ID: 905170974

View in Genome Browser
Species Human (GRCh38)
Location 1:36109327-36109349
Sequence AGACAGAGCCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1542
Summary {0: 1, 1: 0, 2: 9, 3: 152, 4: 1380}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905170974_905170980 15 Left 905170974 1:36109327-36109349 CCCTCCTCCTTCTGGCTCTGTCT 0: 1
1: 0
2: 9
3: 152
4: 1380
Right 905170980 1:36109365-36109387 GTGAACAGCACTTCTGGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 116
905170974_905170982 30 Left 905170974 1:36109327-36109349 CCCTCCTCCTTCTGGCTCTGTCT 0: 1
1: 0
2: 9
3: 152
4: 1380
Right 905170982 1:36109380-36109402 GGCTCAGGCCCTCCCTATCAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
905170974_905170979 9 Left 905170974 1:36109327-36109349 CCCTCCTCCTTCTGGCTCTGTCT 0: 1
1: 0
2: 9
3: 152
4: 1380
Right 905170979 1:36109359-36109381 CAACAGGTGAACAGCACTTCTGG 0: 1
1: 0
2: 2
3: 7
4: 115
905170974_905170981 29 Left 905170974 1:36109327-36109349 CCCTCCTCCTTCTGGCTCTGTCT 0: 1
1: 0
2: 9
3: 152
4: 1380
Right 905170981 1:36109379-36109401 TGGCTCAGGCCCTCCCTATCAGG 0: 1
1: 0
2: 1
3: 9
4: 146
905170974_905170978 -7 Left 905170974 1:36109327-36109349 CCCTCCTCCTTCTGGCTCTGTCT 0: 1
1: 0
2: 9
3: 152
4: 1380
Right 905170978 1:36109343-36109365 TCTGTCTCTGTCATCACAACAGG 0: 1
1: 0
2: 4
3: 37
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905170974 Original CRISPR AGACAGAGCCAGAAGGAGGA GGG (reversed) Intronic
900382131 1:2390229-2390251 AGACAGGCCCAGTAAGAGGAGGG + Intronic
900765256 1:4500739-4500761 ACGCATAGCCAGACGGAGGAGGG + Intergenic
900805316 1:4763744-4763766 AGACAGAGGGAGAGGGAGAAAGG - Intronic
901004006 1:6162952-6162974 AGGGAGAGCCGGAAGGAGGGAGG + Intronic
901005972 1:6171690-6171712 AGATGGAGCCATAGGGAGGAGGG - Intronic
901125613 1:6926367-6926389 AGACAGAGAAAGAAAGAGAAAGG - Intronic
901140214 1:7024185-7024207 AGACAGAGACAACAGGAGGGAGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901232902 1:7651184-7651206 AGAAAGACCCAGAAAGAGGGTGG - Intronic
901472685 1:9468522-9468544 AGACAGAATCAGAACGAAGATGG + Intergenic
901799241 1:11697891-11697913 ATACAGAGCCACAGGGAGGCAGG + Intronic
901841603 1:11957357-11957379 AGACATAGTCATAAGCAGGACGG + Intronic
902036348 1:13461005-13461027 ACACAAAGCCAGAAGCAGGGAGG + Intergenic
902072320 1:13749997-13750019 AGACAGAGACAGGAGGCGGCGGG + Intronic
902112739 1:14096533-14096555 AGTCAGAGCATGAAGGAGAATGG + Intergenic
902243062 1:15101511-15101533 AGACATAGCCAGAGAGTGGATGG - Intronic
902489866 1:16773440-16773462 AGACAGAGACAGAGGGAAGATGG - Intronic
902765406 1:18611256-18611278 AGAAAGGGAGAGAAGGAGGAAGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902818834 1:18931250-18931272 AGACAGAAGCAGTGGGAGGAGGG - Intronic
903228740 1:21909134-21909156 GGACAGAGCCAGAAGGAGTCAGG + Intronic
903338792 1:22641896-22641918 ACACACAGCCAGAAAGGGGAAGG + Intergenic
903442010 1:23395280-23395302 AGACAGAGTCAGAAAGAGGCTGG - Intronic
903472311 1:23595700-23595722 AGTCAGAGCCAGGGGGATGATGG - Intronic
903740440 1:25555648-25555670 AGACAAAGCAAGAGGGTGGAGGG - Intronic
903883091 1:26525432-26525454 AGGCTGAGGCAGAAGGAGAATGG + Intergenic
903995667 1:27304064-27304086 AGACAGAGGGAGAAGGAGGTGGG - Intronic
904045064 1:27603775-27603797 AGAGAGAGCGGGAGGGAGGAGGG - Intronic
904270783 1:29348715-29348737 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
904396433 1:30225359-30225381 AGACAGGGCCAGTGGGAGGGAGG - Intergenic
905029375 1:34871342-34871364 ACAAGGAGCCAGGAGGAGGAAGG - Intronic
905128246 1:35731305-35731327 AGTCAGACAAAGAAGGAGGATGG + Intronic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905205641 1:36341443-36341465 GGACTGAGCAAGAGGGAGGAGGG - Exonic
905251383 1:36650932-36650954 AGGCAGAGGCAGAAGGAGGTTGG + Intergenic
905323168 1:37131895-37131917 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
905343997 1:37299163-37299185 AGACAGAACAGGAGGGAGGAGGG - Intergenic
905348458 1:37327821-37327843 TGCCAGAGCCAGAGGGAGGAGGG - Intergenic
905481984 1:38268010-38268032 AGAAAGAGAGAGAAGGAGGGAGG - Intergenic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905615372 1:39393824-39393846 AGACAGAGAGAGAGGGAGGGAGG + Intronic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906018074 1:42600848-42600870 AGAGAGAGAAAGAAGGAGGGAGG - Intronic
906102308 1:43271430-43271452 AGACAGAGACAGAAGCAAGCAGG - Intronic
906673492 1:47676956-47676978 AGACAGAGCAAGGAGGGAGAAGG - Intergenic
907428976 1:54399901-54399923 AGTCAGAGCCTGTGGGAGGAGGG - Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908199600 1:61780601-61780623 AGGCAGAGGCAGGAGGAGGGAGG - Intronic
908437860 1:64124387-64124409 AGACAGAGAGGGAAGGAGAAAGG - Intronic
908910001 1:69062271-69062293 ACACAGAGACAGAGGGAGGCGGG + Intergenic
908912762 1:69091606-69091628 ACACAGAGACAGAGGGAGGGAGG - Intergenic
908962655 1:69717968-69717990 AGAAAGAGAAAGAAAGAGGAGGG + Intronic
909290196 1:73873405-73873427 AGACAGAGAGAAAAGAAGGAAGG + Intergenic
909358854 1:74739594-74739616 AGAAGGTGCCAGAAGGAGGCTGG + Intronic
909480699 1:76126443-76126465 AGACAGAGAGAGAGGAAGGAAGG - Intronic
909699776 1:78510415-78510437 AGAGAGAGTAAGAAAGAGGAAGG + Intronic
909772185 1:79437704-79437726 AGAGAGAGAGTGAAGGAGGAAGG - Intergenic
909901661 1:81144654-81144676 AGACAAAGACATATGGAGGATGG - Intergenic
910367707 1:86484444-86484466 ATACACAGCCAGAATGAGAATGG + Intronic
910499395 1:87872127-87872149 AGACAGAGAAAGAAGGATGAAGG - Intergenic
910631365 1:89358389-89358411 AGACAGAGACAGAGAGAGGGAGG - Intergenic
910954828 1:92690670-92690692 AGACTGAGCCAAGAGGTGGAAGG + Intronic
910966534 1:92813727-92813749 GGAGAGAGTAAGAAGGAGGAGGG + Intergenic
911120073 1:94287365-94287387 AGACAGAGCTAGCAAGAGCAGGG - Intergenic
911247209 1:95531713-95531735 AGAGAGAGAAAGAAAGAGGAGGG + Intergenic
911677364 1:100674756-100674778 TGGCAGAGCCACAAGGTGGAAGG + Intergenic
912134166 1:106638729-106638751 AGAAAGAGAGAGAGGGAGGAAGG + Intergenic
912220239 1:107665751-107665773 AGCCTGATCCAGAGGGAGGAGGG + Intronic
912372122 1:109181829-109181851 AGACAGAGACAGAAGAGGTATGG + Intronic
912510802 1:110188967-110188989 ACCCAGAGCCTGGAGGAGGAAGG - Intronic
912595590 1:110872667-110872689 AGACAGAGGGAGTATGAGGAGGG + Intergenic
912609429 1:111028273-111028295 GTACAGAGACAGAAGGAGGGGGG - Intergenic
912718327 1:111998715-111998737 GGACAGAGCCACAAGAAGGAAGG + Intergenic
912730002 1:112093778-112093800 AGAGAGAGACAGAATGAGGGAGG + Intergenic
912763377 1:112387832-112387854 AGACAGAGAGAGAGGAAGGAAGG + Intergenic
913139243 1:115924093-115924115 AGTCAGAGACAAAAGAAGGAAGG - Intergenic
913305338 1:117424692-117424714 AGGCTGAGGCAGATGGAGGATGG - Intronic
913537123 1:119783779-119783801 AGAAAGAGAAAGAAGAAGGAAGG - Intergenic
913610324 1:120504343-120504365 AAATAGAGCCAGAAACAGGAAGG + Intergenic
913984474 1:143552491-143552513 AAATAGAGCCAGAAACAGGAAGG - Intergenic
914580867 1:149017896-149017918 AAATAGAGCCAGAAACAGGAAGG - Intronic
914724441 1:150315922-150315944 AGAAGGATCCAGAGGGAGGAAGG - Intergenic
915116458 1:153603739-153603761 ATACAGAGACAGAGGGAGGGGGG - Intergenic
915132820 1:153707701-153707723 AAAAAGAGACAGAAAGAGGAAGG + Intergenic
915579733 1:156806210-156806232 AGACAGAAACAGAAGGAGCCTGG + Intergenic
915706606 1:157849751-157849773 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
915720552 1:157982058-157982080 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
916018274 1:160769985-160770007 AGATTGAGCCAGATGGAGAAAGG + Intergenic
916300822 1:163272013-163272035 AGACAGAGAGAGAGGAAGGAAGG - Intronic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
916759475 1:167803572-167803594 AATCACAGCCAGATGGAGGAGGG + Intergenic
916771434 1:167912633-167912655 ATACAGAGACAGAGGGAGGGGGG - Intronic
916964169 1:169918122-169918144 AGACAGAACCAACAGGAGGGAGG - Intergenic
917022429 1:170603526-170603548 AGACAGAGCTAGGAGTTGGAGGG - Intergenic
917080178 1:171249718-171249740 AGAGAGAGACAGAGGGAGTAGGG + Intronic
917148214 1:171915504-171915526 GGATAGAGGTAGAAGGAGGATGG + Intronic
917304403 1:173612262-173612284 AGAAAGAGAGAGAGGGAGGAAGG + Intronic
917354712 1:174115005-174115027 AGAGAAACACAGAAGGAGGAAGG - Intergenic
918076736 1:181176314-181176336 AGACAGAGGAAGAGAGAGGAAGG + Intergenic
918209091 1:182335025-182335047 AGAAAGAGACAGAGGAAGGAAGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919293249 1:195661200-195661222 GGACAGAGCAAAAAGAAGGAAGG - Intergenic
919870587 1:201817989-201818011 AGGCTGAGACAGGAGGAGGATGG + Intronic
919967329 1:202541139-202541161 ATACAGAGTAAGAAGAAGGACGG + Intronic
920164599 1:204026604-204026626 AGACAAAGGCAGAGGGAGGAAGG + Intergenic
920170096 1:204066595-204066617 AGACTGAGGCACAAGAAGGAGGG - Intergenic
