGGGTCCCCGG + Intergenic
1117596432 14:57331091-57331113 CAGTGGGTCCAGTGGGTCCTGGG - Intergenic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1119000231 14:70875147-70875169 CAGTTGATCCATGGAGTGCAGGG + Intergenic
1119059855 14:71463351-71463373 CAGTGGGTACAGTGGGTCCCCGG - Intronic
1119379634 14:74220218-74220240 TGGTTGGTCCAGACGGTCCACGG + Intergenic
1120973503 14:90229254-90229276 CAGTGGGTCCAGTGTGTCCCTGG + Intergenic
1121371220 14:93360084-93360106 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1121434808 14:93912102-93912124 CAGTTGCACCAGGGACTCCAAGG + Intergenic
1122262465 14:100531182-100531204 CAGTGTGTCCAGGGGGTCACTGG + Intergenic
1122285659 14:100650796-100650818 CAGTAGGCCCAGTTGGTCCATGG - Intergenic
1124689057 15:31806598-31806620 CTGCTGGTCCTGGGGGTCAAAGG + Intronic
1125483704 15:40097982-40098004 CAGTGGGCCCACTGGGTCCAAGG - Intronic
1125782167 15:42279373-42279395 CAGGTGGGCCAGGGGGAACAGGG + Intronic
1127356743 15:58207978-58208000 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1128127752 15:65205409-65205431 CACTTGCTCCAGGGAGACCATGG + Exonic
1131510516 15:93047362-93047384 CCCTTGGTCCAGGGGGACCAAGG - Intronic
1131850915 15:96542410-96542432 CATTCGGTCCAGTGGCTCCATGG + Intergenic
1132090817 15:98946750-98946772 CAGTTGGGCCGGGAGGGCCAGGG + Intronic
1132321155 15:100926559-100926581 CAGTGGGTCCAGGTGGTGCCAGG - Intronic
1132953495 16:2578324-2578346 CAGATGGTACAGGGGCTGCAGGG + Intronic
1132960857 16:2621843-2621865 CAGATGGTACAGGGGCTGCAGGG - Intergenic
1133043175 16:3071566-3071588 CACTTGAACCAGGGAGTCCAAGG + Intronic
1133301883 16:4787634-4787656 CAGGGGGTCCATGGGGGCCAAGG + Exonic
1135237762 16:20774720-20774742 CAGTGGCTCCAGTGGGTCCCAGG + Intronic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1138319068 16:56095419-56095441 CAGTGGGTCCAGTAGGTCCTTGG - Intergenic
1138868226 16:60849579-60849601 CAGCAGGTCCAGTGGGTCCCTGG + Intergenic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1142110626 16:88329216-88329238 CAGGTGGTGAAGGGGCTCCAGGG + Intergenic
1142121808 16:88390226-88390248 CAGTGGGCCCAGCGGGTCCTGGG + Intergenic
1142154257 16:88526050-88526072 CAGTGAGGCCAGGGGGGCCAGGG + Intronic
1142399733 16:89852571-89852593 AAGATGGGCCAGGGGATCCAGGG - Intronic
1143291153 17:5830170-5830192 AAGCTGCTCCAGGTGGTCCAGGG - Intronic
1143374689 17:6460326-6460348 CAGTTTGTCCAGGGAGGGCAGGG - Intronic
1144220905 17:13099133-13099155 AAGTTGTTCCTGGGGGTCCAGGG + Intergenic
1146100168 17:29973102-29973124 TAGTTGGTCCTGGTGGACCAAGG - Intronic
1146850775 17:36219823-36219845 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
1148224001 17:45885525-45885547 CAGTGAGTCCACTGGGTCCACGG - Intergenic
1148663863 17:49360887-49360909 CAGGTGTTCCTGAGGGTCCACGG + Intronic
1148794209 17:50189412-50189434 CAGCAGGGCCAGGGGGACCAGGG + Exonic
1148795266 17:50193996-50194018 CAGGTGGGCCTGGGGGTCCGGGG + Exonic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1148796213 17:50198160-50198182 CAGGTGCACCAGGGGGGCCAGGG + Exonic
1149236158 17:54593443-54593465 CACTGGGTCCAGTGGGTCCCTGG - Intergenic
