ID: 905168945

View in Genome Browser
Species Human (GRCh38)
Location 1:36098779-36098801
Sequence GGCTCCCCTTTGGCCCCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905168936_905168945 -1 Left 905168936 1:36098757-36098779 CCCAGGGGGGCCCCGGGTCCCTG 0: 1
1: 0
2: 4
3: 26
4: 275
Right 905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 29
4: 214
905168926_905168945 22 Left 905168926 1:36098734-36098756 CCATAGCCAGTGGGGCCTATCAG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 29
4: 214
905168925_905168945 23 Left 905168925 1:36098733-36098755 CCCATAGCCAGTGGGGCCTATCA 0: 1
1: 0
2: 0
3: 10
4: 68
Right 905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 29
4: 214
905168933_905168945 7 Left 905168933 1:36098749-36098771 CCTATCAGCCCAGGGGGGCCCCG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 29
4: 214
905168937_905168945 -2 Left 905168937 1:36098758-36098780 CCAGGGGGGCCCCGGGTCCCTGG 0: 1
1: 0
2: 4
3: 47
4: 446
Right 905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 29
4: 214
905168927_905168945 16 Left 905168927 1:36098740-36098762 CCAGTGGGGCCTATCAGCCCAGG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG 0: 1
1: 0
2: 1
3: 29
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905168945 Original CRISPR GGCTCCCCTTTGGCCCCTGA TGG Exonic
900198003 1:1387155-1387177 GGCTGCCCTTTGACCCCCGGTGG - Exonic
900646870 1:3712985-3713007 GGTTCCCCTGGGGGCCCTGAGGG - Intronic
901082539 1:6591713-6591735 GGCTACCCCTTGGCCCCTCCTGG - Exonic
901678874 1:10901823-10901845 GGCTTCCCTGGGGGCCCTGATGG + Intergenic
903758651 1:25682624-25682646 GTCTCCCCTGTGGCCCATAAGGG + Intronic
904032735 1:27543293-27543315 GGCTCCACGTTGGGCCCTGTGGG - Intronic
904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG + Exonic
905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG + Exonic
907222032 1:52914172-52914194 GGCTCCCCTCTGCCCACTGGAGG - Intronic
913075620 1:115338468-115338490 GGTTTCCCTTTGACCTCTGAAGG - Intergenic
913110103 1:115649916-115649938 GGCTAGCCTTGGGCTCCTGATGG + Intronic
913198205 1:116475377-116475399 TGCTTACCTTTGGCCCCTCAAGG - Intergenic
913491421 1:119383404-119383426 GGGCCCTCTTTGGCCCCTGATGG + Intronic
915964065 1:160291300-160291322 GGCTTCCCTATGGTCACTGAAGG + Intronic
916023377 1:160813918-160813940 GGCTCCAACTTGGCCCTTGAGGG + Intronic
916747686 1:167697267-167697289 GGATCCCCTTTGTCCAGTGAGGG + Exonic
918134502 1:181659486-181659508 CGCTGCCCTGTAGCCCCTGATGG - Intronic
918168168 1:181970425-181970447 GGCTCTCAGATGGCCCCTGAGGG - Intergenic
919881488 1:201904013-201904035 GGAGCTGCTTTGGCCCCTGATGG - Intronic