920262142 1:204695828-204695850 ACACAGAGCCTGAGGGAGGCTGG + Intergenic
920454873 1:206093058-206093080 TGACAGAGCCAGGAGAAGGCAGG + Intronic
920606703 1:207396033-207396055 AGCCAGAGGCAGAAGGAAGATGG + Intergenic
920617450 1:207507426-207507448 ACACAGACCCAGAGGGAAGACGG - Intronic
920620110 1:207537228-207537250 ACACAGACCCAGAGGGAAGATGG - Intronic
920621892 1:207555783-207555805 ACACAGACCCAGAGGGAAGATGG - Intronic
920623518 1:207572877-207572899 ACACAGACCCAGAGGGAAGATGG - Intronic
920636084 1:207705128-207705150 ACACAGACCCAGAGGGAAGATGG - Intronic
920942339 1:210495564-210495586 AGAAAGAGGGAGAAGGAGGGAGG - Intronic
921266924 1:213428513-213428535 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
921525348 1:216210445-216210467 AGAAAGAGCAGGGAGGAGGAGGG - Intronic
922232714 1:223700412-223700434 AGAAAGAGAGAGAGGGAGGAGGG + Intergenic
922321047 1:224487385-224487407 ACAGAAAGACAGAAGGAGGAAGG - Intronic
922550607 1:226491473-226491495 ATACAGAGACAGAGGGAGGGGGG + Intergenic
922787191 1:228288762-228288784 AGACATAGCCTGAGGCAGGACGG + Exonic
922788097 1:228293490-228293512 AGACACAGCCTGAGGCAGGACGG + Exonic
922788234 1:228294289-228294311 AGACACAGCCTGAGGCAGGACGG + Exonic
922788854 1:228298591-228298613 AGATACAGCCTGAAGCAGGATGG + Exonic
922789669 1:228304440-228304462 AGACACAGCCTGAGGCAGGATGG + Exonic
923090260 1:230735283-230735305 AGAAGGAGCGAGAAGGAAGAAGG - Intergenic
923148811 1:231216272-231216294 AGAGAGAGAGAGAAGGAGGGAGG - Exonic
923235734 1:232031192-232031214 AGACAGAGAGAGAGGAAGGAAGG + Intronic
923530575 1:234809088-234809110 AGACAGAGACAGAGGGAAGATGG + Intergenic
924116506 1:240753081-240753103 AGACAGAGAGAGAGGGAGGGAGG - Intergenic
924168800 1:241315013-241315035 AGACAGAGTAAGAAAAAGGATGG + Intronic
924767237 1:247045460-247045482 AGTCAGAGAGAGGAGGAGGAAGG - Intronic
924817082 1:247451917-247451939 AGACACACCCAGAAGGATGAAGG + Exonic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063107099 10:3001980-3002002 AGAGAGAGAGAGAAGGAGAATGG + Intergenic
1063225749 10:4013347-4013369 AGAAAGAGGAAGAGGGAGGACGG - Intergenic
1063362407 10:5469177-5469199 AGACAGAGGAAGGAGGAGGGAGG - Intergenic
1063524606 10:6773135-6773157 AGAGAAAGAAAGAAGGAGGAAGG - Intergenic
1063625138 10:7682093-7682115 AGAAAGAGAGAGAAGAAGGAAGG + Intergenic
1063681900 10:8196314-8196336 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
1063692177 10:8297199-8297221 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1063715796 10:8525720-8525742 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
1063876480 10:10484196-10484218 AGACAGAGAGAGGAGGGGGAGGG - Intergenic
1063910352 10:10822715-10822737 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
1063929000 10:11010311-11010333 AGCCAGACCCAGAGGGAAGAGGG - Intronic
1064055079 10:12090471-12090493 AGAGAGAGAAAGAAGAAGGAAGG - Intronic
1064541219 10:16406859-16406881 AGAAAGACCCAGAAAGAGGGTGG + Intergenic
1064557959 10:16566507-16566529 AGGCAGAGCGAGAGGGAGGGAGG + Intergenic
1064955615 10:20905440-20905462 AGAGAGAGCCAGCAAGAGCAGGG + Intronic
1065121992 10:22539180-22539202 ACACAGAGCCAGGAGGGGGCTGG + Intronic
1065218083 10:23470048-23470070 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1065251262 10:23816806-23816828 AGGCATAGTCAGAAGGAGAATGG + Intronic
1065492095 10:26292371-26292393 AGACAGAGACGGCAGGATGACGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065781402 10:29171685-29171707 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1065893882 10:30144290-30144312 AGACAGAGTAGGAAGGAGGACGG + Intergenic
1066110025 10:32187649-32187671 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1066254189 10:33662764-33662786 GGAAAGAGCCAGAAAGAGGCAGG - Intergenic
1066389551 10:34967793-34967815 AGACAGGGTGAGAAGGAGGGAGG + Intergenic
1066420099 10:35257235-35257257 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1066561246 10:36672146-36672168 AGACAGAGAGAGAGGGAGGCAGG + Intergenic
1066575798 10:36823352-36823374 AAACACAGCCAGAAGCAGAAGGG - Intergenic
1066690184 10:38018675-38018697 AGACAGAGCCGGAAGGCAGGAGG + Intronic
1066713909 10:38265867-38265889 AGAGAGAGAGACAAGGAGGAAGG - Intergenic
1067009586 10:42697961-42697983 AGAAAGAGACAGAGGGAGAAGGG - Intergenic
1067143180 10:43673257-43673279 ATACAGGGCCAGAAGGCAGAGGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1067730072 10:48804190-48804212 AGCCTGAGCCAGGAGGAGGCAGG - Intronic
1068799292 10:61121355-61121377 AGACAGAGAAAGAGGAAGGAAGG - Intergenic
1068846437 10:61680960-61680982 AGAGAGAGAGAGAACGAGGATGG - Intronic
1069067554 10:63959509-63959531 ATACAGATTCAGAAGGGGGAGGG + Intergenic
1069646751 10:70005226-70005248 AGAGAGAGCCAGAGAGAGGAAGG + Intergenic
1069719826 10:70542225-70542247 AGAATCAGCCAGAAGAAGGAAGG - Intronic
1069725808 10:70577454-70577476 AGAAAGAGAAAGAAAGAGGAAGG - Intergenic
1069777928 10:70937662-70937684 GGACAGAACCAGAGGGAGGGCGG + Intergenic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1069979447 10:72242177-72242199 AGACAGAGCCAGAATGCTGTGGG + Intergenic
1070490234 10:76969241-76969263 AGAAAGAGAGAGAAGGAGGAAGG + Intronic
1071088480 10:81891942-81891964 GGACAGAGCGAGACAGAGGAAGG - Intronic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071459936 10:85883473-85883495 AGACAGAGAGAGAAGGACAAAGG - Intronic
1071515633 10:86294911-86294933 CCACAGAGCCAGGAGGAGGGAGG + Intronic
1071516337 10:86300445-86300467 TGACAGAGCCAGAGGGAACAGGG + Intronic
1071723842 10:88176071-88176093 AGACAGAGCCTGAAAGTGAAGGG - Intergenic
1071928540 10:90439154-90439176 ACACAAAGCCAGAAAGAAGAAGG - Intergenic
1072247259 10:93554743-93554765 AAGCAGAGCCACAAGGAGAAGGG - Intergenic
1073940003 10:108686093-108686115 AGAGAGAGAGAGAGGGAGGAGGG + Intergenic
1074480949 10:113820153-113820175 AGACGGAGGAAGAAGGAGAAGGG + Intergenic
1074724087 10:116289718-116289740 AGACAGAGAAGGAAGGAGGAAGG - Intergenic
1074724097 10:116289778-116289800 AGAGAGAGAAGGAAGGAGGAAGG - Intergenic
1074724104 10:116289812-116289834 AGACAGAGAAGGAAGGAGGAAGG - Intergenic
1074724111 10:116289842-116289864 AGAGAGAGTCGGGAGGAGGAAGG - Intergenic
1074804094 10:117029861-117029883 AGACAGAGAGAGAGGGAGGGAGG - Intronic
1075407615 10:122205006-122205028 TGACAGAGCCATAGTGAGGATGG - Intronic
1075410326 10:122223026-122223048 AGAGAGAGAGAGGAGGAGGAAGG - Intronic
1075657777 10:124173460-124173482 GGGCAGAGGCTGAAGGAGGAGGG - Intergenic
1075670534 10:124261197-124261219 AGATAGAGCCAGAACAGGGAAGG + Intergenic
1076228487 10:128800129-128800151 TGACAAAGGCAGCAGGAGGAAGG + Intergenic
1076238605 10:128884686-128884708 AGGCAGGGCCGGAAGGAGGGAGG - Intergenic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076724260 10:132406034-132406056 AGTCTCGGCCAGAAGGAGGACGG + Exonic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077044262 11:537535-537557 AGACAGCGCCTGGAGGTGGAGGG + Exonic
1077091061 11:778477-778499 AGACAGAGCCAGCAGGCGAGCGG + Intronic
1077466458 11:2735928-2735950 AGTCAGAGGCAGGAGGAGGTGGG + Intronic
1077507769 11:2940098-2940120 AGACAGAGGCAGAAATCGGAAGG + Intergenic
1077522809 11:3046328-3046350 AGACACAGCCAGAGGGGGGCAGG - Intronic
1077610995 11:3642922-3642944 AGCCAGAGCCAGGAGGAGGTGGG + Intergenic
1077800069 11:5528207-5528229 GGACACAGCCAGATGGAGGCAGG - Intronic
1078059677 11:8035029-8035051 AGACTGAGTCAGGAGCAGGAAGG - Intronic
1078304426 11:10169361-10169383 AGAGAGAGAGAGAAGAAGGATGG - Intronic
1078538756 11:12196776-12196798 AGAAAGAGCCAGATCGTGGAGGG - Intronic
1078542111 11:12221144-12221166 AGTCTGGGCCAGAAGCAGGATGG - Intronic
1078551053 11:12280918-12280940 TGTCAGAGCTGGAAGGAGGAAGG - Intronic
1078646746 11:13147824-13147846 AGCAAGAGAGAGAAGGAGGAAGG + Intergenic
1078744777 11:14101525-14101547 AGAAAGAGAAAAAAGGAGGAGGG - Intronic
1078854094 11:15192179-15192201 AGAGGGAGCCAGAGGGAGGGAGG - Intronic
1078897887 11:15614105-15614127 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1079580327 11:22055778-22055800 AGACAGAGCCACCAGGGGGATGG - Intergenic
1079805088 11:24921196-24921218 ATACAGAGACAGAGGGAGGGGGG + Intronic
1080389865 11:31834842-31834864 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
1080812871 11:35723016-35723038 AGAGAGAGACAGAAGGAGGGAGG - Intronic
1081028836 11:38051676-38051698 AGAGAGAGCCAGCAAGAGCAGGG + Intergenic
1081392423 11:42544491-42544513 AGAAAGAGCAAGAAAGAGAAAGG + Intergenic
1081648370 11:44805847-44805869 AGACAGAGAGAGAGGGAAGATGG - Intronic
1081850385 11:46271631-46271653 AGACAGAGTAGGAAGAAGGATGG - Intergenic
1081882112 11:46462526-46462548 AGACAGGTCCAGATCGAGGAGGG - Intronic
1081906349 11:46672781-46672803 AGACAGTGCCAGGAGGAAGAAGG + Intronic
1082236819 11:49827302-49827324 AGAGAGAGAAATAAGGAGGAAGG + Intergenic