1150222800 17:63506745-63506767 CAGTTGGACCAGGAGGTGGATGG + Intronic
1152920509 17:83064275-83064297 CAGATGGTGCAGGGGCTGCAGGG - Intergenic
1152987768 18:335168-335190 CAGTTGGGCCAGGGGGTCCCTGG + Exonic
1153131440 18:1858930-1858952 CAGTGCGTCCAGTGGGTCCCTGG - Intergenic
1153217855 18:2836820-2836842 CAGTGGGTTCAGTGGGTCCCTGG - Intergenic
1153281500 18:3418640-3418662 CAGTTGGCCCTGGGTTTCCATGG - Intronic
1155741917 18:29299203-29299225 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156537627 18:37879319-37879341 CAGTGGGTCTAGTGGGTCCCTGG + Intergenic
1156864061 18:41869092-41869114 CAGTTCTTCCAGGGGATTCAGGG - Intergenic
1157871136 18:51231129-51231151 CAGTGGGTCCAGTGCGTCCCTGG - Intergenic
1160092296 18:75838810-75838832 CAGTGGGTCCAGTGGGTTCCTGG + Intergenic
1160235476 18:77082687-77082709 CAGCTGGACCAGGTGGTCTAGGG + Intronic
1161162007 19:2767039-2767061 CAGCTGGTCCCTGGGGCCCAGGG - Intronic
1161484141 19:4525651-4525673 CAGCTGGGCCAGGGTGTCCTGGG + Exonic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1163643252 19:18473807-18473829 CAGTGGGGCCAGGTGGTGCAGGG - Intronic
1164855772 19:31519564-31519586 CAGATGTTCCAGGAGGTCCTTGG + Intergenic
1165349185 19:35267298-35267320 GAGGTCGTCCAGGGCGTCCACGG - Exonic
1165418230 19:35708298-35708320 CATTTGGTCCAGGAAATCCAGGG + Intronic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1165707612 19:37987662-37987684 CAGCTGGCCTAGGGGGTCCCAGG - Intronic
1165734027 19:38164567-38164589 CTCTGGCTCCAGGGGGTCCAGGG - Exonic
1166105789 19:40597422-40597444 CTGGTGGTCCAGGAGGACCACGG + Intronic
1168166557 19:54552227-54552249 CAGGATGTCCAGGGGGTCCCTGG - Intergenic
925223544 2:2162281-2162303 CAGGTGGTGCCTGGGGTCCACGG + Intronic
925460558 2:4059239-4059261 CAGTGGGTCCAGTGGGTGCCTGG + Intergenic
927718404 2:25367514-25367536 CAGCTGCTCCAGGGCGGCCATGG - Intergenic
930993341 2:57686007-57686029 CTGTTGGTACAGTGGGTCAAGGG - Intergenic
935183770 2:100713561-100713583 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
935564481 2:104591473-104591495 CAGTGGGTCCAGTGTGTCCCTGG - Intergenic
936641080 2:114313486-114313508 TAGTGGGTCCAGTGGGTCCCTGG + Intergenic
936699620 2:114995204-114995226 CATTTGGTCCAGGATGGCCACGG - Intronic
937060043 2:118974373-118974395 CAGGTGGTCCCGGCGGGCCAGGG - Exonic
937800178 2:126073534-126073556 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
937875613 2:126823218-126823240 GAGGAGGTCCATGGGGTCCAGGG - Intergenic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
939068911 2:137516643-137516665 CAGTGGCTCCAGTGGGTCCACGG + Intronic
940171479 2:150833932-150833954 CAGTGGGTCCAGTGGGCCCTTGG - Intergenic
940606079 2:155925566-155925588 CAGTGGATCCAGTGGGTCCCTGG - Intergenic
941330832 2:164175783-164175805 CAGTGGGTCCAGTGGGTTCAGGG - Intergenic
941653995 2:168123981-168124003 CAGTGGATCCAGTGGGGCCAAGG + Intronic
943387986 2:187225924-187225946 CAGTGGATCCAGTGGGTTCATGG + Intergenic
943524103 2:188995060-188995082 CATTTGGTCCAGCAGGTCCTCGG - Exonic
943730404 2:191297301-191297323 CAGTTGCTGCAAGGGGCCCACGG + Intronic
943956659 2:194200467-194200489 CAGTTGATCCATGGAGTCCAGGG - Intergenic
