ID: 905169195

View in Genome Browser
Species Human (GRCh38)
Location 1:36099406-36099428
Sequence CCCGGGCCTCGGGGTCCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 4, 3: 49, 4: 437}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905169195_905169216 25 Left 905169195 1:36099406-36099428 CCAGGGGGACCCCGAGGCCCGGG 0: 1
1: 1
2: 4
3: 49
4: 437
Right 905169216 1:36099454-36099476 TTCAGGTCCATCGGCAGCAGCGG 0: 1
1: 0
2: 0
3: 5
4: 97
905169195_905169211 8 Left 905169195 1:36099406-36099428 CCAGGGGGACCCCGAGGCCCGGG 0: 1
1: 1
2: 4
3: 49
4: 437
Right 905169211 1:36099437-36099459 GGGGGCCGGGCTCTCCCTTCAGG 0: 1
1: 0
2: 0
3: 21
4: 230
905169195_905169204 -10 Left 905169195 1:36099406-36099428 CCAGGGGGACCCCGAGGCCCGGG 0: 1
1: 1
2: 4
3: 49
4: 437
Right 905169204 1:36099419-36099441 GAGGCCCGGGCTTCCCAGGGGGG 0: 1
1: 0
2: 2
3: 36
4: 356
905169195_905169213 16 Left 905169195 1:36099406-36099428 CCAGGGGGACCCCGAGGCCCGGG 0: 1
1: 1
2: 4
3: 49
4: 437
Right 905169213 1:36099445-36099467 GGCTCTCCCTTCAGGTCCATCGG 0: 1
1: 0
2: 2
3: 91
4: 1127
905169195_905169206 -6 Left 905169195 1:36099406-36099428 CCAGGGGGACCCCGAGGCCCGGG 0: 1
1: 1
2: 4
3: 49
4: 437
Right 905169206 1:36099423-36099445 CCCGGGCTTCCCAGGGGGGCCGG 0: 1
1: 0
2: 2
3: 35
4: 562
905169195_905169208 -5 Left 905169195 1:36099406-36099428 CCAGGGGGACCCCGAGGCCCGGG 0: 1
1: 1
2: 4
3: 49
4: 437
Right 905169208 1:36099424-36099446 CCGGGCTTCCCAGGGGGGCCGGG 0: 1
1: 0
2: 2
3: 34
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905169195 Original CRISPR CCCGGGCCTCGGGGTCCCCC TGG (reversed) Exonic
900091845 1:924148-924170 CCAGGGCCTCGGGGCTCCCCGGG - Intergenic
900227606 1:1540379-1540401 CCCCGGCCCCGGCGCCCCCCCGG + Intronic
900298830 1:1966439-1966461 AGCTGGCCCCGGGGTCCCCCTGG + Exonic
900379158 1:2375313-2375335 CCGCTGCCTCGGGGTTCCCCTGG - Intronic
900382303 1:2391124-2391146 CCTGGGCTTCGGGATCCCCATGG + Intronic
900635846 1:3664606-3664628 TCCTGGCCTCCGGGTCCACCTGG + Intronic
900984706 1:6066592-6066614 CCCATGCCTCAGGGTTCCCCAGG - Intronic
901010535 1:6199332-6199354 CCCGGGCCTCCGAGACCTCCCGG + Intronic
901182251 1:7349887-7349909 CCTGGGCCTTGGGGGCCTCCTGG + Intronic
901381612 1:8878400-8878422 CCCGGGCCTCGGGGTGAGCGGGG + Intronic
901641234 1:10694183-10694205 CCTGGGCCTCGCGGATCCCCCGG - Intronic
901762406 1:11479523-11479545 TGCGGGCCTCGGAGCCCCCCGGG + Intronic
903115482 1:21176104-21176126 CCTGGGCTGCGGGGTCCCCCTGG + Intronic
903132848 1:21290544-21290566 CTCGGGTCTTGGGGTCTCCCCGG - Intronic
904054286 1:27659976-27659998 TCAGGGCGTCGGGGTCTCCCGGG - Intergenic
904602813 1:31683219-31683241 CCGGGACCTCGGGGACCACCTGG - Exonic
905168677 1:36098089-36098111 CCCGGGCCCCCGGGACCCCCTGG - Exonic
905168680 1:36098098-36098120 CCGGGGCCTCCCGGGCCCCCGGG - Exonic
905168937 1:36098758-36098780 CCAGGGACCCGGGGCCCCCCTGG - Exonic
905169195 1:36099406-36099428 CCCGGGCCTCGGGGTCCCCCTGG - Exonic
905202409 1:36323421-36323443 CCCGGGCCGGTGGGTCCCCGCGG - Intronic
905626888 1:39495252-39495274 CCCCGCCCTCTGGGTCCCACAGG - Intronic
905733713 1:40312581-40312603 CCCGGGCTTCCTGGTCCTCCTGG - Exonic
905990643 1:42334860-42334882 CCCAGCCCTCGGCGTCCGCCAGG + Intronic
906073652 1:43036004-43036026 CCCTGGCCCCTAGGTCCCCCCGG + Intergenic
907334911 1:53693648-53693670 TCCCGGCCTCGGGGTCGCCAAGG + Intronic
911860890 1:102946874-102946896 CCGGGACCTCAGGGTCCTCCTGG - Exonic
912315101 1:108661150-108661172 CCCGCGCCTCGGCCTCCCCGCGG + Intronic
915249517 1:154578229-154578251 CTGGGGCCTCGGGGTAGCCCAGG - Exonic
919763988 1:201114838-201114860 CCCGGGCCTCGCCGTCGCCAGGG + Exonic
920741673 1:208586711-208586733 CCCTGGCCTCAGGCTCCCCCAGG - Intergenic
920850801 1:209626830-209626852 CCAGAGCCTCAGCGTCCCCCAGG + Intronic
922763435 1:228146029-228146051 GCCGGGCCTCGGGTTCCTCGTGG - Exonic
922831644 1:228557390-228557412 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922832121 1:228609372-228609394 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922832681 1:228611613-228611635 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922833242 1:228613854-228613876 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922833802 1:228616095-228616117 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922834359 1:228618336-228618358 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922834921 1:228620567-228620589 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922835471 1:228622770-228622792 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922836029 