1082948180 11:58782404-58782426 AGAAAGAAATAGAAGGAGGATGG + Intergenic
1083077355 11:60055019-60055041 AGACAGAGACAGAAGTCAGAAGG - Intergenic
1083265068 11:61542805-61542827 AGCCAGGGCCAGAAGGTGGGTGG - Intronic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1083808643 11:65089771-65089793 AGTCTGAGGCAGAGGGAGGATGG + Intronic
1083828290 11:65215449-65215471 AGAGAGAGCGAAGAGGAGGAAGG - Intergenic
1083940812 11:65894481-65894503 CCACAGATCCAGAAGGATGAGGG - Intronic
1084051673 11:66604279-66604301 AGAAAGATCAAGAAGGGGGAGGG - Intronic
1084174241 11:67415477-67415499 ACACGGACCCAGCAGGAGGAGGG - Intronic
1084395168 11:68904516-68904538 GGAAAGAGCCTGGAGGAGGAAGG + Intronic
1084594167 11:70107291-70107313 AGACAGAGCCACCGGGAGGGTGG + Intronic
1084596940 11:70122582-70122604 AGACAGAGACAGAGAGAGGTGGG - Intronic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084607427 11:70180662-70180684 AGACAGAGACAGAGATAGGAGGG + Intronic
1084607430 11:70180686-70180708 AGACAGAGACAGAGATAGGAGGG + Intronic
1084680069 11:70661914-70661936 AGCCGGAGCCAGCCGGAGGAAGG + Intronic
1084772764 11:71354623-71354645 ATTCAGAGACAGAAGGAGTATGG - Intergenic
1084972538 11:72779776-72779798 AGACAGAGTCAGAGGGGAGAAGG + Intronic
1085031320 11:73272608-73272630 AGGCATAGCCAGGCGGAGGAAGG - Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1085160095 11:74333285-74333307 AGACAGAACCAGAGGGAATAAGG - Exonic
1085363565 11:75915768-75915790 AAACAGAACCAAAAGGAGAAAGG - Intronic
1085523934 11:77153602-77153624 AGTCAGAGCCCGATGGAGGGAGG - Intronic
1085543022 11:77289790-77289812 AGAGAGAGAGAGAAGGAGGGAGG + Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085912801 11:80848460-80848482 TGACAGACACAGAAAGAGGAAGG - Intergenic
1085983671 11:81757351-81757373 GGAGAGAGAGAGAAGGAGGAAGG + Intergenic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086134129 11:83429981-83430003 AAACAGAGCAATAAGGAAGAAGG - Intergenic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086490446 11:87353608-87353630 AGACAGCTACAGAAGGAAGATGG - Intergenic
1086593114 11:88539731-88539753 AGACAGATCCAGATGGAAGTAGG - Intronic
1086597730 11:88593753-88593775 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
1086719197 11:90099399-90099421 AGAGAGAGAGAGAAGAAGGAAGG + Intergenic
1087583988 11:100094731-100094753 AGACAGGGAAAGAAGAAGGAGGG + Intronic
1087908883 11:103729876-103729898 GGAGAGAGACAGAGGGAGGAAGG + Intergenic
1087963957 11:104389655-104389677 AGACAGAGAAAGAAAGAGAAAGG - Intergenic
1087978665 11:104583590-104583612 AGATAGAGGGAGAAGGAAGAAGG + Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088670961 11:112140241-112140263 AGAAAGAGAGAGAGGGAGGAAGG - Intronic
1088974162 11:114799969-114799991 AGAAAGAGGGAGAGGGAGGAGGG - Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089218650 11:116852275-116852297 AGGCAGAGCCCAAAGGAGGGTGG - Intronic
1089245621 11:117117336-117117358 AGAAAGAGAGAGAGGGAGGAAGG + Intergenic
1089327098 11:117664834-117664856 AGGCAAAGCCAGGAGGAGTAGGG - Intronic
1089778912 11:120859492-120859514 ACACAGAGCCCGATGGATGAAGG - Intronic
1090028187 11:123185397-123185419 AGAGAGAGAGAGCAGGAGGAAGG + Intronic
1090183396 11:124719998-124720020 AGAGAGAGAGAGAAGGAGGAAGG + Intergenic
1090347585 11:126083600-126083622 AGAGAGAGACAGAGGTAGGAAGG - Intergenic
1090485563 11:127109161-127109183 AGAGAAAGGCAGAAGGAGAAAGG - Intergenic
1090515213 11:127417688-127417710 AGACAGAGAGAGTAGAAGGATGG - Intergenic
1090608962 11:128453067-128453089 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1090612433 11:128483531-128483553 AAAAAGAGCCAGAAAGGGGAAGG + Intronic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1090941920 11:131394429-131394451 AGTCAGAGCGAGAAGGAGAGAGG + Intronic
1091028252 11:132160867-132160889 AGGCAGTGAGAGAAGGAGGAGGG + Intronic
1091123909 11:133079825-133079847 AGGCAGAGCCTGCAGCAGGATGG - Intronic
1091192840 11:133708717-133708739 AGTCAGAGGCACAAGGTGGAGGG - Intergenic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1091428005 12:408231-408253 TGACAGAGACAGAAGGAGAGAGG - Intronic
1091831125 12:3551798-3551820 AGACAGAGAGAGAGGGAGGGAGG + Intronic
1091963280 12:4717679-4717701 AGGCTGAGGCAGGAGGAGGATGG - Intronic
1092062666 12:5564037-5564059 AGAGAGAGCCAGATGGAGGGAGG - Intronic
1092508129 12:9124978-9125000 AGGCAGAGCAAGAGAGAGGATGG + Intergenic
1092564007 12:9646410-9646432 AGAGAGAGTCAAAAGGTGGAAGG + Intergenic
1092721644 12:11447022-11447044 AGACAGAGAGAGAGAGAGGAAGG + Intronic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1093045178 12:14435086-14435108 AGAGAGAGAGAGAAGGAGGGAGG + Intronic
1093363469 12:18261821-18261843 AGAAAGAGGCAGAGGGAGGGGGG - Intronic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093508395 12:19896748-19896770 AGAAGGAGGAAGAAGGAGGAAGG - Intergenic
1093655972 12:21694695-21694717 TGAGGGAGCCAGAAGGAAGATGG + Intronic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1094768098 12:33620773-33620795 TGCCAGAGCCAGAAAGTGGAAGG + Intergenic
1095095924 12:38149160-38149182 AGACAAAGACAGACAGAGGAAGG - Intergenic
1095693260 12:45115048-45115070 GGAGAGAGACAGAAGAAGGATGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096076668 12:48810311-48810333 ACACAGAGCCAGAAGGAGTCTGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096356871 12:50948849-50948871 CGACAGAGCGAGGAGGAGGGGGG + Intergenic
1096500083 12:52059321-52059343 AGAGAGAGCCAGCAGGAGGCTGG - Exonic
1096717233 12:53499066-53499088 AGAGAGAGAGGGAAGGAGGAGGG - Intronic
1096778337 12:53977302-53977324 ATACAAAGACAGAAAGAGGAGGG - Exonic
1096838804 12:54369024-54369046 AAAGGGAGCGAGAAGGAGGAGGG - Intergenic
1096926019 12:55147470-55147492 AGAAAGAGGGAAAAGGAGGAGGG + Intergenic
1097182486 12:57179237-57179259 AGACGGATCCAGAAGAAGGCAGG + Intronic
1097513223 12:60568930-60568952 AGACAGATAGAGAAGGTGGAGGG - Intergenic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098167478 12:67713231-67713253 GTACAGAGACAGAAGGAGCAGGG - Intergenic
1098460766 12:70730810-70730832 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1098605132 12:72380838-72380860 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
1098725280 12:73956956-73956978 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1098849914 12:75583780-75583802 AGACAGAGAAAGATGGAGGGAGG - Intergenic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1100357903 12:93849220-93849242 AGACAGTGCCAGAGGGAGCTGGG + Intronic
1100406694 12:94278057-94278079 ATACAGAGACAGAGGGAGGGGGG - Exonic
1100580958 12:95940126-95940148 AGAGTGGGCCAGAAAGAGGAAGG - Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1101674900 12:106908778-106908800 AGACAGAGAGAGAGGGGGGAAGG - Intergenic
1102186548 12:110951904-110951926 AGACAGAGGGAGAGGGAGGGGGG + Intergenic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102556084 12:113727423-113727445 AGAGAGGGACAGAAGGAGGGAGG - Intergenic
1102691638 12:114765942-114765964 AGACAGAGAGAGGAGGGGGAAGG - Intergenic
1102746515 12:115253546-115253568 AGAGAGGGCCAGGAGGAGGGTGG + Intergenic
1102902329 12:116648011-116648033 AGGCAGAGGATGAAGGAGGAAGG - Intergenic
1102988384 12:117297202-117297224 AGAGAGACCCATGAGGAGGATGG + Intronic
1103186649 12:118963727-118963749 AGCCAGCCCCAGAAGGAGGCTGG - Intergenic
1103823052 12:123713238-123713260 AGACAGAGCCAGAAATGGGAAGG + Intronic
1103864605 12:124042010-124042032 AGACACACGCAGAAGGAAGATGG - Intronic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104416062 12:128597459-128597481 AGAGAGAGCGAGAGAGAGGAAGG + Intronic
1104491943 12:129201777-129201799 AGAAAGAGAGAGAAGGAGGGAGG + Intronic
1104493641 12:129216443-129216465 AGACAGACACACAGGGAGGATGG + Intronic
1104670671 12:130677939-130677961 AGAGGGAGCCAGGTGGAGGAGGG - Intronic
1105567739 13:21567580-21567602 AGAAAGAGCTAGAAGAAGGATGG + Intronic
1105606093 13:21927615-21927637 AGACCCAGCAAGAAGGATGAGGG + Intergenic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106189910 13:27442576-27442598 AGAGTGAGCCAGAAGAAGTACGG - Intronic
1106614046 13:31310312-31310334 AGAGTGAGCCAGGTGGAGGAGGG - Intronic
1106763839 13:32894065-32894087 GGACAGAGGCAGAGAGAGGAAGG - Intergenic
1107138098 13:36966811-36966833 AGCAAAAGCCAAAAGGAGGAAGG - Intronic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1107826992 13:44337733-44337755 AGACAGTGCTGGAAAGAGGATGG - Intergenic
1107833976 13:44398779-44398801 AGTCAGAGCCAACAGGATGAGGG - Intergenic
1108021894 13:46136170-46136192 AGCAGGAGGCAGAAGGAGGATGG - Intronic
1108032997 13:46256416-46256438 AGACAGAGCCAGAAGCCAGGAGG + Intronic
1108071592 13:46634501-46634523 AGGCACAGCCTGAATGAGGAAGG - Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108779842 13:53816178-53816200 AAACAGACACAGAAGGAAGAAGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109678513 13:65714026-65714048 AGACAGAGAGAGAAAGAGTATGG - Intergenic