945544718 2:211136968-211136990 CAGTAGGTCCAGTGGGTCCCTGG + Intergenic
946104688 2:217358808-217358830 CAGGTGATTCAGGGGGTCCATGG + Intronic
947072591 2:226307450-226307472 CAGTTGCTCCAGGAGACCCAGGG - Intergenic
947954016 2:234171839-234171861 CAGCAGGAGCAGGGGGTCCACGG + Intergenic
947971568 2:234329244-234329266 CTGTTGTTGCAGGGGGTCCCGGG - Intergenic
948354297 2:237365664-237365686 CAGTTGGTTCAGGTGCTCCCTGG - Intronic
948529774 2:238597047-238597069 GAGCTGGTCCAGGGGGTCCCCGG + Intergenic
1168780725 20:487488-487510 CAGTTTGTCCAGGAAATCCAAGG + Exonic
1170965337 20:21063636-21063658 CAGTTGGCCAAGGTCGTCCAGGG + Intergenic
1172203072 20:33140427-33140449 CAGGTGGACCAGAGGGGCCAGGG - Intergenic
1172518869 20:35554597-35554619 CAGTTGGTACAGGGTCCCCATGG + Intronic
1172885634 20:38229034-38229056 CAGTGGGTACAGGGTGGCCAGGG + Intronic
1173193860 20:40897517-40897539 CAGGTGGTCCTGGGGGTTCAGGG - Intergenic
1173613111 20:44385332-44385354 CACTTGGGCCAGGTGCTCCATGG + Intronic
1174193645 20:48757742-48757764 GAGCTGGTCCAGGGGCTACACGG - Intronic
1176055605 20:63145333-63145355 CAGTTGGCCCCTGGGGGCCATGG - Intergenic
1177505734 21:22015423-22015445 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1177933853 21:27318141-27318163 CAGTGGGTGCAGTGGGTCCCTGG - Intergenic
1179415322 21:41193733-41193755 CAGTGGGTCCAGTGGGTCCTCGG - Intronic
1180085267 21:45505386-45505408 CAGGGGGCCCAGGGGGCCCAGGG - Exonic
1184504573 22:44893104-44893126 GAGGTGGTCCAGGGAGGCCAGGG + Intronic
1184603727 22:45559603-45559625 CAGTGGGTCCAGTGGGTCCCCGG - Intronic
949445452 3:4129838-4129860 CACTGGGTCCAGTGGGTCCCTGG + Intronic
950182865 3:10927334-10927356 CAGTTGGGCCTGGGGGCCCGAGG + Intronic
950441796 3:13014872-13014894 CAGTGGGTCAAGGGGCTCCTGGG + Intronic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
951970918 3:28443077-28443099 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
954053961 3:48006458-48006480 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
954134297 3:48575072-48575094 CAGGGGGTCCGGGGGGCCCAGGG + Exonic
954136375 3:48583935-48583957 CACCTGGTCCAGGGGGACCCTGG + Exonic
955575969 3:60363749-60363771 CAGGGGGGCCAGGGGGGCCAGGG - Intronic
956403273 3:68902449-68902471 CACTTGGTCCTGGGAGTTCAAGG - Intronic
957247687 3:77734537-77734559 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
957298625 3:78362825-78362847 CAGTGAGTCCAGTGGGTCCCTGG - Intergenic
957634290 3:82760922-82760944 CAGTGGGTCCAGTTGGTCCCTGG + Intergenic
961068749 3:123900308-123900330 CAGTTTTTCCAGTGGGTACATGG - Intronic
961380388 3:126492802-126492824 CAGATGGCTCAGGGGCTCCAAGG - Intronic
962853168 3:139323170-139323192 CAGGAGGGCCTGGGGGTCCAGGG - Intronic
963355824 3:144208051-144208073 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
963566749 3:146939764-146939786 CAGTGGGTCCAGTTGGTCCCTGG + Intergenic
963630157 3:147722016-147722038 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
963661230 3:148130929-148130951 CAGTGAGTCCAGTGGGTCCCTGG + Intergenic
964743493 3:159990185-159990207 GAGGTGGTCCAGGAGGACCAGGG - Exonic
964977363 3:162636991-162637013 CAGTAGGTCCAGTGGATCCCTGG - Intergenic