1:228625012-228625034 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922836586 1:228627252-228627274 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922837146 1:228629493-228629515 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922837706 1:228631735-228631757 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922838264 1:228633975-228633997 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922838823 1:228636200-228636222 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922839382 1:228638441-228638463 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922839943 1:228640672-228640694 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922840503 1:228642913-228642935 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
922841066 1:228645144-228645166 CCCAGGCCTCCGGGCCCGCCCGG - Intergenic
923171747 1:231422534-231422556 CCTGCGCCTCGGCGTCCCCGAGG - Exonic
923712700 1:236399861-236399883 CCCAGGCCCAGGGTTCCCCCAGG - Intronic
924421877 1:243917352-243917374 CCCCGGCCTCGGGGGCCCGCGGG - Intergenic
924778348 1:247126643-247126665 CCCGGGCCCCGGGCTCCCAGCGG + Intronic
924783310 1:247171777-247171799 CCCGGGCCCCGGGCTCCCAGCGG - Intronic
1062834843 10:628876-628898 CCTGGGGCTGGGGGTGCCCCTGG - Intronic
1062935485 10:1382954-1382976 CCCAGGCCACTGCGTCCCCCAGG - Intronic
1064003606 10:11683219-11683241 CCAGGGCCTCCGGGATCCCCTGG - Intergenic
1067280142 10:44864990-44865012 CCCGGGCCTCTGCTGCCCCCTGG + Intergenic
1067752076 10:48978211-48978233 CTCACGCCTAGGGGTCCCCCAGG - Intronic
1069438441 10:68407020-68407042 CCTGGGACTCGGGGGCTCCCGGG - Exonic
1069749704 10:70737312-70737334 ACCCAGCCACGGGGTCCCCCGGG - Intronic
1070598542 10:77849592-77849614 CCTGGTCATTGGGGTCCCCCAGG - Intronic
1072976726 10:100065352-100065374 CCCGGGTCTCGGGTTCCACCTGG + Exonic
1073122618 10:101131776-101131798 GCCGGGCCTCCGGGGCCGCCGGG - Exonic
1073509463 10:104034271-104034293 CCTGGGCCGCAGGGACCCCCTGG - Exonic
1073509556 10:104034698-104034720 CCAGGGCCTCGAGGGCCCCCGGG - Exonic
1073509567 10:104034716-104034738 CCAGGACCTCCTGGTCCCCCAGG - Exonic
1076217821 10:128710447-128710469 CCCTGGGCTCTGGGTACCCCTGG - Intergenic
1076413146 10:130265850-130265872 CCCTGGCCTGGGGATCCCACCGG + Intergenic
1076594818 10:131618986-131619008 CTCGGGTCTCGGGGCCCCACGGG - Intergenic
1076936062 10:133568039-133568061 CCCGGGCCGCACCGTCCCCCAGG - Intronic
1077010306 11:376568-376590 CCCGGGACGGGGGGACCCCCAGG + Exonic
1077091155 11:778931-778953 CACTGGCCTCTGGCTCCCCCTGG + Intronic
1077095770 11:798399-798421 CCCTGGCCGTGGGTTCCCCCGGG + Exonic
1077185090 11:1232225-1232247 CCTGGGCCACGGGGACCCCTGGG + Intronic
1077486146 11:2839205-2839227 CCCTGGCCTCTGGGTGCACCTGG + Intronic
1077630572 11:3808598-3808620 CCCGGGCCACCTGGGCCCCCGGG + Exonic
1077813539 11:5662917-5662939 CCAGGGCTTCGGGATCCGCCTGG + Intergenic
1078255137 11:9652353-9652375 CCCTGGCCACTGGGTCCCCCTGG - Intergenic
1078659683 11:13277343-13277365 CGCGCTCCTCGGGGTCGCCCGGG - Intronic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1081967575 11:47178893-47178915 CCCAGTCCCCGGGGTCCCCAGGG - Exonic
1083199251 11:61109930-61109952 TCCAGGCCTCGGGGGCCTCCTGG + Intronic
1083661287 11:64252686-64252708 CCCCGGCCCCTGGGGCCCCCAGG - Intronic
1083887576 11:65580439-65580461 CCCGGGCCTCCGGGGCTCCTGGG - Exonic
1083936474 11:65872466-65872488 CTTGGGCCTCGGGGCCTCCCAGG + Intronic
1084156944 11:67318322-67318344 ACCGGGCCTGGGGGCCTCCCGGG - Intronic
1089556337 11:119317520-119317542 CCTGGTCCTCGGTGTCCCCAAGG + Intronic
1089590011 11:119534000-119534022 CCCGGCTCTCGGGCTCCCCCTGG + Intergenic
1090080576 11:123609651-123609673 CCCGGCCCTCGGGCTCCCATTGG + Intronic
1090184131 11:124725290-124725312 CCTGGGCCTCTGGGTCCTTCAGG - Intergenic
1091060145 11:132453438-132453460 CCCGGCCCTGGGGATGCCCCTGG - Intronic
1091223273 11:133943443-133943465 CTGGGTCCTCGGGGTCTCCCTGG - Intronic
1091280548 11:134379451-134379473 CCCAGGCCTCTGGGGCCCACTGG - Intronic
1095981164 12:47975559-47975581 CCTGGTCCTCCAGGTCCCCCTGG - Exonic
1095983019 12:47983410-47983432 CCTGGCCCTCCTGGTCCCCCAGG - Exonic
1095983861 12:47987121-47987143 CCTGGGCCACGGGGCCCTCCTGG - Exonic
1095985611 12:47997616-47997638 CCCGGCCCCCCTGGTCCCCCTGG - Exonic
1096009229 12:48198760-48198782 CCCGGGCCTCCGGGAGCCCAGGG + Intergenic
1096217286 12:49804934-49804956 CCTGGGCCTCAGGCTCCTCCTGG + Intronic
1100469044 12:94873800-94873822 CGCTGGCCGCGGGGTCCCCGGGG + Intergenic
1102069991 12:110010637-110010659 CCCAGGCCTCAGTGTTCCCCCGG - Intronic