1110764236 13:79264536-79264558 TGCCAGAACAAGAAGGAGGATGG + Intergenic
1110952629 13:81515762-81515784 ATACAGAGAAAGAGGGAGGAGGG + Intergenic
1111340753 13:86882516-86882538 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1111534542 13:89585863-89585885 AGACAGCCACAGAAGGAAGACGG + Intergenic
1111670271 13:91321112-91321134 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1112109013 13:96273993-96274015 AGAGAGAGAGAGAAGGAGAAGGG - Intronic
1112111719 13:96307148-96307170 AGAAAGAGTAAGAAAGAGGAGGG + Intronic
1112237668 13:97650917-97650939 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1112415018 13:99196960-99196982 AGAGAGACCCAGAAGGAGTCAGG - Intergenic
1113222471 13:108120691-108120713 AAACAGAGACAGAAGGAGGGGGG - Intergenic
1113408233 13:110061703-110061725 AGACTGAGGCAGCAGGAGGTGGG + Intergenic
1113512083 13:110864518-110864540 AGACAGAGCGAGCAAGAGCAGGG + Intergenic
1113585206 13:111460008-111460030 AGACAGAGAAAGAAGGAAAAGGG + Intergenic
1113647188 13:112006923-112006945 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1113939963 13:114013611-114013633 AGAGAGAGACAGATGGAGGGGGG - Intronic
1113993063 14:16043419-16043441 AGACAGAGAGAGGAGGAGGAAGG - Intergenic
1114041863 14:18686268-18686290 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1115501495 14:34053833-34053855 AGAGTGAGCCAGATGGAGGGAGG - Intronic
1115975162 14:38989236-38989258 AGAAAGAGAGAGAGGGAGGAAGG + Intergenic
1116162052 14:41280457-41280479 AGACAGAAAGAGAAGAAGGAAGG + Intergenic
1116218927 14:42056738-42056760 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
1116357042 14:43942150-43942172 AGACAGAGAGAGAGGGAGAAAGG + Intergenic
1117123007 14:52589210-52589232 TGCCAGAGCCTGGAGGAGGAGGG + Intronic
1118089570 14:62458225-62458247 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1118163970 14:63317793-63317815 ATAGCCAGCCAGAAGGAGGAGGG + Exonic
1118176227 14:63442584-63442606 ACACAGAGAGAGAAGGAAGAGGG + Intronic
1118354925 14:65005563-65005585 AGACAGAGACAGAAAGAGAGAGG - Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118422330 14:65620678-65620700 AGAGAGAGACAGAGAGAGGAAGG + Intronic
1118601096 14:67471962-67471984 AGTCAGAGCCGGAAGTAGGCTGG + Exonic
1118614793 14:67567896-67567918 AAACAGATCCAGAAGGTGCAGGG + Intronic
1118654090 14:67928367-67928389 ATACAGAGACAGAGGGAGGGGGG + Intronic
1118970372 14:70631793-70631815 AGAAAGAGAGAGAAGAAGGAAGG + Intergenic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119429042 14:74553805-74553827 AGCCAGAGGCAGAAGGTTGAGGG + Intronic
1119443856 14:74647742-74647764 AGACAGAGGGAGAGGGAGGCAGG - Intergenic
1119510019 14:75203687-75203709 AGACAGAGACAGAGAGAGGCAGG + Intergenic
1119607766 14:76035436-76035458 AGAGAAAGAGAGAAGGAGGAGGG - Intronic
1119639744 14:76305676-76305698 AGACACAGGCAGAGGGAGGTGGG - Intergenic
1119682744 14:76605025-76605047 AGACAGTGCCTGGAGGTGGAAGG + Intergenic
1119707358 14:76791472-76791494 AGAAGGATCCAGAAGGAGAAAGG + Intronic
1120026238 14:79587593-79587615 AGAGAGAGCAAGAAAGAGGGAGG + Intronic
1120045732 14:79803475-79803497 AGACATACCCAGTGGGAGGAAGG - Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120317211 14:82910611-82910633 AGACAGGGCAAAAAGGAGGAAGG + Intergenic
1120677915 14:87443436-87443458 AGAGAGAGAAAGAGGGAGGAAGG + Intergenic
1120778629 14:88464990-88465012 AGCCAGAAACAGGAGGAGGAGGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121426830 14:93858393-93858415 AGACAGACCCAGAAAGAGCAGGG - Intergenic
1121532280 14:94663586-94663608 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1121533376 14:94673934-94673956 TGACAGAGCCCGAAGGCGGAGGG + Intergenic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121726546 14:96156223-96156245 AGAGAGAGGGAGAAGAAGGAAGG + Intergenic
1121782839 14:96633297-96633319 AGAAAGAGCAAGAAAGAAGAAGG - Intergenic
1121799661 14:96764045-96764067 GGAAGGAGACAGAAGGAGGAAGG + Intergenic
1121815035 14:96922744-96922766 AGAGTGAGCCAGAAGGAGAGAGG - Intronic
1121822890 14:96985759-96985781 AGACATAGCCAGAAGATGAAGGG - Intergenic
1121835557 14:97088941-97088963 AGGCAGAGGCACAAGGTGGAAGG + Intergenic
1121894968 14:97638297-97638319 AGAAAGAGAGAGAAGGGGGAAGG - Intergenic
1122455389 14:101846187-101846209 AGACAGACCCGGAGGGAGGCGGG + Intronic
1122540562 14:102495700-102495722 AGACAGAGCAGCAAGGAGGACGG - Intronic
1122662698 14:103308717-103308739 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1122935450 14:104953933-104953955 AAAAAGAGCCAGAAAGAGAAAGG - Exonic
1123049630 14:105534744-105534766 AGACGGGGGCAGGAGGAGGAAGG + Intergenic
1124129966 15:26974568-26974590 AGACAGAGACAGCAGAGGGAGGG + Intronic
1124210858 15:27764020-27764042 AGACAGAGAGAGAGGTAGGAGGG + Intronic
1124219542 15:27837604-27837626 AGTAACAGCCAGAAGTAGGAAGG + Intronic
1124362086 15:29045060-29045082 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
1124428843 15:29588555-29588577 AGAGAGAGAGAGAAGGAGAAGGG + Intergenic
1124472430 15:30000360-30000382 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1124699481 15:31900202-31900224 AGAGAGAGCAAGAGAGAGGAGGG - Intergenic
1124791453 15:32731075-32731097 AGGCACATCCGGAAGGAGGAAGG + Exonic
1124899651 15:33810381-33810403 TGACAGGGCCACAAGGAGGCAGG + Intronic
1125177934 15:36846931-36846953 AGAGAAATCAAGAAGGAGGATGG - Intergenic
1125431533 15:39599530-39599552 AGAGAGAGAAAGAAGGAGGAGGG - Intergenic
1125712917 15:41801354-41801376 AGAGTGAGCCAGAAGCAGGAGGG - Intronic
1125753833 15:42049082-42049104 AGGCAGAGTCAGGAAGAGGAAGG + Intronic
1126224157 15:46250460-46250482 AGAGAGAGACAGAGAGAGGAGGG + Intergenic
1126556011 15:49988442-49988464 AGAGAGGGACAGAGGGAGGAAGG + Intronic
1127612240 15:60648073-60648095 AGACTGAGGGAGGAGGAGGAGGG + Intronic
1127729703 15:61788373-61788395 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1127997599 15:64162756-64162778 AGACAGAAGCCGAGGGAGGAGGG + Intronic
1128250525 15:66160853-66160875 TGCCAGAGCTAGAAGCAGGATGG + Intronic
1128310564 15:66629565-66629587 ATACACAGCTAGAATGAGGAGGG + Intronic
1128399626 15:67264852-67264874 AGAAAGGGAGAGAAGGAGGAGGG - Intronic
1128417427 15:67459474-67459496 AGAAAGAGGCAGAAGCAGCAGGG + Intronic
1128535067 15:68484466-68484488 AGAAAGAGAGAGAGGGAGGAAGG + Intergenic
1128676761 15:69615449-69615471 AGACAGAGCCTGAATTGGGAGGG + Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1128776905 15:70327519-70327541 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1128848320 15:70922490-70922512 AGACATAGAGAGTAGGAGGATGG + Intronic
1128875918 15:71201212-71201234 AGAAAGGGCCAGGAGGATGAGGG + Intronic
1129114536 15:73357885-73357907 TGACAGAGCCAGAAAGAGGGAGG + Intronic
1129652572 15:77501732-77501754 AGAGAAAGACTGAAGGAGGAAGG - Intergenic
1129665628 15:77577987-77578009 AGGCAGAGATAGAGGGAGGAGGG + Intergenic
1130028221 15:80288334-80288356 AGAGAGAGAGAGAAAGAGGAGGG + Intergenic
1130042555 15:80417577-80417599 AGAGAGAGAAAGAGGGAGGAAGG - Intronic
1130148154 15:81291393-81291415 AAACTCAGCCACAAGGAGGAAGG - Intronic
1130706323 15:86236701-86236723 ATACAGAGACAGAGGGAGGGGGG + Intronic
1130918215 15:88322707-88322729 AGACAAAGCCGAGAGGAGGAGGG + Intergenic
1131006923 15:88985995-88986017 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1131396881 15:92093315-92093337 AGCCAGAGCAAGAGGGAGAAGGG + Intronic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131454825 15:92575400-92575422 AGCAATAGACAGAAGGAGGAAGG + Intergenic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1131667417 15:94585231-94585253 AGACAAAGGCAGGAGGAGAAAGG - Intergenic
1132281987 15:100626612-100626634 AGACAGAGAGAGAAGGAGAGGGG - Intronic
1132292840 15:100715243-100715265 AGACAGAGCCAGATGGCCGGGGG - Intergenic
1133320111 16:4908409-4908431 AGAGAGAGAAAGAAGGAAGAGGG - Intronic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133421492 16:5650694-5650716 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
1133439422 16:5807973-5807995 AGACACAGCAAGAAGGAAGGAGG - Intergenic
1133489779 16:6256375-6256397 GGACTGAGGCAGAAGGAGGCAGG + Intronic
1133513020 16:6479296-6479318 AGAGAGAGCCAGAAAGATCAGGG + Intronic
1133515836 16:6507804-6507826 AGCCAGGGCTAGAAGGAGGGGGG + Intronic
1133606153 16:7390095-7390117 AAACAGAGCGAGAAGGGAGAGGG + Intronic
1133692791 16:8232741-8232763 AGACAGAGGCAGAGGAAGGTGGG - Intergenic
1133971261 16:10569901-10569923 AGACAGAGCCAACTGCAGGAGGG + Intronic
1134079857 16:11317210-11317232 AGACACAGCTGGAAGGAGGCAGG + Intronic
1134328141 16:13225815-13225837 AGAGAGAGACAGATGGAGGAAGG + Intronic
1134381799 16:13734189-13734211 AGACAGAGCTACAAGAAGAAAGG + Intergenic