919903177 1:202058795-202058817 GCCTCACCTCTGGCCCCTGAGGG - Intergenic
921202892 1:212824018-212824040 GTCTCCCATTTGGTCCCTGAGGG - Intergenic
921774540 1:219081892-219081914 GGCTCCCCTCTGGCCCAGGGTGG + Intergenic
922173560 1:223177561-223177583 GCCTGGCCTTTGGACCCTGAGGG - Intergenic
922750293 1:228067082-228067104 GGCTCCCCATGGGCACCTGAGGG - Intergenic
922860453 1:228811715-228811737 GGCCTCCCTTTGGCCCCTTGTGG - Intergenic
922992739 1:229929343-229929365 GACTGCCCTTTGGTGCCTGATGG - Intergenic
924139197 1:241004471-241004493 GCCTCTCCTTTGCCCTCTGAAGG + Intronic
1063218488 10:3944792-3944814 GGCGCCTCTTTGGGCCATGAGGG - Intergenic
1066974152 10:42349509-42349531 GCCTCTACTGTGGCCCCTGAAGG + Intergenic
1067693676 10:48520386-48520408 TGCTCCCCTTAGGCCCCTCCTGG - Intronic
1069279567 10:66638016-66638038 GCCTACCCTTTGGACCCTGATGG + Intronic
1069614534 10:69798631-69798653 GGCTCCCCTGTGGCCTCTACAGG + Intergenic
1070143842 10:73759644-73759666 GGGTCCCCATTGGCCCCTGTGGG + Exonic
1070670638 10:78375054-78375076 TGCTCCCCTTTCCCACCTGAGGG - Intergenic
1071563251 10:86658867-86658889 GGAGATCCTTTGGCCCCTGATGG - Intronic
1074396874 10:113105303-113105325 GGCTCCCATTGGGCCTCTTAGGG + Intronic
1075417305 10:122274225-122274247 GCCCACTCTTTGGCCCCTGAGGG - Intronic
1075634028 10:124018200-124018222 GGTGCACCTTTGTCCCCTGAGGG - Intronic
1075681995 10:124339864-124339886 GCCTCACCGTTGGCCTCTGAGGG + Intergenic
1076569022 10:131420244-131420266 GGCTCACCCTTCGCCCCTGAAGG - Intergenic
1077258870 11:1604790-1604812 GGCTGCCCTGTAGCCCCAGATGG - Intergenic
1077287493 11:1774105-1774127 GGCTCCTATTTGCCCCATGAAGG - Intergenic
1079409352 11:20172791-20172813 GGTTCCCAATTGGTCCCTGATGG + Intergenic
1079673661 11:23199111-23199133 GGCTCTACATTGGCCCCTGTTGG + Intergenic
1082922645 11:58512187-58512209 GACTCCCCTGTGGCCCCTAAGGG - Intergenic
1083861066 11:65420289-65420311 GGCACAGCTTTGGCCCCTTAAGG + Intergenic
1084166829 11:67379054-67379076 GGCTTCCCTTTGCTTCCTGAGGG + Intronic
1084285527 11:68128415-68128437 GGCTTCCCTCTGGCCCCTCCTGG + Intergenic
1084437597 11:69153296-69153318 GGCTCCCCGTGGGCCCTGGACGG + Intergenic
1085499567 11:77007405-77007427 GGTTCCTCTTTGGCCTCTGTTGG + Intronic
1089286506 11:117411150-117411172 AGCTGCCCTCTGGCCCCTGTGGG + Intronic
1089650691 11:119910869-119910891 GGCTCCCCTATAGGCCCTGCTGG - Intergenic
1089740269 11:120577524-120577546 CCAGCCCCTTTGGCCCCTGAAGG - Intronic
1090189810 11:124760395-124760417 CGCTCTCCTTCGGCCCCTGCCGG - Intronic
1090676879 11:129007128-129007150 GGCTCCCCTCTGGCCCAGGGCGG + Intronic
1090976209 11:131682783-131682805 GGATCCCCTTTGGCTCCTGGAGG + Intronic