965519086 3:169655118-169655140 CATTTGGGCAAGGGGGTTCAGGG - Intronic
967990583 3:195127329-195127351 CAGTTCCTCCAGGGGTGCCATGG + Intronic
968084979 3:195870166-195870188 CAGGAGGTCGGGGGGGTCCATGG + Exonic
968551082 4:1223623-1223645 CAGCTGGGCCAAGGTGTCCAGGG + Intronic
968906769 4:3456751-3456773 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
970089341 4:12387558-12387580 CAGTGGGCCCAGTGGGTCCCTGG - Intergenic
971101181 4:23467636-23467658 CAGTGGGTCCAGTGGGTCCGCGG - Intergenic
971118880 4:23681537-23681559 CAGTGTGTCCAGTGGGTCCAAGG - Intergenic
971979445 4:33734071-33734093 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
972805734 4:42528136-42528158 CAGTGGGTCCAGTGGGTCTCCGG + Intronic
976034344 4:80796973-80796995 CAGTAGGTCCAGTGGGTCCCTGG - Intronic
976226803 4:82800539-82800561 CAGTGGGCACAGGGGATCCAAGG + Intergenic
977219003 4:94316725-94316747 CAGATGATGCAGGTGGTCCATGG - Intronic
977430604 4:96927012-96927034 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
977465836 4:97382178-97382200 CAGTGGGTCCAGTGGGTCCCCGG + Intronic
977490241 4:97701280-97701302 CAGTGGGTCCAGTGGGTCCCTGG - Intronic
977701903 4:100031104-100031126 CAGTGGGTCCATTGGGTCCCTGG - Intergenic
978341749 4:107726790-107726812 TAGTGGGTCCAGTGGGTCCCTGG - Intergenic
978400277 4:108323678-108323700 CAGTGGCTCCACTGGGTCCACGG + Intergenic
979766856 4:124473377-124473399 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
980388080 4:132112321-132112343 CAGTGGGTCCAGTGGGTCTCTGG - Intergenic
980602005 4:135038263-135038285 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
980957569 4:139444716-139444738 CAGTGTGTCCAGTGGGTCCCTGG + Intergenic
983184898 4:164690359-164690381 CAGTGGGTCCAGTGTGTCCCTGG + Intergenic
985723676 5:1504346-1504368 CACCTGGTCCCGGGGCTCCAGGG + Intronic
986037197 5:3951649-3951671 CAGTAGGTCCAATGGGTCCCTGG - Intergenic
986261749 5:6153442-6153464 CAGTGGGTCCAGAGGGTCCCTGG - Intergenic
986742754 5:10718287-10718309 CAGTGGGTCCAGCGGGTCCCTGG + Intronic
987578501 5:19759529-19759551 CAGTGGGCCCAGTGGGTCCCTGG - Intronic
988188625 5:27900017-27900039 CAGTGGGTCCAGTGGTTCCCTGG + Intergenic
988233437 5:28508288-28508310 CAGTAGGTTCAGTGGGTCCCTGG - Intergenic
989045379 5:37268809-37268831 CAGTGGGTCCAGTGGGCCCCTGG - Intergenic
989097670 5:37796122-37796144 CAGCGGGTCCAGTGGGTCCCTGG + Intergenic
989307644 5:39975772-39975794 CAGTGGGTCCAGTGGATCCCTGG - Intergenic
989457804 5:41662982-41663004 TAGTGGGTCCAGTGGGTCCCTGG - Intergenic
990118110 5:52414238-52414260 CAGTGGGTCAAGGGAATCCACGG - Intergenic
990996455 5:61736876-61736898 CAGTTGTGCCAGGGTCTCCATGG - Intronic
991013976 5:61912119-61912141 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
991300135 5:65121789-65121811 CAGTGGGTCCACTGGGGCCATGG + Intergenic
992242713 5:74788227-74788249 CAGTCGGTCCAGTGGGTCCCCGG + Intronic
992929363 5:81626637-81626659 GAGTTGGTGCATGGGGTCAAAGG - Intronic
993412729 5:87593024-87593046 CAGTGGGTCCAGCAGGTCCCTGG - Intergenic
993925968 5:93866664-93866686 CAGTTGGTCCTGTGGAACCATGG - Intronic
996908851 5:128633237-128633259 CAGTGAGTCCAGTGGGTCCCCGG - Intronic