1134554773 16:15155336-15155358 AGAGAGAGACAGAAGGAGAGAGG + Intergenic
1134782561 16:16911588-16911610 AGCCAGAGGCAGAAAGAAGATGG - Intergenic
1134819920 16:17238714-17238736 ACTAAGAGCCAGAAGGCGGAAGG - Intronic
1135296547 16:21283993-21284015 GGACGCAGGCAGAAGGAGGAAGG - Intronic
1135522474 16:23188009-23188031 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
1135640199 16:24113136-24113158 AGAAAGAGAAAGAAAGAGGAGGG - Intronic
1135891776 16:26363793-26363815 AGAAAGAGAAAGAAGAAGGAAGG - Intergenic
1136083790 16:27870174-27870196 AGACAGAGAGAGAAGGAGAGAGG - Intronic
1136654759 16:31703207-31703229 AGAAGGAGCCTGAAGGAGGAAGG + Intergenic
1136912430 16:34155171-34155193 AGACAGAGAGAGGAGGAGGAAGG - Intergenic
1137291495 16:47055059-47055081 AGCCAGAGCAAGAGAGAGGATGG - Intergenic
1137302981 16:47171557-47171579 ACTCAAAGCCAGCAGGAGGATGG - Intronic
1137317689 16:47344747-47344769 GGACATAGACAGTAGGAGGATGG - Intronic
1137465261 16:48702703-48702725 AGAGAGAGAAAGAAGGGGGAGGG - Intergenic
1137819209 16:51427600-51427622 AGAAAGAGAGAGAGGGAGGAAGG - Intergenic
1138207058 16:55132904-55132926 AGACACAGCCTGGAAGAGGAAGG - Intergenic
1138818243 16:60227485-60227507 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1138954956 16:61960699-61960721 AGAAAGGGCGAGAGGGAGGAAGG - Intronic
1139341742 16:66271912-66271934 AACCAGAGCCAGAAGGAGAGGGG + Intergenic
1139439541 16:66959111-66959133 AGAAAGAGAAAGAAAGAGGAAGG + Intergenic
1139661744 16:68425560-68425582 AGCCAGAGTCAGAAGAAGGATGG + Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140092326 16:71848916-71848938 AAAAAGAGCCAGCAGGAGGCTGG + Intronic
1140145175 16:72300073-72300095 AGACAGAGGTAGAAAGAGAAGGG - Intergenic
1140327343 16:74017698-74017720 AGAATGGGCCATAAGGAGGATGG + Intergenic
1140462813 16:75154661-75154683 TGACAGAGACAGAGGGAGGGGGG + Intronic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1141164436 16:81651087-81651109 AGCCAAAGTCAGAAAGAGGAGGG - Intronic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141293936 16:82749174-82749196 ACAGAGAGAGAGAAGGAGGAAGG + Intronic
1141678500 16:85530309-85530331 AGCCAGAGGCAGAGGGAGCAAGG + Intergenic
1141774887 16:86116628-86116650 AGGCAGAGCCAGCAGCTGGAAGG + Intergenic
1141788711 16:86218534-86218556 AGACAGAGGCAGAGGTTGGAGGG + Intergenic
1142121392 16:88388251-88388273 GGCCAGAGCCAGAGGCAGGATGG + Intergenic
1142336665 16:89493773-89493795 AGACACAGCCAGACGGAAGCAGG + Intronic
1142941182 17:3380871-3380893 AGAGAGAGCGAGAGGAAGGAGGG + Intergenic
1143157565 17:4848038-4848060 AGAGAGAGGAAGAAGGAGGGAGG + Intronic
1143174581 17:4948823-4948845 GGAGTGAGCCAGAAGAAGGAAGG + Exonic
1143399253 17:6631566-6631588 AGACAGCAAGAGAAGGAGGAAGG + Intronic
1143487799 17:7264091-7264113 AGAGAGAGCCAGAATAAGCAGGG - Intergenic
1143722295 17:8821614-8821636 AGACATAGCTGGAAGGTGGAGGG - Intronic
1143794689 17:9327213-9327235 AGAAGGAGGAAGAAGGAGGAAGG + Intronic
1143794695 17:9327237-9327259 GGACAGAGGAGGAAGGAGGAAGG + Intronic
1143794820 17:9327978-9328000 AGAGAGAGACAAAAGAAGGAAGG - Intronic
1143864775 17:9916176-9916198 AGACAGAGCCATCTGGGGGATGG + Exonic
1143949677 17:10622793-10622815 AGACAGAACTTGAAGGAAGAAGG + Intergenic
1143964096 17:10743968-10743990 AAAAAGAGAAAGAAGGAGGAAGG - Intergenic
1144012371 17:11161845-11161867 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1144127962 17:12220450-12220472 GTACAGAGACAGAAGGAGGGGGG + Intergenic
1144137156 17:12307567-12307589 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
1144396951 17:14853664-14853686 AGAAAGTTCTAGAAGGAGGAAGG + Intergenic
1144504511 17:15818356-15818378 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1144634250 17:16893975-16893997 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1144721191 17:17470921-17470943 AGAGAGAGCCAGCAGGAAGGAGG + Intergenic
1144926851 17:18818746-18818768 TGCCAGAGCCAGGAGGAGGAGGG + Intergenic
1145168364 17:20633870-20633892 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1145200332 17:20938825-20938847 TGACAGTGCCAGCAGCAGGAGGG - Intergenic
1145258213 17:21339195-21339217 AGACGGAGCCACAGGGAGGGAGG - Intergenic
1146017743 17:29247328-29247350 GGACAGAGCAAGAAAGAGGAAGG - Intronic
1146127931 17:30243687-30243709 TGGCAGAGGCAGTAGGAGGAGGG + Intergenic
1146164457 17:30576833-30576855 TGACAGCGCCAGCAGCAGGAGGG - Intergenic
1146284419 17:31564939-31564961 AGACCGTGCCAAAGGGAGGAGGG - Intergenic
1146506927 17:33413830-33413852 GGCCAGTGCCAGAAGGAGCAAGG - Intronic
1146796870 17:35787856-35787878 AGAGAGAGAAAGAAGGAGCAGGG - Intronic
1146930120 17:36770930-36770952 AGAAAGAGAGAGAAAGAGGAAGG - Intergenic
1147145429 17:38481987-38482009 AGACAGAGCCAGAGTGAGCTGGG - Intronic
1147421967 17:40326411-40326433 AGAAAGAACCAGAAGTCGGAAGG - Intronic
1147769725 17:42859199-42859221 AGAAAGAGCCGTAAGGAGGTGGG - Intergenic
1147954226 17:44123419-44123441 GGACAGAGACAGCAGGAGGAGGG + Intronic
1148233503 17:45951917-45951939 AGAGAGAGAGAGAGGGAGGAAGG + Intronic
1148577909 17:48724407-48724429 AGACATGGACAGAAGGCGGATGG + Exonic
1148749396 17:49935814-49935836 GGAAAGAGCCAGAAGCTGGAAGG + Intergenic
1148965387 17:51430709-51430731 ATACAGAGCAGGATGGAGGATGG + Intergenic
1150354051 17:64468238-64468260 AGACAGAGGCAGAAGTTGAAGGG - Intronic
1150455462 17:65303676-65303698 AGAGAGAGAGAGAAGGAGTAGGG + Intergenic
1150593639 17:66584729-66584751 TGACAGAGCCAAAGGGAAGAAGG - Intronic
1151319448 17:73343687-73343709 AGGGAGGGCCAGAAGGAGGCAGG + Intronic
1151671570 17:75574152-75574174 AGAGAGAGCCAGGCCGAGGAGGG + Intronic
1151726350 17:75887053-75887075 AGGCTGAGGCAGGAGGAGGAAGG + Intronic
1152321613 17:79611121-79611143 AGAGAGAGAGAGAAGGAGGGCGG - Intergenic
1152321617 17:79611174-79611196 AGAGAGAGAGAGAAGGAGGGCGG - Intergenic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1153014725 18:573294-573316 GGACAGAGACAGAGGGAAGATGG - Intergenic
1153166462 18:2267188-2267210 AGGCAGAACAAGAAGGAGGGAGG + Intergenic
1153779137 18:8478846-8478868 AGGCATAGCCAGCAGGTGGAGGG + Intergenic
1154064071 18:11090276-11090298 AGAGAGAGAGAGAAGGAAGAAGG + Intronic
1154110089 18:11560244-11560266 AGAAAGAGACAGCAGCAGGACGG - Intergenic
1154141370 18:11827052-11827074 GGAGAGACCCGGAAGGAGGAGGG + Intronic
1155117484 18:22783899-22783921 GGACAGAGCCCCAGGGAGGAGGG - Intergenic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155333079 18:24737701-24737723 AGACAAAGACACAAGAAGGAGGG - Intergenic
1155403528 18:25463512-25463534 AGACAGGGCCAGAGAGAGGAAGG - Intergenic
1155509437 18:26562170-26562192 AGAAAGAGTGAGAAGGAGGATGG - Intronic
1155517384 18:26637214-26637236 CGATAGAGTCAGGAGGAGGAAGG - Intronic
1155615045 18:27712433-27712455 AGAGAGAGCCAGAAGGCAAAGGG + Intergenic
1155829223 18:30492098-30492120 AGAGAAAGAAAGAAGGAGGAAGG + Intergenic
1155878151 18:31112081-31112103 AGAAAGAGACAGAGAGAGGAAGG + Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156017496 18:32563145-32563167 AGCAAGAACCAGTAGGAGGAAGG + Intergenic
1156452817 18:37276072-37276094 AGGAAGAGCCAGACCGAGGAGGG - Intronic
1156475508 18:37403138-37403160 AGGCAGAGAGAGAAGGAAGAGGG + Intronic
1156558891 18:38098988-38099010 ACACAGAGCCTGAAGGATAAAGG - Intergenic
1156919103 18:42498008-42498030 AGACAGAGAGAGAAAGAAGAAGG - Intergenic
1157305958 18:46517995-46518017 AGACAAAGGCAGAGGAAGGAAGG + Intronic
1157453086 18:47802329-47802351 AGACAGAGACAGAGAGAGGTAGG - Intergenic
1157470087 18:47982436-47982458 AGAGAGAGCCAGAGAGAGGGAGG + Intergenic
1157578123 18:48757573-48757595 TGACAGAGTCAGAGGCAGGAGGG + Intronic
1157587479 18:48813971-48813993 AGCCAGAGACAGATAGAGGAAGG + Intronic
1157627396 18:49061925-49061947 GGATGGAGCCAGATGGAGGATGG - Intronic
1158280542 18:55820798-55820820 AGACACACACAGAAGGAGAATGG + Intergenic
1158346178 18:56519228-56519250 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159268189 18:66111647-66111669 AGACAGAGAGAGAGGAAGGAAGG + Intergenic
1159313104 18:66736041-66736063 AGAGAGAGAAAGGAGGAGGAAGG - Intergenic
1159376744 18:67603234-67603256 AGACAGACACAAAAGAAGGATGG + Intergenic
1159875495 18:73806227-73806249 AGACAGAGCAAACAGCAGGAGGG + Intergenic
1159951867 18:74489975-74489997 AGAAAGAGAAAGAGGGAGGAAGG + Intergenic
1159967941 18:74615111-74615133 AGACAGAGCTTCAAGGTGGAAGG + Intronic
1160037567 18:75315904-75315926 AGAGAGAGCGAGAAAGAGGAAGG - Intergenic
1160367083 18:78335530-78335552 GGAGAGAGGGAGAAGGAGGAGGG + Intergenic
1160730418 19:639510-639532 AGACAGAGACAGAAAGACGGCGG - Intergenic
1160950458 19:1664407-1664429 AGACAGAGAGAGAGGGAGGGAGG - Intergenic
1160951567 19:1670013-1670035 AGAGAGAGAGAGAAGGGGGAGGG - Intergenic
1161146789 19:2683725-2683747 AGAGAGACCCTGGAGGAGGAGGG + Intronic