1102471835 12:113163705-113163727 CCTGGGCCTGTGCGTCCCCCAGG - Intronic
1102977605 12:117217805-117217827 ACAGGGCCTCAGGGTTCCCCTGG + Intronic
1103562571 12:121800216-121800238 CCCGCGCCTCGGGGGATCCCGGG + Intronic
1104857613 12:131909388-131909410 AAGGGGCCTCGGTGTCCCCCAGG + Intronic
1105492640 13:20903057-20903079 CCCCGGCCTCGCGGTGCCCCCGG + Intergenic
1106192486 13:27465941-27465963 CCCGGGCCTGAGGGTCCTCCCGG + Intergenic
1107015386 13:35704772-35704794 CCCTGCCCTCAGGGTCCTCCGGG - Intergenic
1110980390 13:81889969-81889991 CCCAGACCTCAGGGTTCCCCAGG + Intergenic
1113422107 13:110178949-110178971 CCTGGAGCTAGGGGTCCCCCTGG - Exonic
1113423995 13:110192838-110192860 CCCGGGCCACAGGGACCCCCGGG - Exonic
1113484739 13:110645753-110645775 CCCGGGCCTCAGGGCCACCTGGG - Intronic
1113660788 13:112105186-112105208 CCCTGCCCGCGGGGACCCCCGGG - Intergenic
1113888600 13:113724895-113724917 TCCTGGCCTCGGAGTCCACCTGG - Intronic
1113948068 13:114056044-114056066 CCCAGGCCTCGGGGTTCACCTGG + Intronic
1114458446 14:22872178-22872200 CCCGGGCCATGGAGCCCCCCTGG + Exonic
1117067203 14:52022808-52022830 CCCTGGCCTCGAGTTCCCCCAGG + Intronic
1117253151 14:53954756-53954778 CCCGGGCCCCGGGGACGACCTGG - Intronic
1121253016 14:92513653-92513675 CCCGGGCCTCCGTGTGCCCCAGG + Intergenic
1122124792 14:99573149-99573171 CCGGTGCCTCGGAGTCCCCGCGG + Intronic
1122126643 14:99581990-99582012 CCTGAGCCTCGGTTTCCCCCTGG - Intronic
1122136594 14:99636333-99636355 CCTGGTCCACGGGGTCCCACTGG + Intergenic
1122786890 14:104168016-104168038 CCTGGGCCTGGGGGTGCCACAGG + Intronic
1122880821 14:104689746-104689768 CCTTGGCCTCGGGGTCCGCTTGG + Intronic
1123059183 14:105586771-105586793 CCTGAGCCTCGGGGGGCCCCTGG - Intergenic
1124340255 15:28885814-28885836 CTCGGGACCCCGGGTCCCCCCGG - Intronic
1124983312 15:34583430-34583452 CCCACGCGTCGGGGTCCCCGCGG + Intronic
1125720865 15:41844586-41844608 CCGGGGCCTCGGGCTCCACCTGG + Exonic
1125726010 15:41868469-41868491 CCCGGGCCTCCAGCTCCGCCCGG + Exonic
1129016549 15:72474210-72474232 GCCGGGCCGTGGGGTCTCCCCGG + Intergenic
1129456224 15:75677367-75677389 CCCAGGTCTCTGGGTCCCCGAGG - Exonic
1130196552 15:81784879-81784901 GCCGAGCCTCGGGCTCACCCAGG - Intergenic
1130901036 15:88206952-88206974 CCTGGGCCTGGGGGTCCCTGAGG - Intronic
1131094955 15:89649011-89649033 CCCGGCGCTGAGGGTCCCCCAGG + Exonic
1131171926 15:90184956-90184978 CCCGAGACTCCGGGTCCCCAGGG + Intronic
1132481821 16:170119-170141 CCAGGGCCTCTGGGACCTCCTGG + Intergenic
1132482689 16:174376-174398 CCAGGGCCTCTGGGACCTCCTGG + Intergenic
1132497566 16:271020-271042 CCCGCCCCACGGGGTCCTCCAGG + Exonic
1132553643 16:563689-563711 CCAGGGCCAAGGGGTCCCCAGGG + Exonic
1132689148 16:1174830-1174852 CCCTGGCCTCGAGGCTCCCCGGG + Intronic
1132746270 16:1437653-1437675 TCTGGGGCTCGGGGTCTCCCAGG + Intronic
1132747972 16:1444825-1444847 CCCAGGCCTCGGGCTCCGCTCGG - Intergenic
1132759140 16:1500511-1500533 CCCCGGCCTCGGGCGCCCCGAGG + Intronic
1132840915 16:1978153-1978175 CGCAGGCCTCAGGGTCCCTCCGG - Exonic
1132853144 16:2033703-2033725 CCAGGCCCTCGGGCTCCCACGGG - Intronic
1133036557 16:3036864-3036886 CCCGGCCCTCGGCGTCCCCCAGG + Intronic
1133350501 16:5097840-5097862 GCGGGGCCCGGGGGTCCCCCGGG + Intergenic
1133744082 16:8674391-8674413 CCCAGCCCTCGCGGTCCCTCTGG + Intergenic
1135572303 16:23558107-23558129 CCTGGGCTGCGGGGTCCCCAGGG - Exonic
1137426328 16:48384702-48384724 CCCGGGCCTCCGGGCGCCGCGGG + Intronic
1138450660 16:57092177-57092199 CCCGGGCCTGCGGGGCCCCAGGG - Intergenic
1140860047 16:79010488-79010510 CCAGGCCCTGGGGATCCCCCAGG + Intronic
1141085925 16:81095864-81095886 CCCCCGCCTCGGTGTCCCGCAGG + Intronic
1141684296 16:85561640-85561662 TCTAGGACTCGGGGTCCCCCTGG + Intergenic
1141899077 16:86978653-86978675 TCCGTGCCTCGGGCTCCCCTGGG - Intergenic
1142206546 16:88785526-88785548 CCGGGGCCTCTGGCTCCCCCAGG + Intergenic
1142278443 16:89135334-89135356 CCAGGGCCTCTGGGACCCACAGG - Intronic
1142302879 16:89268890-89268912 CCCTGGCCTGGGGCTCACCCTGG + Intronic
1142509694 17:385894-385916 CCCCGACCTCGGGGACCCTCGGG - Intronic
1142513112 17:410400-410422 ATCGGGCCTCGGGCGCCCCCGGG + Exonic
1142631499 17:1229192-1229214 CGCGCCCCTCGGGGACCCCCAGG - Intergenic
1142966475 17:3585092-3585114 CCCTGGCCTGGGGGTCCCCAGGG - Intronic
1143106647 17:4533597-4533619 CCAGGGCCTCTGGGTGCCTCAGG + Intronic
1143499584 17:7330791-7330813 CCCGGGCCTGGGGGACCTGCAGG + Intergenic
1144729726 17:17519482-17519504 CCGGGGCCTGGGAGTCCTCCTGG - Intronic
1145285847 17:21505596-21505618 CCCTGGCCTCCGGGCCCCACAGG + Intergenic