1094187543 12:27661262-27661284 GGCTAACTTTTGGGCCCTGAAGG + Intronic
1096679062 12:53242701-53242723 GCCTCCCCCACGGCCCCTGAAGG + Intergenic
1097146980 12:56948516-56948538 GGCTCCCCATTGGCCCAGGGTGG + Intergenic
1100464693 12:94834652-94834674 GTCTCCCACTTGGCCCCTCAGGG - Intergenic
1102819439 12:115895435-115895457 TGCTCCCCTGTGGCCACTGCTGG - Intergenic
1105432558 13:20350525-20350547 GGATCCCCCGTGGACCCTGAGGG - Intergenic
1112041047 13:95548283-95548305 GACTCCTCTTGAGCCCCTGAAGG - Intronic
1112488111 13:99837773-99837795 GGCTCCCCTTGTGACCCTGCTGG - Intronic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113575402 13:111391722-111391744 GACTCCCCTTAAGCCCCTGCTGG - Intergenic
1113894971 13:113758856-113758878 GCCTCCCCATTGGCCGGTGACGG - Intergenic
1116372550 14:44154592-44154614 GGCTCCAGGTTGGCCCCTGTAGG + Intergenic
1117911690 14:60643032-60643054 GGCTCTCCCTTGTCCGCTGAGGG - Intergenic
1118605287 14:67498387-67498409 GTCTCCCCTTTGCCTTCTGAAGG - Intronic
1119096790 14:71840329-71840351 GGCTCCCCTGTGGCCCAGGGTGG + Intergenic
1121412862 14:93759950-93759972 TGCTGCCCTTCGGCCCCTGGAGG - Intronic
1123106915 14:105846028-105846050 CACTTCCCTTGGGCCCCTGAGGG + Intergenic
1123896286 15:24833469-24833491 AGTTCCCCTTTGTCCTCTGAAGG + Intronic
1124007866 15:25809162-25809184 GGCTCCCCAGTGGCCGCAGATGG + Intronic
1125276975 15:38003798-38003820 GGCTCCTCTGTGGCCCAGGAAGG + Intergenic
1126407592 15:48337158-48337180 AGCTCCCCTTTAGTCCCTAAAGG - Intronic
1126414883 15:48407109-48407131 TGCTCCCCTGTGCCCCCTGTGGG - Intergenic
1127140353 15:55969649-55969671 GGTTCCCCTCTGGCCCAGGATGG - Intronic
1129477439 15:75795619-75795641 GGCTCCCCTCTGGCCTAGGACGG + Intergenic
1129613714 15:77081963-77081985 GCCTCCCCCATGGCCCCGGATGG + Intronic
1129786339 15:78312711-78312733 TTTCCCCCTTTGGCCCCTGAGGG + Intergenic
1131827953 15:96334827-96334849 GGCTGCCCTATGGCCCATGTGGG - Intronic
1132317856 15:100902930-100902952 GTGTCCCTTTTGGCCCCTCAGGG + Intronic
1132592540 16:732461-732483 GTCTGCACTTTGGCCCCAGAAGG + Intronic
1133957380 16:10456586-10456608 GTCTCCCATTTAGCCCCTGCCGG + Intronic
1134013809 16:10874537-10874559 GGATGCACTTTGGCACCTGAAGG - Intergenic
1135116008 16:19723988-19724010 GGCTCCCCTTCCTGCCCTGATGG + Intronic
1135496979 16:22961492-22961514 GGCTCCACTTCAGCCCCTGGGGG - Intergenic
1136343862 16:29663099-29663121 GGCACCCCGCTGGCCCCTGAAGG + Intronic
1137510370 16:49094351-49094373 CCCTCCCCTTTGGCCCATTAGGG + Intergenic
1137665488 16:50246689-50246711 TGGTCCCCTTTGGCCACCGAGGG - Intronic
1141208946 16:81958466-81958488 GGCTTCTCTTTGGGCCCTTATGG - Exonic
1141678330 16:85529512-85529534 TGCTCCCCCTTGGCACCTGTTGG + Intergenic