1161610470 19:5239141-5239163 AGACAGAAACAGAGGGGGGAGGG + Intronic
1161653521 19:5499119-5499141 AGCCAGATCCAGAAGGTGGGAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1162051714 19:8038088-8038110 TGGCAGAGCCAGAAGACGGAAGG + Intronic
1162151962 19:8652800-8652822 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
1162151975 19:8652900-8652922 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
1162223800 19:9202603-9202625 AGAAAGAGACAGAAAGAAGAGGG + Intergenic
1162483117 19:10941049-10941071 AGAGAGAGACAGAGGGAGGCAGG + Intergenic
1162705988 19:12555276-12555298 AGAAAGAGAAAGAAGAAGGAAGG + Intronic
1162745678 19:12796753-12796775 AGCCTGAGCCTGAAGAAGGAAGG + Intronic
1162746696 19:12802491-12802513 AGACAGAGAAAGAAGGGGGCGGG + Intronic
1162776667 19:12983886-12983908 TGAAAGAGACAGAAGGAGGAAGG + Intergenic
1162822313 19:13230373-13230395 AGACAGAGACAGAAAGAGACTGG + Intronic
1162875588 19:13618790-13618812 AGAAAGAGAGAGAAGGAGGAGGG + Intronic
1162877783 19:13633678-13633700 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877797 19:13633794-13633816 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877816 19:13633927-13633949 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1163581527 19:18142160-18142182 ACACAGAGCCAAAGGGAGCAAGG - Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164929789 19:32166555-32166577 AGAAAGAGCCATATGGAGGAAGG + Intergenic
1164976536 19:32577034-32577056 AGAGAGAGACAGAGGGAGGGAGG - Intergenic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1165188855 19:34045288-34045310 AGAGAGAGAGAGAAGAAGGAAGG + Intergenic
1165205626 19:34182929-34182951 AGATGGAGCTAGAAAGAGGAGGG - Intronic
1165309255 19:35020787-35020809 AGAGGGAGCCAGAAGGAGCCTGG - Intronic
1165357806 19:35314544-35314566 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1165370192 19:35400569-35400591 AGAGAGAGACAGAAAGAAGAAGG + Intergenic
1165400389 19:35596027-35596049 AGACAGAGCAAGAAGAAAGAAGG + Intergenic
1165416063 19:35694215-35694237 AGAAAGAGAAAAAAGGAGGAGGG - Intergenic
1165466804 19:35979422-35979444 GGACAGAGCCAGCATGAGGCAGG + Intergenic
1165834384 19:38745349-38745371 TGACAGGGTCTGAAGGAGGAGGG - Intronic
1166159449 19:40941082-40941104 AGAAAAAGACAGAAGGATGAGGG + Intergenic
1166168383 19:41009005-41009027 AGAAAAAGACAGAAGGATGAGGG + Intronic
1166688141 19:44808314-44808336 GGAGAGAGCGGGAAGGAGGAAGG + Intergenic
1166730812 19:45058028-45058050 AGACAGGGGCAGCAGGAGGCTGG - Intronic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167706516 19:51084326-51084348 AGAGAGACCCAGAAAGAGAAGGG + Intergenic
1167711159 19:51111930-51111952 AGGCAGGGCCACAAGGATGAAGG - Intergenic
1167799356 19:51730162-51730184 AGACAGAGGGAGAGGGAGGGAGG + Intergenic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1167900149 19:52615434-52615456 AGACACAGCAAGAAGCAGGTTGG + Intronic
1168092790 19:54096637-54096659 AGAAAGAGGCAGAAGGAGAAAGG - Intronic
1168102796 19:54149843-54149865 AGAGAGATCCAGAAAGAGGGTGG - Intronic
1168106545 19:54168959-54168981 AGAGAGAGAAAGAAGAAGGAAGG - Intronic
1168346155 19:55651141-55651163 AGACAGAGAGACAAGGAGTACGG - Intronic
1168642060 19:58037432-58037454 AGACAGTGCCATAAGGATGATGG + Intronic
924959993 2:26265-26287 AGGCAGAGGCAGAAGGAGAGAGG + Intergenic
925058169 2:871408-871430 AGACACAGGCAGGAGGAAGATGG + Intergenic
925405438 2:3602910-3602932 AGACAGAGACAGACAGAGGCAGG - Intronic
925809836 2:7688399-7688421 AGACAGAGACAGTCGGAGAAGGG + Intergenic
925886266 2:8395742-8395764 AGAAAGAGAGAGAGGGAGGAAGG + Intergenic
925921022 2:8637923-8637945 AGAAAGAGCGGGGAGGAGGAGGG + Intergenic
925965701 2:9063294-9063316 AGAAAGAGAGAGAAAGAGGAAGG + Intergenic
926116355 2:10216044-10216066 AGAGAGAGAAAGAAGAAGGAAGG + Intergenic
926169460 2:10542950-10542972 ACAGAGAGCCAGAAGGAAGAAGG - Intergenic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926920737 2:17937412-17937434 GGACAGGGAGAGAAGGAGGAAGG - Intronic
927099108 2:19774260-19774282 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
927345634 2:22035606-22035628 AGAGAGAGCCAGAAGGGAAAAGG - Intergenic
927384670 2:22519612-22519634 AGAAAGAGAAAGAAGGAGGGAGG - Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928908951 2:36399245-36399267 AGACAGAATCAGAAAGAAGATGG + Intronic
929120465 2:38480111-38480133 AGACACATCCAAAAGCAGGAGGG + Intergenic
929452011 2:42044199-42044221 AGACAGAGAGAGAGGAAGGAAGG + Intergenic
929685147 2:44027000-44027022 AGAGAGAGACAGAGGGAGGGAGG + Intergenic
929956748 2:46464124-46464146 AGACTGAGGCAGGAGGAGGGGGG - Intronic
930192827 2:48478024-48478046 AGACAGAGATACAAGGGGGAAGG + Intronic
930312183 2:49755768-49755790 TGACAGAGAAAGAAGAAGGAAGG + Intergenic
930485819 2:52009442-52009464 AGAAAGAGACAGAGGGAGAAAGG - Intergenic
930501674 2:52228587-52228609 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930648994 2:53945483-53945505 ACAGAAAGCTAGAAGGAGGAAGG + Intronic
931096454 2:58946055-58946077 AGACAGTGCCAGAGAGAAGAGGG - Intergenic
932151578 2:69377691-69377713 TAACAGAGCTAGAAGAAGGAAGG + Intronic
932159650 2:69448297-69448319 AGACAGAGAGAGAAGGAGTGGGG + Intergenic
932167765 2:69523905-69523927 AGACAGAGGGAGAAGAAGCATGG - Intronic
932335442 2:70928478-70928500 AGTCAGAGGCAGATGGAGCAGGG - Intronic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932476975 2:72012542-72012564 GGACAGAGTCAGGAGGAAGACGG + Intergenic
932509511 2:72271506-72271528 AGAGAGGGACTGAAGGAGGAAGG + Intronic
932664516 2:73686080-73686102 AGACAGAGAGAGAAGGCGGGGGG - Intergenic
932795833 2:74695296-74695318 AGACAGAGCCTGAAGGTTCAAGG - Intergenic
932867137 2:75355590-75355612 AGACAGAACCAATAGGATGATGG + Intergenic
933014250 2:77104303-77104325 GGACAGAAACAGAAGCAGGAAGG - Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933158849 2:79002416-79002438 AGAGAGAGCCAGTAGGGGGAAGG + Intergenic
933479138 2:82833067-82833089 AGAAAGGTCCAGAAGAAGGATGG + Intergenic
933531030 2:83512461-83512483 AGACAAAGACAGAAAGAGGAGGG + Intergenic
933577868 2:84090379-84090401 GGAGAGAGAGAGAAGGAGGAAGG - Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934535341 2:95128704-95128726 AGAAGGAGAAAGAAGGAGGAGGG + Intronic
934767246 2:96886522-96886544 GGCCAGAGCCCGGAGGAGGAGGG + Intronic
934781300 2:96971324-96971346 AGACAGAGACACAAGGGAGAGGG - Intronic
935329807 2:101968705-101968727 AGAGGGAGCAAGAAAGAGGAGGG + Intergenic
935333184 2:101992313-101992335 AGACAGAGACAGAGAGAGGCAGG + Intronic
936233934 2:110726791-110726813 AGACAGAGACAGACAGAGGAAGG + Intergenic
936246209 2:110829668-110829690 AGGCAGGGGAAGAAGGAGGAAGG + Intronic
936376714 2:111947324-111947346 AGACAGAGCCCAAAGGGGAATGG - Intronic
936514685 2:113174229-113174251 ACACAGAGCAGGAAGGGGGAAGG - Intronic
936520143 2:113206763-113206785 AGCCAGAGCCCAAAGGAGGAGGG - Intronic
937235991 2:120432298-120432320 AGACAGGGCCCGGGGGAGGAAGG - Intergenic
937244943 2:120486610-120486632 TGACAGGGCCCGAAGGAGGAAGG - Intergenic
937290761 2:120780426-120780448 AGACAGGGAGGGAAGGAGGAAGG + Intronic
937313484 2:120916413-120916435 TGGCAGAGCCAGAAGGAAGGGGG - Intronic
937509885 2:122583429-122583451 AGAAAGAGAAAGAAAGAGGAAGG + Intergenic
937752734 2:125497474-125497496 GTACAGAGACAGAGGGAGGAGGG - Intergenic
937953717 2:127407900-127407922 AGACAGGAGCAGAAGGAGGGAGG - Intergenic
938538636 2:132267487-132267509 AGACAGAGAGAGGAGCAGGAAGG + Intergenic
938968898 2:136414504-136414526 AGTCAGAACCAGAAGCAAGAGGG - Intergenic
939506054 2:143048453-143048475 AGAGAGAGAGAGAAAGAGGAGGG - Exonic
939899429 2:147833779-147833801 AGTCAAAGCCAGAAGGTGGCTGG + Intergenic
939962160 2:148574842-148574864 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
939998212 2:148940217-148940239 AGACAGACCCATAAGGATGTGGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940613650 2:156023152-156023174 AGACAGAGGTAGAAAGAGGTTGG + Intergenic
941695809 2:168550132-168550154 AGAGAGAGACTGAGGGAGGAAGG - Intronic
942002052 2:171657514-171657536 AGAGAGAGAAAGAAGGAGGGAGG + Intergenic
942277887 2:174336065-174336087 GGAGGGAGCAAGAAGGAGGAGGG - Intronic
942627271 2:177915348-177915370 AGACTGAGGGAGAAGGAGGGAGG - Intronic
942810198 2:179990571-179990593 AGAGAGAGAAAGAAGAAGGAGGG + Intronic
942926361 2:181437806-181437828 AGGCAGACCCACAGGGAGGAAGG + Intergenic
943446757 2:187995877-187995899 GTACAGAGACATAAGGAGGAGGG - Intergenic
944128949 2:196325156-196325178 AGAAAGAGGGAGAAGGAGGGAGG + Intronic
944522980 2:200590180-200590202 AGACAGAGTCAGAAAGAGAAAGG - Intronic
944648365 2:201803449-201803471 AAACAGAGCCTGAAGGAAAAGGG + Intronic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
944856749 2:203775493-203775515 GGACAGAGCAAGCTGGAGGATGG - Intergenic
944893631 2:204142496-204142518 AGGCAGGGCCAGATGGAGAAGGG - Intergenic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