998290489 5:140909762-140909784 GAGTGGGTCCAGTGGGTCCCTGG - Intronic
999321772 5:150619660-150619682 CAGTAGATCCCGGGGGTGCAGGG + Intronic
999351227 5:150873641-150873663 CAGTGGGTCCAGTGGGTCCCTGG + Intronic
1000416812 5:160992689-160992711 CAGTGGGTCCAGTAGGTCCCTGG + Intergenic
1002175285 5:177398120-177398142 GAGGTGGTCCAGGGGCTTCAGGG - Exonic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002786153 6:401967-401989 CAGATGGTCCAGGTGGACCATGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1003696064 6:8407355-8407377 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1006298227 6:33179457-33179479 CCATGGGGCCAGGGGGTCCACGG + Exonic
1007336712 6:41159866-41159888 CCGGTGATCCAGGGGGTCTATGG + Exonic
1007363843 6:41376219-41376241 CAGTAGGGACAGGGGTTCCAGGG - Intergenic
1008858801 6:56124238-56124260 CAGCAGGTCCAGGGAGGCCAGGG + Exonic
1010108160 6:72192130-72192152 CAGTGGGTCCAGTGGGTCCCCGG - Intronic
1010552285 6:77237613-77237635 CAGTGGGTCCAGTGGGTCCTGGG + Intergenic
1010818469 6:80387186-80387208 CAGTGGGTCCAGTGGGTTCCTGG + Intergenic
1012001773 6:93663250-93663272 CAGTGGGTCCAGTGGGTTCCTGG + Intergenic
1012344429 6:98169111-98169133 CAGTGGGTCCACTGGGTCCCCGG + Intergenic
1014631495 6:123795585-123795607 CAGTGAGTCCAGTGGGTCCCTGG + Intergenic
1015475597 6:133656274-133656296 CAGTGGGTCCAGTGAGTCCCCGG + Intergenic
1016419771 6:143871892-143871914 CAGTGGGTCCAGTGGATCCCTGG - Intronic
1017010123 6:150057847-150057869 CACTTGGTCCTTAGGGTCCACGG + Intergenic
1018123092 6:160656440-160656462 CAGTGGTTCCAGTGGGTCCCTGG - Intronic
1018899198 6:168042809-168042831 CAGGAGGTGCAGGGGGTGCATGG - Intronic
1020120289 7:5499321-5499343 CAGTCGGTTCAGAGGGTCCAGGG - Intronic
1020124607 7:5526551-5526573 AAGTTGGGGTAGGGGGTCCATGG - Intergenic
1020710178 7:11596402-11596424 CAGTGGGTCCAGTGGTTCCCGGG + Intronic
1022078729 7:26999110-26999132 CAGTGGGTCCAGTGGGTCCCCGG + Intergenic
1025285151 7:57654533-57654555 CAGTTGTTCCACGGTTTCCACGG - Intergenic
1028322428 7:89476870-89476892 CAGTTGGTCCAGCAGGTCCATGG + Intergenic
1028755369 7:94427632-94427654 CAGGAGGGCCAGGGGGACCAGGG - Exonic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029328814 7:99833959-99833981 GACTTGGTCCAGGTGGTCCCTGG - Intronic
1029442555 7:100595171-100595193 CTGCTGGTCCAGGGGGTCAAAGG - Exonic
1029598308 7:101549193-101549215 CAGGTGTTCCTGGGGGTCCTGGG - Exonic
1030368592 7:108672818-108672840 TAGTGGGTCCAGTGGGTCCCTGG + Intergenic
1031474608 7:122206552-122206574 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1031676397 7:124617116-124617138 CAGTGGGTCCAGAGGGTCCCTGG + Intergenic
1032018536 7:128394172-128394194 CAGGTGGTCCATGGGGTCCCTGG + Intronic
1032027828 7:128457374-128457396 CTGGTGGTCCAGGAGGTCCCAGG - Exonic
1034272887 7:149811928-149811950 CACTGGCTCCAAGGGGTCCAGGG - Intergenic
1035634007 8:1129854-1129876 AATGTGGTCCTGGGGGTCCAAGG - Intergenic
1038781253 8:30569921-30569943 GAGAAGGTCCAGGGTGTCCAGGG + Intronic
1039399077 8:37253321-37253343 GAGAGGGTCCAGGGGCTCCATGG + Intergenic
1040560677 8:48520934-48520956 TAGGTGGCCCAGGGGATCCATGG - Intergenic