1141805833 16:86340890-86340912 GGCTCCCCTGCGCCCCCTGGTGG - Intergenic
1142247537 16:88976819-88976841 GGCTCCAGGTTGGCCCCTGAGGG - Exonic
1143174434 17:4948210-4948232 TGCTCCGGTTTGGACCCTGAGGG - Intronic
1144132457 17:12259967-12259989 GGCCCCCCTTAGACCCCTGAAGG - Intergenic
1145017559 17:19409197-19409219 TCCCCTCCTTTGGCCCCTGAGGG + Intergenic
1145924351 17:28634576-28634598 GGCAGCCCTTTTCCCCCTGAGGG - Exonic
1146063929 17:29621062-29621084 GCCTCCCCTCTGGTCCTTGAGGG + Intronic
1147311642 17:39599235-39599257 GGCTCCCCTGCGGCTCCTGGGGG + Intergenic
1148783979 17:50136234-50136256 GGGTACCCTTTGGCTCCTGCTGG - Intronic
1149342091 17:55697889-55697911 GGAACCCCTCTGGCTCCTGATGG + Intergenic
1149582852 17:57763257-57763279 GGTCCCCCTGTGGCCTCTGATGG + Intergenic
1151786925 17:76279618-76279640 GGCTTCCCATGGGCCCCTGAGGG + Intronic
1152129457 17:78467166-78467188 GGGTCCCCGCTGGGCCCTGAGGG + Intronic
1152684348 17:81686821-81686843 GGTTCCCCTCCGGCCACTGACGG + Intronic
1156671703 18:39478409-39478431 GTCTCCACTTTGGCCCTTGAGGG + Intergenic
1158601519 18:58859984-58860006 GGCTCTCCTTTGACTCCTGAAGG + Intergenic
1160986173 19:1839966-1839988 GGCTCCCTTTTGGTCTCTGAGGG + Intronic
1161104585 19:2437029-2437051 GCCTCCCCTCTGGCTCCTGTGGG + Intronic
1161258721 19:3323734-3323756 TGCACCCCTGTGGCCCCTGCTGG + Intergenic
1164421619 19:28098721-28098743 GGTTCCCCTTTGCCCTCTGAAGG - Intergenic
1164511099 19:28897906-28897928 GGACCCTCGTTGGCCCCTGATGG + Intergenic
1164561333 19:29294177-29294199 GACTTCTCTTTGGCCCCTGGAGG - Intergenic
1166325975 19:42051408-42051430 GGCTCCTTGTTGGCCCATGAGGG - Intronic
1167116014 19:47489460-47489482 GGCTCGGCCTTGGCCCCTCAGGG - Intronic
925196517 2:1930334-1930356 GGCACCCCTGTGGTCCCTGTGGG + Intronic
926704196 2:15825346-15825368 GGCTCCCCTCTAGCTCCTGGTGG + Intergenic
927686916 2:25177639-25177661 GACTCTGCTTTGGACCCTGAGGG - Intergenic
931055242 2:58461939-58461961 TCCAACCCTTTGGCCCCTGATGG - Intergenic
931645374 2:64417155-64417177 GGCTCCTCTATGGCCCTGGAAGG + Intergenic
932191902 2:69748024-69748046 GGATCCCCTTTGCCCTCTGAAGG + Intronic
932292620 2:70595131-70595153 GGGTCCTCAGTGGCCCCTGAAGG - Intergenic
934564401 2:95330359-95330381 TGCTCCCCAGTGGCCTCTGAGGG + Intronic
935670955 2:105556817-105556839 GGCTTTCCTTTGGCCCCAAATGG - Intergenic
935761663 2:106326090-106326112 TTTTCCCCTTTGGCCTCTGAAGG - Intergenic
935863862 2:107363672-107363694 GGCTGCCCTTGAGCCCATGAAGG - Intergenic
936461036 2:112713930-112713952 GACTCCTCTTTAACCCCTGAGGG - Intergenic
937220806 2:120342491-120342513 GGCTCCCCTTCCCCTCCTGAGGG - Intergenic
937480242 2:122250935-122250957 TGCTGCCCTCTGGGCCCTGATGG - Intergenic