1145391752 17:22460704-22460726 CCCTGGCCTCTGGGCCCCACAGG - Intergenic
1145828277 17:27893439-27893461 CGCGGGACTCGGGGTCCTACTGG + Intronic
1145925772 17:28645380-28645402 CGCGGGGCTCGGGGACCCGCGGG + Intronic
1146058769 17:29593756-29593778 GCCCGGCCGCGGGGTCCCCGCGG - Intronic
1146750610 17:35374547-35374569 CCCGGGCCTAGGGTTCCGCAAGG - Intergenic
1146904574 17:36609714-36609736 CCTGGGCCTCGGTGCCCTCCTGG + Intergenic
1147393069 17:40122077-40122099 CCCGAGCCGCGGAGACCCCCGGG + Intergenic
1147686206 17:42288276-42288298 CCCCGACGGCGGGGTCCCCCGGG - Exonic
1148081018 17:44967795-44967817 CCCGGCCCTCCGGGGCCTCCCGG - Exonic
1148127014 17:45242201-45242223 CCTGGGCCTCAGTGTCCTCCAGG + Intronic
1148558193 17:48591051-48591073 TCTGGGCCTTGGAGTCCCCCAGG + Intronic
1148652558 17:49260361-49260383 CACGGGCCTCGGCGCCCGCCGGG + Intergenic
1148793581 17:50186885-50186907 CCTGGACCTCCTGGTCCCCCTGG - Exonic
1148796350 17:50199236-50199258 CCCGGACCTCCCGGACCCCCTGG - Exonic
1149430669 17:56593933-56593955 CCCGCGCCCCGCGGTCGCCCTGG + Exonic
1150561582 17:66300037-66300059 CTCCAGCCTCTGGGTCCCCCTGG + Intergenic
1151365386 17:73613361-73613383 CCCCGCCCTCCAGGTCCCCCTGG + Intronic
1151485265 17:74395026-74395048 CCCAGGCTTCCTGGTCCCCCTGG - Intergenic
1151767601 17:76140308-76140330 CCAGGGCGTCGGGCTCCTCCAGG + Exonic
1152087955 17:78231855-78231877 CACTGGCCTCGCGGGCCCCCTGG - Exonic
1152088390 17:78233813-78233835 CCCGAGCCCAGGGGACCCCCTGG - Intronic
1152108115 17:78342340-78342362 ACCGGGCGGCGGGGTCCCTCGGG - Intergenic
1152357420 17:79813768-79813790 TGCGGGCCTCGGGGGCCCCCAGG - Intergenic
1152433394 17:80261264-80261286 CCCGGGCCTGCAGGTCCGCCCGG + Intronic
1152468499 17:80478192-80478214 TGCGGGCCGCGGGGTCCCTCTGG - Intergenic
1152612637 17:81323177-81323199 TCCGGGCCTCGGGGGAGCCCTGG + Intronic
1152684259 17:81686399-81686421 CCCGTGCCTCAGTGGCCCCCAGG + Intronic
1152737448 17:82004409-82004431 CCGGGACCTGGGGGTCCACCGGG + Intronic
1152801556 17:82333250-82333272 CCCGGTCCTCGGCCTCACCCGGG - Intronic
1152806055 17:82356885-82356907 CTCGGGCCTCGGCCTCACCCTGG - Intergenic
1152987680 18:334924-334946 CCCGGCCCTCAGGGCCCTCCTGG - Exonic
1153794455 18:8609645-8609667 CCCGGGCCCCGGCGCCCCCTCGG - Exonic
1154327411 18:13401541-13401563 CCAGGGCCTCGGGGACGCACAGG - Intronic
1154954679 18:21242402-21242424 CCCGCGCCCCGGAGTCCCCGCGG - Intronic
1155053877 18:22169224-22169246 CCCTGGGCTCGGTGCCCCCCGGG + Intergenic
1155910338 18:31498155-31498177 CCCTGGCCCCGGCCTCCCCCCGG - Exonic
1156350562 18:36298071-36298093 CCGGGGCTTCGTGGGCCCCCTGG + Intronic
1160580982 18:79884477-79884499 CCCCGGCCACTGGGTCCCCGGGG + Intronic
1160594652 18:79965006-79965028 CCAGGACCGCAGGGTCCCCCAGG - Intronic
1160721030 19:596971-596993 CCCAGGCCTCGGTTTCCCCTTGG + Intronic
1160751659 19:737254-737276 CCTGGGCCTCGGTGTCTGCCAGG - Intronic
1160772629 19:839863-839885 CCCGGGAGCTGGGGTCCCCCGGG + Intergenic
1160823503 19:1068752-1068774 CCCAGGCCTCGGTGTCCCCGTGG - Intronic
1160971041 19:1767902-1767924 CCAGGGCCCCGGGGACCCCCAGG + Intronic
1161134802 19:2613481-2613503 CCAGGAGCTGGGGGTCCCCCTGG - Intronic
1161226736 19:3150423-3150445 CCCGGGAATTAGGGTCCCCCTGG - Intronic
1161234220 19:3190018-3190040 TCCGGGCCTCGAGCTCCCGCAGG - Intronic
1161252188 19:3286103-3286125 CCCGGGCCTCTGGGACCCGCGGG + Intronic
1161272490 19:3397718-3397740 CCCGCCCCTTGGGGTCACCCTGG + Intronic
1161280578 19:3443504-3443526 CCAGGAGCTGGGGGTCCCCCTGG - Intronic
1161282661 19:3454166-3454188 GGCGGGCACCGGGGTCCCCCAGG - Intronic
1161314690 19:3612435-3612457 CCCGGGCCTCGGCCTCCCCCTGG + Intronic
1161553537 19:4927929-4927951 CCAGGAGCTGGGGGTCCCCCTGG - Intronic
1161743070 19:6036392-6036414 CCAGGGCCTGGGGGTCACTCTGG + Intronic
1161993220 19:7697150-7697172 CCCCAGCCTCGTGGTTCCCCAGG + Intronic
1162127362 19:8506671-8506693 CCAGGGTCCCGGGGGCCCCCAGG - Intergenic
1162321599 19:9973935-9973957 CCAGGTCCTCGGGGTCCCCAAGG - Exonic
1162322280 19:9977399-9977421 CTGGGGCCTCTGGGACCCCCTGG - Exonic
1162341060 19:10091812-10091834 CCCGTGCCTGAGGGTCCCCATGG + Intronic
1162567652 19:11453139-11453161 CCCGGGGCTCAGCCTCCCCCTGG - Exonic
1162572177 19:11480130-11480152 CCCGGGCCTCGGCCGCACCCGGG - Intronic
1163118072 19:15200167-15200189 CCAGGGCCTCCGGGTCCCCGCGG + Intronic
1163284058 19:16335342-16335364 CCCTGGCCTTGGGGGCCGCCCGG + Intergenic
1163432044 19:17274051-17274073 CCCGGGCCCCAGGGGACCCCAGG - Intronic
1163708610 19:18832351-18832373 CCCGGGCCGCCGGGGCCGCCGGG - Exonic