945762587 2:213932610-213932632 AGACTGAGCCAGAAGCTTGAAGG - Intronic
946158101 2:217820122-217820144 AGACAGAGCCAGGCTGAGCAGGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946279831 2:218658954-218658976 AGTCAGAGCCAGAGGCAGGTGGG - Intronic
946650131 2:221884248-221884270 GGACAGAGCCAGTTGGAGGTAGG - Intergenic
946875853 2:224129184-224129206 AGAAAAACCCAAAAGGAGGATGG - Intergenic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
947569511 2:231221253-231221275 ACACAGACACAGAAGGAAGACGG - Intronic
947598441 2:231429138-231429160 ATACAGAGACAGAAGGAGGGGGG + Intergenic
948013077 2:234665437-234665459 AGAAAGAGAAAGAAAGAGGAAGG - Intergenic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948287406 2:236796608-236796630 AGAGAGAGAAAGAAGAAGGAAGG - Intergenic
948293942 2:236847267-236847289 AGAGGGAGCCAGAGGGAGGCAGG + Intergenic
948294454 2:236850217-236850239 AGGCAAGGCCAAAAGGAGGATGG - Intergenic
948308565 2:236968440-236968462 TGAGAGGGTCAGAAGGAGGAAGG + Intergenic
948710846 2:239824643-239824665 AGCCAGAGCCAGAAGGAAGGGGG - Intergenic
948752257 2:240139533-240139555 AGACAGAGGAAGAAGAAGAAGGG + Intronic
948761131 2:240191704-240191726 AGACGGAGAAAGAAGGAAGAAGG - Intergenic
948999309 2:241603219-241603241 AGACACAGCCAAAATGAGCAAGG - Intronic
948999331 2:241603319-241603341 AGACACAGCCAAAATGAGCAAGG - Intronic
948999351 2:241603419-241603441 AGACACAGCCAAAATGAGCAAGG - Intronic
948999372 2:241603519-241603541 AGACACAGCCAAAATGAGCAAGG - Intronic
949061033 2:241957443-241957465 GGTGAGAGCCAGAAGGTGGAGGG + Intergenic
949071821 2:242029777-242029799 ACACACAGACTGAAGGAGGAAGG + Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169274996 20:4227742-4227764 AGAGAGAGAGAGAAGAAGGAAGG - Intronic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169507948 20:6233175-6233197 TGACAGAGCAAGACGAAGGAAGG - Intergenic
1169541639 20:6606134-6606156 AGAAAGAGAAAGAAAGAGGAAGG - Intergenic
1169848953 20:10029225-10029247 AGAGAGAGAGAGAAGAAGGAAGG + Intronic
1170637204 20:18117597-18117619 AGACAGAGAGAGAGAGAGGAAGG + Intergenic
1170690978 20:18614826-18614848 AGAAAGAGTGAGCAGGAGGAAGG - Intronic
1170933822 20:20792855-20792877 AGAGAGAGAGAGAAGCAGGAAGG - Intergenic
1171073749 20:22101952-22101974 AGACAGAGACAGAGAGAGAATGG + Intergenic
1171278152 20:23876048-23876070 AGACAGACACAGAAGGTGGCAGG - Exonic
1171411297 20:24950322-24950344 AGACAGGGACAGAAGGGGGCTGG + Intronic
1171573758 20:26277954-26277976 AGGCACAGCAAGAGGGAGGATGG - Intergenic
1171768829 20:29306084-29306106 AGACAGAGAGAGGAGGAGGAAGG + Intergenic
1171811964 20:29752377-29752399 AGACAGAGAGAGGAGTAGGAAGG + Intergenic
1171867549 20:30499447-30499469 AGACAGAGAGAGGAGGAGGAAGG + Intergenic
1171907717 20:30913315-30913337 AGACAGAGAGAGGAGGAGGAAGG - Intergenic
1171961262 20:31496740-31496762 ACCCAGACCCAGAAGGAAGAGGG - Intergenic
1172015626 20:31870797-31870819 AGGCAGAGCCGGAAGGGGGACGG - Intronic
1172107642 20:32526339-32526361 ACACAGACCGAGAAGCAGGAGGG + Intronic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1172863517 20:38076727-38076749 AGACAGGGCCAAAAAGAGAAAGG - Intronic
1173005084 20:39134149-39134171 AGACAGAGAGGGAAGGAGGGAGG - Intergenic
1173145422 20:40520401-40520423 AGAGAGGGACAGAGGGAGGAAGG - Intergenic
1173667733 20:44774767-44774789 AGCCACAGCCAGGAGAAGGACGG - Intronic
1174020008 20:47522487-47522509 ATACAGAGACAGAAGGAGGGGGG + Intronic
1174030473 20:47620562-47620584 AGGCAGAGCAAGGATGAGGAAGG - Intronic
1174157090 20:48522671-48522693 AGACAATGCCAGGAGGAAGAGGG - Intergenic
1174231910 20:49052539-49052561 AGCAAGAGCCAGGAGGAGGTAGG + Intronic
1174265130 20:49325770-49325792 AGGGAGGGCAAGAAGGAGGAGGG - Intergenic
1174532066 20:51222048-51222070 AGAGAGAGCCAGGGGGAGGAGGG + Intergenic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1175099747 20:56570609-56570631 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1175252286 20:57616811-57616833 GGACGGAGCCAGAGGGAGGCAGG + Intronic
1175356768 20:58375022-58375044 AGACAGAGATAGAGGGAGGGAGG - Intergenic
1175433051 20:58920703-58920725 ATACAGAGACAGAAGGAGGGGGG + Intergenic
1175503318 20:59465489-59465511 AGAAGGAGGAAGAAGGAGGAGGG - Intergenic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1175950148 20:62579093-62579115 AGACAGAGACAGAGGGAGGCAGG - Intergenic
1175950168 20:62579245-62579267 AGACAGAGACAGAGGGAGACAGG - Intergenic
1175950199 20:62579464-62579486 AGACAGAGACAGAGGGAGACAGG - Intergenic
1175950231 20:62579719-62579741 AGACAGAGACAGAGGGAGACAGG - Intergenic
1175950250 20:62579907-62579929 AGACAGAGACAGAGGGAGACAGG - Intergenic
1175965720 20:62659260-62659282 AGACAGAGACAGATGGAGATGGG + Intronic
1175981061 20:62738864-62738886 AGACAGGGCCAGCACGAGAAGGG + Intronic
1175986013 20:62764508-62764530 AGCCAGAGCCAGGAGGAGGCCGG + Intergenic
1176176950 20:63733192-63733214 AGACAGAGCCGTAAGGGGCAGGG - Intronic
1176233789 20:64044959-64044981 AGACAGGGCCAGGAGCGGGAGGG + Intronic
1176429344 21:6566581-6566603 GGACAGACCCAGGAGGAGCAGGG - Intergenic
1176552925 21:8237151-8237173 AGACAGAGAGAGGGGGAGGAAGG - Intergenic
1176571823 21:8419554-8419576 AGACAGAGAGAGGGGGAGGAAGG - Intergenic
1176579734 21:8464116-8464138 AGACAGAGAGAGGGGGAGGAAGG - Intergenic
1176870080 21:14076905-14076927 AGACAAAGACAGACAGAGGAAGG + Intergenic
1176924128 21:14725962-14725984 AGAGAGAACCAGAGGGAGGGAGG + Intergenic
1176944899 21:14967711-14967733 AGGCAGAGCCTCAAGGAGCAAGG - Exonic
1176958832 21:15136922-15136944 AGACAGCTCAAGAATGAGGATGG + Intergenic
1177046902 21:16182558-16182580 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1177332720 21:19683136-19683158 CTACAGAGACCGAAGGAGGAGGG - Intergenic
1177783706 21:25646595-25646617 AGAGAGAGAGAGAGGGAGGATGG + Intronic
1177833075 21:26161443-26161465 AGACAGAATAAAAAGGAGGAAGG - Intronic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178327340 21:31656648-31656670 AGAAAGAGAAAGAAGAAGGAAGG - Intergenic
1178505252 21:33157391-33157413 AGAAAGAGGGAGGAGGAGGAGGG - Intergenic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1178737483 21:35166268-35166290 AGAGAGAGAGAGAAGGAGGGAGG + Intronic
1178791573 21:35705108-35705130 AGACAGAGACAGAGAGAGGAAGG + Intronic
1179147200 21:38778577-38778599 AGAGAGAGCAAGTAGGGGGAAGG - Intergenic
1179162772 21:38911532-38911554 AGGAAAAGCCAGAGGGAGGATGG - Intergenic
1179166372 21:38938321-38938343 TCACAGAGACAGAAAGAGGAGGG - Intergenic
1179166765 21:38941402-38941424 AGGCGGAGCCAGAAGCAGGAAGG - Intergenic
1179225421 21:39448712-39448734 TGTCACAGCCAGAAGGATGAGGG + Intronic
1179237900 21:39563562-39563584 AGAGAGAGAAGGAAGGAGGAAGG - Intronic
1179358304 21:40682626-40682648 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
1179473232 21:41626019-41626041 AGAAAGAGAGGGAAGGAGGATGG + Intergenic
1179540349 21:42079585-42079607 GGGCAGATCTAGAAGGAGGAAGG + Intronic
1179626112 21:42650448-42650470 AGGCAGAGCCAGGGGAAGGAAGG + Intergenic
1179704736 21:43174043-43174065 GGACAGACCCAGGAGGAGCAGGG - Intergenic
1179971839 21:44840496-44840518 AGACAGAGCCGATAGGTGGAGGG - Intergenic
1180065570 21:45410463-45410485 GGCCAGAGCCACAGGGAGGAAGG + Intronic
1180314205 22:11264100-11264122 AGACAGAGAGAGGAGGAGGAAGG + Intergenic
1180341155 22:11619452-11619474 AGACAGAGAGAGGAGGAGGAAGG - Intergenic
1180341159 22:11619491-11619513 AGACAGAGACAGAGAGAAGACGG - Intergenic
1180750166 22:18119054-18119076 CGACAGACCCAGAAGGCTGAGGG + Intronic
1181093271 22:20488853-20488875 AGTCATAGCCACAAGGAGTAGGG + Intronic
1181577174 22:23802435-23802457 AGACAGAAGGAAAAGGAGGAGGG - Intronic
1181646115 22:24232539-24232561 AGAGAGAGGAAGAAGGAGGCCGG + Intronic
1181666485 22:24402007-24402029 AGAGGGAGCAAGAAGGAGGCAGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181851158 22:25750860-25750882 AGTCAGAGCCAGGAAGGGGAAGG + Intronic
1181901495 22:26159948-26159970 AGACAGAGAAAGAGGAAGGAGGG + Intergenic
1182046532 22:27278595-27278617 AGACAATGACAGAGGGAGGAAGG - Intergenic
1182129037 22:27837255-27837277 AGAAAGAGACAGAAGAAAGAAGG + Intergenic
1182198431 22:28543532-28543554 AGAGAGAGAGAGAAGGAGGGAGG + Intronic
1182260446 22:29070346-29070368 AGAGAGAGCCAATTGGAGGAGGG + Intergenic
1182368177 22:29792582-29792604 AGCAAGAGCCACAAGGAGGAGGG + Intronic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182681019 22:32080182-32080204 AGGCAGAGCCAGGAGGTGGGAGG - Intronic
1182830727 22:33302657-33302679 AGACGGAGTCAGAAGGAGGGAGG + Intronic
1182906323 22:33940050-33940072 AGACAAAGGCAGAAAGAGAATGG + Intergenic
1183089747 22:35513764-35513786 AGGGAGAGCCAGAGGGAGAAAGG + Intergenic
1183102541 22:35592760-35592782 AGAGTGAGCAAGATGGAGGAGGG - Intergenic