937905529 2:127051072-127051094 GGCTCCCCTGTGGCCCCTGCTGG - Intronic
938101284 2:128499661-128499683 GGCTCCTCGGTGGCCCCTGCTGG - Intergenic
938236458 2:129710176-129710198 ACCTCCCCTTTGCCCTCTGAGGG + Intergenic
940461412 2:153967847-153967869 GATTCCCTTCTGGCCCCTGATGG + Intronic
943208183 2:184927879-184927901 GGCTCCCCTCTGGCCCAAGGCGG + Intronic
944835902 2:203579655-203579677 GCTTCCCCTTTGCCCTCTGAAGG + Intergenic
946414365 2:219532165-219532187 GGCTCGCCTTTGGGCTCAGAGGG + Intronic
1171097170 20:22343471-22343493 GGCCCACCTCTGGCCCCAGAAGG + Intergenic
1172899891 20:38327076-38327098 GGCACCCATATGGCCACTGAGGG + Intronic
1173736601 20:45366038-45366060 GGCTCCTCTTTTGTCCATGAGGG + Intronic
1174146548 20:48456205-48456227 GGCTCCCCCTTGGCCTCTGTGGG + Intergenic
1175609048 20:60334851-60334873 TGTTCAGCTTTGGCCCCTGAAGG - Intergenic
1175824168 20:61927682-61927704 GGCTCTGCACTGGCCCCTGAGGG - Intronic
1176161697 20:63651973-63651995 GACTCCCCTCCTGCCCCTGAGGG - Intronic
1177415982 21:20794038-20794060 GCTTCCCCTTTGCCCTCTGAAGG - Intergenic
1178918464 21:36722789-36722811 GCCACCCCTGAGGCCCCTGATGG - Intronic
1179076143 21:38123569-38123591 GGCTTCCCATTGGCCCATGGAGG + Intronic
1179547496 21:42122480-42122502 GGCTCACCATGGGCCCCCGAGGG - Intronic
1179643639 21:42762388-42762410 GGCTCCACTCTGGGCCCTGGAGG - Intronic
1183324206 22:37182720-37182742 GGGTCCCCTTTGTCACCTGTGGG + Exonic
1183612196 22:38916739-38916761 AGCTCCCCTTTCTCCACTGATGG + Intergenic
1184233284 22:43169701-43169723 GCCTCCTGTTTGGACCCTGAGGG - Intronic
1184748270 22:46469234-46469256 TGCTCCCCTGTGGTCCCTAATGG + Intronic
949177810 3:1087319-1087341 GGCTCCCCTTGGGGCCTTGAGGG + Intergenic
950536792 3:13583546-13583568 GGCTCAGCTTTGCCCCTTGAGGG - Intronic
950544330 3:13629730-13629752 GCCTCCCCTTCGGCCCTGGATGG + Intronic
951398731 3:22203598-22203620 GGCTTCCCTCTGGCCCATGATGG - Intronic
952777408 3:37059857-37059879 GGCCTCCCTTTGACCCCTGTTGG - Intronic
956777723 3:72579549-72579571 GGCACCCCTTTTGCCCCAAAAGG + Intergenic
957977158 3:87461099-87461121 GGTTCCCCTCTGGCCCAGGATGG - Intergenic
962739097 3:138349631-138349653 TACTCCCCAATGGCCCCTGATGG + Intronic
963786223 3:149536845-149536867 GGCTCCCCCTTGTCCCTTCACGG - Intronic
965844536 3:172946435-172946457 GGCTTCCCTTTGGCCCAGGGCGG - Intronic
967636635 3:191809060-191809082 GGCTCCCCTCTGGCCCAAGGCGG - Intergenic
968957915 4:3728440-3728462 GGCTCCCCTTTGGGGAGTGAGGG - Intergenic
971791750 4:31178099-31178121 GTCACCCCTTTGGCCGCTGAAGG + Intergenic
972050229 4:34722272-34722294 TGTTCCCCTTTGCCCTCTGAAGG - Intergenic
975669916 4:76770664-76770686 GGCTCCCCTTCGCCTCCTGGAGG - Exonic