1165213895 19:34255191-34255213 CCCGGCCCTCCCGGTCCCCGCGG - Intronic
1165349648 19:35268998-35269020 CGCCGGGCTCGGGGCCCCCCCGG + Intronic
1165419867 19:35717529-35717551 CCAGGGCCTCGGGGGTCCCGGGG + Intergenic
1165772413 19:38387069-38387091 CCCGGGACTCATGGTACCCCGGG - Exonic
1165922032 19:39305277-39305299 CCCTGGCCTCAGGGGGCCCCTGG + Intergenic
1166219317 19:41354537-41354559 CTAGGACCTCGGGGTCCCTCTGG - Exonic
1166960711 19:46494424-46494446 CCCGGGCCCAGGGGTCCGACGGG + Exonic
1167287566 19:48607122-48607144 CACAGGCCACGGGGTCGCCCCGG + Exonic
1168076290 19:53982442-53982464 CCCGGGCCCCCGGGGCCGCCGGG - Exonic
1168105704 19:54164645-54164667 CGCGGGCCTCCCGGTTCCCCAGG + Intronic
1168689760 19:58369257-58369279 CCCGGGCCCCGGAGGCACCCTGG + Exonic
924987768 2:287748-287770 CCCGGGGCTCCGCGCCCCCCCGG + Exonic
927895688 2:26780317-26780339 GCTGGACCTGGGGGTCCCCCAGG - Exonic
928022513 2:27715756-27715778 CCCCGGCCTCTGGGCCCCTCTGG - Intergenic
929560717 2:42954750-42954772 GCCGGGCTTGGGGATCCCCCAGG - Intergenic
930096471 2:47570372-47570394 CCCGGGCCACGACATCCCCCCGG + Exonic
932316925 2:70790680-70790702 CCCGGGCCTCGTGCGGCCCCGGG - Intergenic
932771517 2:74503206-74503228 CCCGGACCCCGGGGTCACTCGGG - Intronic
932793341 2:74674494-74674516 TCCGGCCCCCGAGGTCCCCCTGG - Exonic
933729990 2:85449237-85449259 GCAGGGCCTCGGGGTGCCCTTGG - Intergenic
935234295 2:101125194-101125216 CCCTGGCCCCGGGTGCCCCCTGG - Intronic
936242595 2:110800789-110800811 CCAGGGCCTCGGTCACCCCCGGG - Intronic
937083807 2:119157989-119158011 CCAGGGCCGCGGGGGCCCCCTGG - Exonic
937357260 2:121205845-121205867 CCCGGGCCTGGGGGTGGCCAGGG - Intergenic
941666543 2:168247908-168247930 CCCCGCCCTCGGGGTCCCCAGGG - Exonic
942458341 2:176152509-176152531 CGCGGGCCTCGGGGCGCGCCAGG + Intronic
943523600 2:188988087-188988109 CCAGGCCCTCCCGGTCCCCCTGG + Exonic
943527805 2:189039517-189039539 CCTGGCCCTCCGGGTCCCCCTGG - Exonic
946692385 2:222319428-222319450 CCCGGGCCTCGAGCCCGCCCCGG - Intergenic
947142259 2:227030505-227030527 CCAGGGCCACCAGGTCCCCCTGG - Exonic
947144344 2:227051038-227051060 CCAGGGCCTCCTGGACCCCCAGG - Exonic
947147078 2:227078016-227078038 CCTGGACCTCTGGGCCCCCCAGG - Exonic
947166430 2:227267031-227267053 CCAGGGCCTCCCGGTCTCCCAGG + Exonic
947592853 2:231395353-231395375 GCTGGGCCTTGGGGTGCCCCAGG + Intergenic
947992172 2:234496706-234496728 CCCGGGGCTCGGCGTCCCCGCGG + Exonic
948454122 2:238096901-238096923 CCAGGGCATAGGGGTCCTCCGGG + Intronic
948468345 2:238162754-238162776 CCTGGGCCTCCCGGTCCCCAGGG + Exonic
948468348 2:238162763-238162785 CCCGGTCCCCAGGGCCCCCCAGG + Exonic
948699600 2:239751544-239751566 CCCTGGCCTGGGTGTCCCCTGGG - Intergenic
948777617 2:240297793-240297815 ACCTGGCCTCGGGGTCTCTCGGG + Intergenic
949040130 2:241844174-241844196 GCCGGGCCTCGGGGCTCCCCGGG - Intergenic
1169120439 20:3092794-3092816 CGCGGGCCTCGGGGACCCGAGGG + Intergenic
1170613210 20:17930272-17930294 CCCTGCCCTCGGGGTATCCCTGG + Intergenic
1171389340 20:24791108-24791130 CGTTGGCCTCTGGGTCCCCCTGG - Intergenic
1172125559 20:32623378-32623400 CCCTTGCCTCGGTGTCCCCAGGG - Intergenic
1172183431 20:33017130-33017152 CTGGGGCCTCTGGGACCCCCTGG + Intronic
1172505053 20:35455354-35455376 TCTGGGCCTCGGGTTCCTCCCGG - Exonic
1172688966 20:36777699-36777721 CCTTGCCCTGGGGGTCCCCCAGG + Exonic
1173625252 20:44467623-44467645 CCCGGGCCTGGGGTTCCCTAAGG - Intergenic
1173734220 20:45348192-45348214 CCCGGGCCTCGGTGTCCGGTTGG + Intronic
1173750305 20:45470622-45470644 CCCCGGACCCGGGGACCCCCGGG + Intronic
1173827674 20:46057919-46057941 CTGGGGCCTTGGGGACCCCCAGG + Intronic
1173843582 20:46174514-46174536 CCTGGGCCTCGTCGTCCCCGCGG + Exonic
1173866855 20:46317802-46317824 CCAGTGCCCCAGGGTCCCCCCGG - Intergenic
1174402950 20:50285727-50285749 GCCCGGCCTCCTGGTCCCCCGGG + Intergenic
1174552530 20:51372400-51372422 CCAGGGCCTGGGGCTCTCCCGGG - Intergenic
1175266090 20:57704321-57704343 CCCCAGCCTCGGGGAGCCCCTGG + Intronic
1175579400 20:60087447-60087469 GCCGGGCCTCGGCGTCCCCGCGG - Intergenic
1175579430 20:60087541-60087563 GCCGGGCCTCGGCTTCCCCGCGG - Intergenic
1175579445 20:60087588-60087610 GCCGGGCCTCGGCTTCCCCGCGG - Intergenic
1175579472 20:60087682-60087704 GCCGGGCCTCGGCTTCCCCGCGG - Intergenic
1175999643 20:62826116-62826138 CAAGGCCCTCGGGGTACCCCTGG - Intronic
1176005587 20:62860969-62860991 CCCCGGCCTCGGCCTCCACCCGG + Intronic
1176056158 20:63150432-63150454 CCCGGGGCTCTGAGTCTCCCCGG - Intergenic
1176088026 20:63306903-63306925 CCCTGGACTTGGGCTCCCCCAGG + Intronic