1041600890 8:59716385-59716407 CAGGAGGTCCTGGGGGTCCCAGG + Intergenic
1041934389 8:63320108-63320130 CAGTGGGTCCAGTGAGTCCCCGG + Intergenic
1042565105 8:70103020-70103042 CAGTGGGCCCAGTGGTTCCATGG - Intergenic
1044275994 8:90300144-90300166 CAGTTGGAACAGGAGGCCCATGG - Intergenic
1044487310 8:92768339-92768361 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1044633583 8:94300996-94301018 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1048208536 8:132435166-132435188 CATTGGGTCCAGGAGGTCCTGGG - Intronic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1050612010 9:7362707-7362729 GAGTGGGGTCAGGGGGTCCATGG + Intergenic
1050866756 9:10510276-10510298 CAGATTGTCGAGGGGGTACATGG - Intronic
1051534664 9:18143255-18143277 AACTTGGTCCAGAGGCTCCATGG - Intergenic
1051966298 9:22833377-22833399 CAGTGGGTCTAGTGGGTCCCTGG + Intergenic
1052227442 9:26107156-26107178 CAGTTGGTCCTGTGGGTCCCCGG + Intronic
1052368487 9:27639617-27639639 CAGTGGGTCCAGTGGGTCCCTGG + Intergenic
1053128190 9:35599575-35599597 CAGTTGGTCCTGGGCAGCCATGG - Intergenic
1053390400 9:37731042-37731064 CAGGAGGTCCAGGGGGTCCTTGG - Exonic
1056314404 9:85374163-85374185 CAGTGCGTCCAGTGGGTCCCCGG - Intergenic
1058019731 9:100074861-100074883 CAGAGGGTCCAGTGGGTCCCCGG + Intronic
1058544334 9:106043965-106043987 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1059436895 9:114282498-114282520 CAGGGGGTCCAGGGTCTCCAGGG - Exonic
1059437360 9:114284747-114284769 CTTTTGGTCCAGGAGGTCCAAGG - Exonic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1061670101 9:132183765-132183787 AGGCTGGTCCAGGTGGTCCAGGG - Intronic
1062112748 9:134790958-134790980 CAGTTGCTCCACGAGGTCCCTGG - Intronic
1062114866 9:134802929-134802951 CGGGGGGTCCAGGGGGCCCAGGG - Exonic
1062460332 9:136660199-136660221 CAGAGGGTACTGGGGGTCCAGGG - Intronic
1189129006 X:38479191-38479213 GAGCTTGGCCAGGGGGTCCAGGG - Intronic
1190996911 X:55618690-55618712 CAGTGGGTCCAGTGGGTTCCCGG - Intergenic
1191134111 X:57045169-57045191 CAGTGGGTACAGTGGGTCCTCGG - Intergenic
1191226582 X:58050471-58050493 AAGTAGGTCCAGTGGGTCCCCGG + Intergenic
1193841563 X:86413822-86413844 CAGTGGGTCCAGTAGGTCCCTGG - Intronic
1193957126 X:87877017-87877039 CAGTGGGTCCAGTGTGTCCCTGG + Intergenic
1194604547 X:95963196-95963218 CAGTGGGTCCAGTGGGTCTCGGG - Intergenic
1194833794 X:98657582-98657604 CAGTGGGTCCAGTGGTTCCCAGG + Intergenic
1194849408 X:98853387-98853409 CAGTGGGTCCAGTGGGTCCCCGG - Intergenic
1195027742 X:100894828-100894850 CAGTTGGCCAAAGGGGACCATGG + Intergenic
1195809816 X:108817036-108817058 CAGTGGGTCCAGTGGGTCCCTGG - Intergenic
1195850633 X:109278316-109278338 GGTTTGGTCCAGGGGGTCCTTGG + Intergenic
1196275665 X:113762896-113762918 CAGTGGGTCCAGTGGGTCTCCGG + Intergenic
1196346700 X:114669609-114669631 CACTTGGACCAGGGAGTCCGAGG + Intronic
1197002133 X:121451739-121451761 CAGTGGGTCCAGTGGGTTCCCGG + Intergenic
1197372200 X:125639071-125639093 CAGTGAGTCCAGTGGGTCCCTGG - Intergenic
1198933857 X:141886634-141886656 CAGATGATCCAGTGGGTCCCCGG + Intronic
1201404438 Y:13635636-13635658 GATTTGCTGCAGGGGGTCCAGGG - Intergenic