975802817 4:78080051-78080073 AACTCCCCTTTGGCCCCAAAGGG + Intronic
978505858 4:109455130-109455152 AGCTCCCCTTGGCCCTCTGAAGG - Intronic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
979395124 4:120178324-120178346 AGTTCCCCCTTGGCCCCCGATGG - Intergenic
979785470 4:124712062-124712084 GGCTCCCCTGTGGCTCCTCTGGG - Intronic
980494543 4:133574702-133574724 GGCTGGCCTCTGGCCCCTCATGG + Intergenic
992616957 5:78554267-78554289 GGCTCTCTTTTGGCCCCACAAGG + Intronic
992872312 5:81019279-81019301 GCCTCACTTTTGGGCCCTGATGG + Intronic
994985428 5:106927065-106927087 AGCTCCCCTTGGCTCCCTGAAGG - Intergenic
996540856 5:124629231-124629253 GGCTCCCCAGTGTCCCGTGATGG + Intergenic
999744075 5:154578317-154578339 GGCTCCCCTAGGGCCCCAAAGGG + Intergenic
1000328961 5:160192763-160192785 AGCTACCCTTTGACCCCAGACGG - Intronic
1000433558 5:161180191-161180213 GGCTCCCCTCTGGCCCAGGGTGG - Intergenic
1002553492 5:180016003-180016025 GGTTCCCCCTTTGCTCCTGAGGG - Intronic
1002868209 6:1142624-1142646 GGCTCCCATCTGGTCCTTGAGGG + Intergenic
1003320796 6:5049296-5049318 GGCTCTCCATTGGACTCTGAAGG + Intergenic
1004615058 6:17281459-17281481 GGCTCGCCCTTGGCCCCCGGCGG + Exonic
1005298341 6:24447936-24447958 GGCTCCCCTTTTGCACCAGGTGG - Exonic
1005813966 6:29535433-29535455 AGCACCCCTTTGACTCCTGAGGG + Intergenic
1006997044 6:38270780-38270802 GACTCTCCTTGGGCCTCTGATGG + Intronic
1007774729 6:44218709-44218731 GGCTCTTATTTGACCCCTGAGGG - Intergenic
1007880077 6:45154882-45154904 GCTTCCCCTTTGCCCTCTGAAGG - Intronic
1009645714 6:66398367-66398389 GGCTCCTCTTTGGCCAATAATGG + Intergenic
1009978494 6:70699800-70699822 GGCTCCTCTTTGGCCCAGGGTGG + Intronic
1012529552 6:100218382-100218404 TGCTCTCCTTTGGCACCTGCTGG + Intergenic
1016185709 6:141195863-141195885 GGCTCCCCTCTGGCCCAGGGTGG + Intergenic
1018198757 6:161376941-161376963 GGCTCCTCTTTGGCCACTGGCGG - Intronic
1020418981 7:7978119-7978141 GCCTTCCCTTTGGTCCCTAAAGG + Intronic
1021033100 7:15763019-15763041 GTCACCCCTTTGGGCCCTGAAGG + Intergenic
1022637455 7:32150390-32150412 GGCTCCCCTCTGGCCTATGAAGG + Intronic
1023054878 7:36283379-36283401 GGCTCCCCGATGGCCCTGGAGGG - Intronic
1024629830 7:51238002-51238024 CGTTCCCCTTTGGTACCTGAGGG - Intronic
1025231148 7:57203992-57204014 GGCTCCCCCTTGGCCACTATGGG - Intergenic
1028108199 7:86905399-86905421 AGCTCCCCCTTGTGCCCTGATGG + Intronic
1030629410 7:111879212-111879234 GGCTCCCTTTTGGCCCAGGATGG - Intronic
1032780288 7:135160314-135160336 GTCTCCCCTTTGCCCTCTGAAGG + Intronic
1032947574 7:136870387-136870409 GGCGCCCCTGGGGCCCCTCACGG + Intronic
1033599827 7:142881155-142881177 GACTCTCCTTGGGTCCCTGAAGG + Intronic