1176117654 20:63440061-63440083 CCCGTTCCTCTGGGTCCCTCTGG - Intronic
1176131575 20:63498800-63498822 CCCGGCCCGCAGGGTCCCCGCGG + Intronic
1176385844 21:6138230-6138252 CCCGCTCCTCCGGGGCCCCCAGG - Intergenic
1178327846 21:31659926-31659948 GCCAGGCCTCGGGGCCGCCCTGG + Intronic
1178460535 21:32798368-32798390 CCCTGGCCTCGGAGTCTCTCTGG + Intronic
1178485920 21:33020193-33020215 CCCGGGCTTCGGGCCTCCCCAGG - Intergenic
1179631806 21:42683546-42683568 CCCAGGCCTCCGGGGCCGCCTGG + Intronic
1179718555 21:43302614-43302636 CCCCGTCCTGGGGGTGCCCCAGG + Intergenic
1179737629 21:43400022-43400044 CCCGCTCCTCCGGGGCCCCCAGG + Intergenic
1180071598 21:45439550-45439572 CCTGGGCCTCTGGCTCCCCCTGG + Intronic
1180085192 21:45505173-45505195 CCTGGACCTCAGGGACCCCCCGG + Exonic
1180085256 21:45505369-45505391 CCCGGCCCTCCGGGCCCCCCTGG + Exonic
1180091347 21:45535162-45535184 CCTGGGCCGGGGGGTCTCCCTGG + Intronic
1180843802 22:18970918-18970940 GCCCAGCCTCGGGGACCCCCGGG - Intergenic
1181719398 22:24762408-24762430 CCAGGTGCTCTGGGTCCCCCAGG + Exonic
1181811233 22:25405020-25405042 CCCGGGACGCGGCGTCCCCGGGG + Intronic
1182283769 22:29232333-29232355 CCAGGGCCTCCTGGCCCCCCTGG + Exonic
1182303014 22:29349319-29349341 CCCGGGCCTCAGGCTCATCCAGG + Exonic
1182583100 22:31327046-31327068 CCGGGCTCTCGGGGGCCCCCTGG - Exonic
1183738967 22:39659652-39659674 CCCTGGACTAGGGGTACCCCAGG + Intronic
1183933610 22:41249596-41249618 CCCAGGCCTCGGGGCCCCGTGGG + Intronic
1184045955 22:41972202-41972224 CCGGGGTCTGGGGATCCCCCTGG - Intergenic
1184686112 22:46097061-46097083 AGCGGGCCTCTGGGTCACCCTGG + Intronic
1184718828 22:46297206-46297228 CTCGGGCCCTGGGGTCCCCTGGG + Intronic
1184785652 22:46670462-46670484 CCCAGGCCTAGGGGTCCAACAGG - Intronic
1185138906 22:49089432-49089454 CCCAGGCCCCGGACTCCCCCAGG + Intergenic
1185324275 22:50218006-50218028 CCCAGGCCTGGGGGCCCCCTGGG - Exonic
1185397469 22:50600432-50600454 CGCGGGCCTCGGGTTCGCCGTGG - Intronic
1185415171 22:50705638-50705660 CCCGGGCCTGGGGGGAGCCCTGG + Intergenic
950304800 3:11909644-11909666 CCAGGGCTTCGGGATCCTCCTGG - Intergenic
953875149 3:46662427-46662449 CCCGGTCCCTGGGGTCGCCCTGG - Intergenic
953979823 3:47408000-47408022 CCCGGGCCTCTGGGGGCCCCAGG + Intronic
954082783 3:48222245-48222267 CCCTGGCCTCGGGTTTCCCTGGG - Intergenic
954136789 3:48585582-48585604 CCCGGCCCCCAGGGGCCCCCTGG - Exonic
954671040 3:52291552-52291574 CCCCTGCCTTGGGGTACCCCAGG - Intronic
956453199 3:69394266-69394288 CGTGGGCCTGGGGGTCCCCATGG - Intronic
960047431 3:113211659-113211681 GCCGGGGCTCAGGGTCCCCGCGG - Exonic
961827220 3:129605493-129605515 CGCGGGCCGCGGGGGACCCCTGG + Exonic
961942976 3:130656601-130656623 CCCAGGCTTCGGGCTCCCCCTGG + Intronic
966712010 3:182980694-182980716 CCCGGGCGCGGGGGTCCCCCGGG + Intronic
966915369 3:184581632-184581654 CACGGTCCTCAGGGTCCCCGTGG - Exonic
967087300 3:186107672-186107694 CCCGCGCCCCGGGCGCCCCCAGG + Intronic
968433989 4:575786-575808 CCCGGGTTTGGGGGTCCCCGCGG - Intergenic
968509010 4:987252-987274 CCGCGGCCTCCGGGACCCCCTGG + Intronic
968572271 4:1347968-1347990 CCCCAGCCTCAGGGTCCTCCCGG + Intronic
968741674 4:2334532-2334554 CCTGTGCCCCGGGGTCCCCTGGG + Intronic
969621328 4:8280320-8280342 CCTGGGCCTGGGGGTTGCCCTGG + Intronic
971272150 4:25160196-25160218 CCCGGGGCTCTGGCTCCGCCGGG - Intronic
977231136 4:94452240-94452262 CCCGGGCTGCGGGGACCCCAGGG - Intronic
980053828 4:128061646-128061668 CCCTGGCCTCGGGGCCACCCCGG + Intronic
980686913 4:136240731-136240753 TCAGGGCAGCGGGGTCCCCCAGG - Intergenic
981348367 4:143700456-143700478 CCCTGGACTCCGGGTGCCCCTGG - Exonic
981550273 4:145936586-145936608 CCCGCGCCTCCGTGTCACCCGGG - Intronic
984767480 4:183410559-183410581 CCCGGGCTTCGGAGCCCCTCTGG - Intergenic
984869744 4:184315716-184315738 CCCTGGCCTCGGAGTCTCTCTGG - Intergenic
985648006 5:1094065-1094087 CCCCGGCCTGGGGGCCCCCAGGG + Intronic
985692968 5:1323604-1323626 TCTGGGCCTCAGTGTCCCCCTGG - Intronic
985696794 5:1345277-1345299 CTAGGGCCGCGGGGTCCCCGGGG + Intergenic
985707910 5:1412270-1412292 CCCCTGCCACGGGGTCCCGCAGG + Intronic
992102374 5:73419767-73419789 GCCGGGCCTCGCCCTCCCCCGGG - Intergenic
995733006 5:115265468-115265490 CCCGGGCCTCCGGGCCTCCCAGG + Intergenic
997265986 5:132495908-132495930 CCCCGGCCTCGGGGCCCCATGGG - Intergenic
998093318 5:139383223-139383245 TCCGGCCCTCGAGGTCCTCCTGG + Exonic
999153571 5:149442394-149442416 CCAGGCCCTCTGGGTCCCCAGGG - Intergenic
999375709 5:151085379-151085401 TCCAGGCCTTGGGGTCCTCCTGG - Intronic
1000014648 5:157266324-157266346 GCCGGGCCTCGGGCTAGCCCGGG - Intronic