1033828707 7:145225582-145225604 GGCACCCCTTTGGGTCTTGAAGG + Intergenic
1034891162 7:154840325-154840347 TCCTCCTCTTTAGCCCCTGATGG - Intronic
1037139905 8:15507130-15507152 AGCTCCCCTTGGCCCTCTGAAGG - Intronic
1038226621 8:25663890-25663912 GTCTCCTATTTGGTCCCTGAGGG - Intergenic
1041027987 8:53706653-53706675 GCCTCCCCTTGGGCCCATGCTGG - Intergenic
1043734318 8:83724577-83724599 GGCCCCCCTTTTGCCCCTACAGG - Intergenic
1044138918 8:88623569-88623591 GGCTCTTCTGTGGCCCTTGAAGG - Intergenic
1044747539 8:95385320-95385342 GGCTCCCCTGTGGTCCAGGAAGG + Intergenic
1044822089 8:96161348-96161370 GGCTCCGGGCTGGCCCCTGAGGG - Intergenic
1045755521 8:105536786-105536808 GGCTCCCTTTTGGAACCTGTAGG + Intronic
1047370400 8:124251556-124251578 GGGTGCCCTTTGGCCTCTGCTGG - Intergenic
1048152941 8:131911549-131911571 AGTTCCCCTTTGCCCTCTGAAGG + Intronic
1048365567 8:133735462-133735484 GGCTCCCAAGTGGCCCCTGCTGG - Intergenic
1052095549 9:24379900-24379922 GCTTCCCCTTTGCCCACTGAAGG + Intergenic
1053611993 9:39723279-39723301 GCTTCCCCTTTGCCCTCTGAAGG - Intergenic
1053870031 9:42481273-42481295 GCTTCCCCTTTGCCCTCTGAAGG - Intergenic
1054086261 9:60747877-60747899 GCTTCCCCTTTGCCCTCTGAAGG + Intergenic
1054241526 9:62619114-62619136 GCTTCCCCTTTGCCCTCTGAAGG + Intergenic
1060997805 9:127885015-127885037 TGGTCCCCTTTTGCCCTTGAAGG + Intergenic
1061328895 9:129880065-129880087 GGCTCACCTTTGCCTCCTCAAGG - Intronic
1061500425 9:130998446-130998468 GGCCCCTCTCTGGCCCCTGGTGG - Intergenic
1061502884 9:131013834-131013856 GGGGACCCTGTGGCCCCTGAGGG + Intronic
1061990939 9:134158401-134158423 GCCTCCCCTTTGGCCCACGCCGG + Exonic
1062273048 9:135718487-135718509 GGCTCCACTCGGGCCCCTGAGGG + Intronic
1187205321 X:17176156-17176178 AACTCCCCCTTGTCCCCTGATGG + Intergenic
1187396361 X:18922971-18922993 GGCTTCTGTTTGGTCCCTGATGG - Intronic
1189193520 X:39132584-39132606 TGGTCCCTTTTTGCCCCTGAAGG + Intergenic
1190303361 X:49068794-49068816 GGCTCCCCGTAGGCCCAGGAAGG + Intronic
1194857840 X:98956321-98956343 GGCTCCCCTTTGGCCCAGGGTGG + Intergenic
1195322071 X:103728434-103728456 GGCTCGCCTTGGGCTCCGGAGGG + Exonic
1198804267 X:140477931-140477953 AGCTTCCCTCTGGGCCCTGATGG - Intergenic
1199258570 X:145744867-145744889 GGCTCCCCTCTGGCCCAGGGCGG - Intergenic
1200085332 X:153601441-153601463 TGCTTCCCTCTGGCCCCTGGTGG + Intergenic
1202165088 Y:21979141-21979163 GGCTCCCTTTTGGTCCTTGTGGG - Intergenic
1202226268 Y:22607233-22607255 GGCTCCCTTTTGGTCCTTGTGGG + Intergenic
1202316847 Y:23588432-23588454 GGCTCCCTTTTGGTCCTTGTGGG - Intergenic
1202553918 Y:26081626-26081648 GGCTCCCTTTTGGTCCTTGTGGG + Intergenic