1000288194 5:159846186-159846208 CCCCAGCCTCAGGGTCCCCAAGG + Intergenic
1002044020 5:176532171-176532193 CCCTGGCCTCGAGGGCCCCCTGG - Exonic
1002299995 5:178252569-178252591 CCCGGACCACAGGGGCCCCCAGG - Exonic
1002302161 5:178263278-178263300 GCTGGGCCTCCGGGGCCCCCTGG - Exonic
1002682864 5:180981841-180981863 CCCGGTCCTCGGGGGACCCAGGG - Intergenic
1003139145 6:3456731-3456753 CCCGGGGCGCGGGGTCCGGCGGG - Intronic
1005584169 6:27259931-27259953 CCCTGGCCTCGAGTTCCTCCTGG + Intergenic
1005989140 6:30892418-30892440 CCCGGGCTCTGGGGTCCCCCAGG - Exonic
1006083522 6:31580984-31581006 CCCTGGCGGCGGGGACCCCCAGG - Exonic
1006089639 6:31620810-31620832 CCCGGGCCTAGGGGCTCCCCGGG - Exonic
1006295092 6:33166736-33166758 CCTGGGCCTCAGGGCTCCCCTGG - Exonic
1006296127 6:33170880-33170902 CCCGGAGCTCGGGGACCCCAGGG - Exonic
1006296355 6:33171738-33171760 CCAGGCCCGCAGGGTCCCCCTGG - Exonic
1006316778 6:33296135-33296157 CGGGGGCCTGGGGGTCCACCCGG + Exonic
1006752692 6:36388295-36388317 CCTGGGCCTCTGGGTGCTCCGGG + Intergenic
1007406355 6:41638280-41638302 CTCGGGCCTCGGGCGCCCCGCGG + Intronic
1008854112 6:56060907-56060929 CCAGGTCCTCAGGGACCCCCAGG - Exonic
1009935753 6:70232681-70232703 CCTGGCCCTCCTGGTCCCCCCGG - Exonic
1009938034 6:70256775-70256797 CCTGGGCCTCAGGGTCTTCCTGG - Exonic
1009940190 6:70281415-70281437 CCCGGGCCTCCGGGCCCCCCTGG - Exonic
1011822554 6:91270961-91270983 CCCAGACCTCAGGGCCCCCCAGG - Intergenic
1013980396 6:116121481-116121503 CCAGGCCCTCAGGGTCCCACAGG - Exonic
1015806900 6:137118908-137118930 GCCTGACCTCGGGGTCCCCTGGG - Intergenic
1016010589 6:139134903-139134925 CCCGGGCCTCCTGGACTCCCGGG - Intergenic
1019305490 7:332587-332609 ACCGGGCGCCGGGGTCTCCCTGG + Intergenic
1019379181 7:712356-712378 CCCGGGCCTGGGAGGCCCCCCGG - Intronic
1019428236 7:987284-987306 CTCGTCCCTGGGGGTCCCCCGGG - Intronic
1019429250 7:991100-991122 CGTGGGCCTCGGGCTCCCCTGGG - Intergenic
1019477969 7:1253057-1253079 CAGGGGCCTGGGGGTCCCCAAGG + Intergenic
1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG + Intergenic
1019664930 7:2247141-2247163 CACGGGCCTGGGGTTGCCCCAGG - Intronic
1024262371 7:47582050-47582072 ACCGCGCCTCAGGCTCCCCCAGG - Exonic
1024394242 7:48847948-48847970 CCCGCGCCGCTGGGACCCCCAGG - Intergenic
1024401023 7:48924696-48924718 CCCGCGCCGCCGGGACCCCCAGG + Intergenic
1026931127 7:74223591-74223613 CCTAGCCCTCTGGGTCCCCCGGG - Intronic
1027266322 7:76496995-76497017 CCCGGGGCACGGGGTCTCCTGGG - Intronic
1027317702 7:76995113-76995135 CCCGGGGCACGGGGTCTCCTGGG - Intergenic
1029139833 7:98401496-98401518 AGTGGGCCTCGGGGTCCCCGGGG - Intergenic
1029170615 7:98627105-98627127 CCACGCCCTCAGGGTCCCCCAGG - Intronic
1029439374 7:100578615-100578637 CCCTGTCCTCGTGGCCCCCCAGG + Intronic
1029569989 7:101362997-101363019 CCCGGGACTCCGGGTCCCCGCGG + Exonic
1029597873 7:101547209-101547231 CCAGGACCCCGGGGTCCCCCTGG + Exonic
1029598303 7:101549176-101549198 CCTGGGCCTCGAGGTCCCCCAGG + Exonic
1032092062 7:128915972-128915994 CCTGGGCCTTGGGGTTCCCTGGG + Intergenic
1033212414 7:139469823-139469845 GCCGGGCCTCAGGGTCCAGCAGG - Intronic
1033328369 7:140398160-140398182 GCCGGGCCGCAGGGTCCCCCGGG + Intronic
1033347010 7:140533456-140533478 CCAGGGCCTCCGGGTGTCCCAGG - Intronic
1034264134 7:149773134-149773156 CCCGGGCGCCTGGGTCCCCGCGG - Exonic
1034344809 7:150379538-150379560 CGCGGGGCTCGGGGCACCCCAGG - Intronic
1034347430 7:150396199-150396221 CCCAGGCCTCAGGATCCCCGAGG - Intronic
1035476982 7:159150767-159150789 CCTGGGCCTCTGGGTGCCCAGGG - Intergenic
1036184252 8:6610724-6610746 CCAGAGCCTGGGGGTCTCCCAGG + Intronic
1036482593 8:9151530-9151552 CCCGGGACTCGAGCTCCCCGCGG + Intronic
1036788880 8:11704776-11704798 GCTGGGCCTCAGGGGCCCCCGGG + Intronic
1037817590 8:22120249-22120271 CCAGCCCCTCGGGGTCACCCTGG + Intronic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1037825189 8:22156504-22156526 CCCCGGCCCCGGGCCCCCCCTGG + Exonic
1038455839 8:27671310-27671332 CCGGGGCCTCCAGGTCCACCAGG + Exonic
1041357183 8:57013640-57013662 CCCTGGCTTCGGGAGCCCCCGGG + Intergenic
1046978836 8:120313965-120313987 CCAGGACCTCAGGGTCCACCTGG + Exonic
1047779350 8:128098813-128098835 CCCAGGCCTCGGGACCCCCAGGG + Intergenic
1048843983 8:138589326-138589348 CCAGGACCTCCCGGTCCCCCAGG - Exonic
1049196874 8:141320601-141320623 ACAGGGCCTCGAGGTCCCCCAGG - Intergenic
1049197866 8:141325405-141325427 CCAGGGCCTCCGCATCCCCCGGG - Intergenic
1049643637 8:143726614-143726636 CCCGGCCTTCGGGGACTCCCCGG + Exonic
1049753004 8:144294546-144294568 TCTGGGCCTCGGTCTCCCCCAGG - Intronic
1053201039 9:36151730-36151752 CCTGTGCCCCGGGGTCCCTCTGG + Intronic
1056949414 9:91030103-91030125 CCAGGGCCTGGGAGTCACCCGGG - Intergenic
1057168630 9:92947554-92947576 CCCGGCCCTCCAGGTCCCCAAGG + Exonic
1057259857 9:93577229-93577251 TCCGGGCCTCGGCCTCCCTCCGG - Intronic
1057524537 9:95786797-95786819 CCCGGGCCTGGTGTTCCTCCAGG + Intergenic
1057619066 9:96619243-96619265 CCCGCGCCGCCGGGACCCCCAGG - Exonic
1057913057 9:99035092-99035114 CCAGGGCCTCCTGGACCCCCTGG + Exonic
1057916102 9:99056350-99056372 CCTGGGCCACCGGGGCCCCCGGG + Exonic
1059405606 9:114097044-114097066 CCAGGGCCTCGGCCTCCGCCAGG - Intronic
1059438976 9:114292118-114292140 CCCGGACAGCTGGGTCCCCCTGG + Exonic
1059456261 9:114402197-114402219 CTGGGGCCTTGGGGTCCCCAGGG + Exonic
1060514632 9:124258112-124258134 TCCGGGCCGCGGGGCCCCACCGG - Intronic
1060966781 9:127716113-127716135 CAGAGGCCTCGGGGTCCTCCTGG + Exonic
1061037565 9:128122109-128122131 CCCGGGCCTCTGGATCCAGCAGG + Intronic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061195192 9:129103531-129103553 TCTGGGCCTCTGTGTCCCCCAGG + Intronic
1061489991 9:130939377-130939399 CCCAGACCTCGGGGGCCCGCAGG - Intergenic
1061515946 9:131090547-131090569 CCAGGGCCTCGGGGATCCCAGGG + Intronic
1061536351 9:131252557-131252579 CCCGGTCCTCTGTGGCCCCCAGG + Intergenic
1062032142 9:134366531-134366553 CATGGGCCTCCAGGTCCCCCGGG + Intronic
1062111590 9:134785067-134785089 CCCGGTCCTCTGGGACCCCCTGG + Exonic
1062115530 9:134806249-134806271 CCTGGGCCCCAGGGACCCCCAGG + Exonic
1062237869 9:135521386-135521408 CGCTGGGCTCAGGGTCCCCCAGG - Intergenic
1062342643 9:136100583-136100605 CCCTGGGCTCTGGGGCCCCCTGG - Intergenic
1062414832 9:136443028-136443050 CCCGGGCACCCGGGTCTCCCCGG - Intronic
1062426683 9:136509224-136509246 GCCGGGCCCCGGGTTCCCACTGG - Intronic
1062490438 9:136802799-136802821 CCCAGGGCTGGGGGCCCCCCAGG + Intronic
1062490464 9:136802867-136802889 CCCAGGGCTGGGGGCCCCCCAGG + Intronic
1062490517 9:136803003-136803025 CCCAGGGCTGGGGGCCCCCCAGG + Intronic
1062490595 9:136803206-136803228 CCCAGGGCTGGGGGCCCCCCAGG + Intronic
1062499176 9:136845016-136845038 CCCGGGGCTCGCGGTCCTGCGGG + Exonic
1062600155 9:137315888-137315910 CCTGGGCCTCGGGCTCCCTCCGG + Intronic
1189333830 X:40158207-40158229 ACTGGCCCTCGGGGTCCCCGTGG + Intronic
1190775123 X:53546502-53546524 CCCGGGTCCCAGAGTCCCCCCGG + Exonic
1192447637 X:71222918-71222940 CCAGAGCCTCTGGGTCCCCTGGG + Intronic
1193211375 X:78810707-78810729 CCCAGACCTAGGGGTTCCCCAGG - Intergenic
1195155912 X:102125004-102125026 CACGGGCTTTGGGGTCCCTCAGG + Intergenic
1195792731 X:108606835-108606857 CCAGGACCTCCGGGTCCTCCAGG + Exonic
1196951035 X:120875619-120875641 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196951866 X:120931991-120932013 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196952550 X:120936852-120936874 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196953235 X:120941713-120941735 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196953920 X:120946573-120946595 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196954605 X:120951434-120951456 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196955288 X:120956294-120956316 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196955975 X:120961177-120961199 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196956657 X:120966038-120966060 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196957339 X:120970898-120970920 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196958021 X:120975758-120975780 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196958703 X:120980618-120980640 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1196959384 X:120985478-120985500 CCGGGGCCTCCTGGTCCCCTTGG + Exonic
1197702547 X:129610170-129610192 CCAGGGCCTCAGGGCCACCCTGG - Intergenic
1197774671 X:130111155-130111177 GCCCTGCCTCGTGGTCCCCCGGG - Intergenic
1199833039 X:151563042-151563064 CCCGGGCCTTGCGGGCCCACCGG + Intergenic
1200000189 X:153056250-153056272 CCCCCGCCACGGGGGCCCCCGGG - Intergenic
1200120666 X:153788769-153788791 CCAGGGCCTGGGGCTCCCCCTGG + Intronic
1200184180 X:154170885-154170907 CCGGGGCCTTCTGGTCCCCCAGG + Intergenic
1200189833 X:154208013-154208035 CCGGGGCCTTCTGGTCCCCCAGG + Intergenic
1200195586 X:154245822-154245844 CCGGGGCCTTCTGGTCCCCCAGG + Intergenic
1200201239 X:154282943-154282965 CCGGGGCCTTCTGGTCCCCCAGG + Intronic
1200236037 X:154468185-154468207 CCCGGGCATCGAGGCCCACCCGG + Exonic