1183259929 22:36788127-36788149 TGAGAGAGGGAGAAGGAGGAAGG + Intergenic
1183263711 22:36812936-36812958 ACACAGAGCCAAATGGAGAAAGG + Intronic
1183724046 22:39578607-39578629 AGACAAACCCCCAAGGAGGAAGG - Intronic
1183967021 22:41447944-41447966 ACACAGAGCCAGGGGGAGGGAGG + Intergenic
1184004796 22:41700009-41700031 GGAAGGAGCCAGAAGGCGGAAGG - Intronic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184583613 22:45433339-45433361 GGACAGAGCCACAAGCTGGAAGG - Intergenic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
1185207596 22:49549001-49549023 AGACAGAGACAGATGGAAGAGGG - Intronic
1203257902 22_KI270733v1_random:153554-153576 AGACAGAGAGAGGGGGAGGAAGG - Intergenic
949286443 3:2411651-2411673 AGAAAGAGCAGGAGGGAGGAAGG - Intronic
949300253 3:2575489-2575511 TGACAGAGCCAGACTCAGGAAGG + Intronic
949357890 3:3201313-3201335 GGGCAGGGCCAGAAGGAGGCTGG - Intergenic
949439847 3:4068667-4068689 ACACACAGCCAGCAGGTGGAAGG - Intronic
949563247 3:5221830-5221852 ACACAGAGCCAGAGTGGGGAGGG - Intergenic
949723006 3:7012512-7012534 AGAAAAAGGCAGAAGCAGGAAGG + Intronic
949790584 3:7787666-7787688 ATACAGAGCAAGAACAAGGAAGG - Intergenic
949817598 3:8076340-8076362 ATCAAGAGCCAAAAGGAGGAAGG - Intergenic
949818276 3:8086037-8086059 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
949875495 3:8623738-8623760 AGCCAGAGCCAGACAGAGAAGGG + Intronic
950015952 3:9754985-9755007 AGGCAGAGCAGGAAGGAGAAAGG + Intronic
950109711 3:10411178-10411200 ACACAGACACAGAAGGATGATGG + Intronic
950193845 3:10995293-10995315 TCACATAGCCAGGAGGAGGAAGG + Intronic
950645586 3:14374696-14374718 TGGCAGAGACAGCAGGAGGAGGG + Intergenic
950835757 3:15917723-15917745 AGAGAGAGCTTGAAGGAGCAGGG + Intergenic
950889068 3:16387211-16387233 ACCCAGGGCCACAAGGAGGAGGG + Intronic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
952002063 3:28797538-28797560 AGACAGAGAGAGAAAGAGAAAGG - Intergenic
952090906 3:29884486-29884508 AGACAGAGAAAGAGGGAGGGAGG - Intronic
952110062 3:30112230-30112252 AGAAAGAGAAAGAAAGAGGAAGG - Intergenic
952230511 3:31424834-31424856 AGAAAGAGAAAGAAAGAGGAAGG + Intergenic
952878838 3:37970539-37970561 AGACAGAGGAAGTGGGAGGAGGG - Intronic
953006814 3:38986603-38986625 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
953082316 3:39632187-39632209 AGAGAGAGAAAGAGGGAGGAAGG - Intergenic
953232761 3:41079206-41079228 TGACAGAGCTAGAAGGAGGCCGG + Intergenic
953312194 3:41890866-41890888 AGAAAGGGACAGAAGGGGGAAGG + Intronic
953435631 3:42875068-42875090 AGCCACAGCCAGGAGAAGGAGGG - Exonic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953660764 3:44890036-44890058 AGAGAGAGCGAGAAAGAGCAGGG + Intronic
953691832 3:45126242-45126264 AGAGAGAGAGAGAAGAAGGAAGG - Intronic
953929052 3:46996907-46996929 AGCCAGGGTCAGAGGGAGGAGGG - Intronic
954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG + Intergenic
954397329 3:50299637-50299659 AGGCAGAGCCAGCTGGAGGCGGG - Intergenic
954830069 3:53413487-53413509 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
954962110 3:54575804-54575826 AGGCAGGGAGAGAAGGAGGAAGG + Intronic
955207434 3:56909105-56909127 AGAGAGAGAAAGAAGGAGAAGGG + Intronic
955360009 3:58265812-58265834 AGAGTGAGCCAGAAGCAAGAGGG + Intronic
955694435 3:61621557-61621579 AGACAGAGAGAGAAAGAGGGAGG - Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
956010825 3:64829795-64829817 AGACAGAAAGAGAAGAAGGAAGG - Intergenic
956230788 3:67014155-67014177 TGGCACAGCCAGAAAGAGGATGG - Intergenic
956563876 3:70614310-70614332 AGAGGGAGCCAGAGAGAGGAAGG + Intergenic
956566347 3:70642993-70643015 TGACACAGCCACAAGGTGGAGGG - Intergenic
956741351 3:72278747-72278769 AGACAGGGCAAAAAGGAGGTGGG + Intergenic
956753302 3:72362327-72362349 AGACAGAGCCTGCAGGAAGTAGG + Intergenic
957274111 3:78068206-78068228 ATACAGAGACAGAGAGAGGAGGG + Intergenic
957556538 3:81769285-81769307 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
957587949 3:82156945-82156967 AGAGAGAGACAAAAGGAGGAAGG - Intergenic
957813170 3:85254858-85254880 GGAGAGAGACAGAAGGAGGGAGG - Intronic
957937980 3:86968764-86968786 GGGCAGAGCCAGCAGGAGGGTGG + Exonic
958080474 3:88740212-88740234 AGAAAGAGGAAGAAGGTGGAGGG - Intergenic
959020897 3:101186566-101186588 AGAAAGAGCTAAAAGCAGGAAGG + Intergenic
959391891 3:105785593-105785615 TTCCAGAGCCAGAAGAAGGAAGG - Intronic
959437211 3:106330613-106330635 AAACAGAACCAGCAGGAGGTAGG - Intergenic
959440239 3:106365348-106365370 AGAAAGAGGAAGAAGGACGAAGG - Intergenic
959563111 3:107805159-107805181 AGACAGAATGGGAAGGAGGAAGG + Intronic
959788271 3:110327904-110327926 AGACAGAGAGGGAAGGGGGAAGG - Intergenic
960220337 3:115100344-115100366 AGAGAGAGCAAGAGAGAGGAGGG + Intronic
960324483 3:116278506-116278528 AGAAAAAGCCAGGAGGAGCAGGG + Intronic
960390770 3:117075233-117075255 AGTCACAGTCACAAGGAGGAGGG + Intronic
960509069 3:118526277-118526299 AGGCAGAGCTAGCAGGAGGATGG + Intergenic
960529498 3:118747235-118747257 AGAGAAAGCCAGGAAGAGGACGG + Intergenic
960588806 3:119345748-119345770 GGACAGAGCCAGGAAGAGAAAGG - Intronic
960805969 3:121584193-121584215 AGACAGAGAGAGAGGAAGGAAGG + Intronic
961158956 3:124705864-124705886 AGAGAGAGAAAGAGGGAGGAAGG - Intronic
961316447 3:126038995-126039017 AGACGGAGCGAGAGGGAGGGAGG - Intronic
961427378 3:126858674-126858696 AGACACAGCCAGAATGCGGCAGG + Intronic
961514376 3:127423562-127423584 AGAGAGTGGCAGACGGAGGAGGG - Intergenic
962139837 3:132777829-132777851 AGACAGACAGAGAAGAAGGATGG - Intergenic
962264423 3:133935131-133935153 AAGCAGAGCCAGAAGGAGAGAGG + Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962483125 3:135815112-135815134 TGGCAGAGCCAGAAGGTAGATGG - Intergenic
963197001 3:142543498-142543520 AGAAAGAGAAAGAGGGAGGAAGG - Intronic
963254457 3:143130858-143130880 AGAAAGAGAGGGAAGGAGGAAGG - Intergenic
963290090 3:143478448-143478470 AGGCAGAGTCAGCAGGAGGCTGG + Intronic
963473703 3:145776584-145776606 AGATAGAGAAAGAGGGAGGAAGG - Intergenic
963811139 3:149777582-149777604 AGCCAAGGGCAGAAGGAGGAGGG - Intronic
964730919 3:159863725-159863747 AGACAGAGAGAGAAGGAGAGGGG + Intronic
965002896 3:162980578-162980600 AGACAGAGGCAGAAATTGGAGGG - Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965496542 3:169405238-169405260 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
965565422 3:170111379-170111401 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
965819072 3:172666479-172666501 ATACAGAGACAGAGGGAGGGGGG - Intronic
965912174 3:173792010-173792032 AGACAGAGGCAGAGAGAGAAAGG + Intronic
966142169 3:176768988-176769010 AGAAAGAGAAAGAAAGAGGAAGG + Intergenic
966461390 3:180180586-180180608 AGAGAGAGAAAGAAGGAGGGGGG + Intergenic
966857655 3:184206421-184206443 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
967149100 3:186631800-186631822 AGAGAGAGCTAGAAAGTGGAAGG - Intergenic
967198310 3:187048845-187048867 GGACAGAGCCAGATGGAAAAGGG - Intronic
967494484 3:190127644-190127666 AGTTAGAGCCAGAAGGAGTAAGG - Intergenic
967616070 3:191568320-191568342 AGAAAGAGGCAGGAGGAGAAAGG + Intergenic
967775064 3:193377785-193377807 AGACAGAGACAGACAGGGGAAGG - Intronic
967881012 3:194301676-194301698 ACAGAGAGCAAAAAGGAGGAAGG + Intergenic
968007034 3:195250074-195250096 TGCCAGAGCTAGCAGGAGGAGGG - Intronic
968131173 3:196193815-196193837 AGTCAGACCCAGATGGAGCATGG + Intergenic
968145053 3:196291107-196291129 AGACAGAGAGAGAGAGAGGAAGG + Intronic
968285773 3:197507888-197507910 AGACAGAGCAAGAGGGCTGAGGG - Intergenic
968454341 4:689348-689370 AGCCTGAGGCCGAAGGAGGAGGG - Exonic
968570591 4:1338420-1338442 AGACAGTGCTACAAGGAGGACGG + Exonic
968619189 4:1596098-1596120 ACACAGAGACAGAGGGACGAGGG + Intergenic
968753316 4:2401552-2401574 TCACAGAGCCAGAAGGAGGAGGG - Intronic
968973203 4:3807100-3807122 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
969047387 4:4346237-4346259 AGACAGACCCAGAGGAAGGAAGG - Intergenic
969314806 4:6375435-6375457 AGGCAGAGGCAGAAAGAGAATGG - Intronic
969327703 4:6453333-6453355 AGACAGATCCCCAAAGAGGAAGG + Intronic
969484780 4:7466264-7466286 GGGCAGAGCCACAAGGAGGCAGG - Intronic
969493181 4:7511533-7511555 AGACAGAGACAGAAGGCCCAGGG + Intronic
969511786 4:7622206-7622228 ACAGGGAGCAAGAAGGAGGAGGG + Intronic
969615843 4:8252233-8252255 AGACAGAGGCAGAGGGAGGTTGG - Intergenic
969941850 4:10740062-10740084 AGACAAAGCTAAGAGGAGGAGGG + Intergenic
970088888 4:12380679-12380701 AGACAGAGCAAGAGAGAGTAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970356266 4:15256258-15256280 AGACAAAGCTAGAAGAACGAGGG - Intergenic
970705874 4:18801651-18801673 AGACAGAGCCACAAGGCAGGTGG + Intergenic
970769372 4:19592145-19592167 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
971037921 4:22715281-22715303 ACACAGAGACACAAGGGGGAAGG + Intergenic
971092283 4:23360248-23360270 TCACAGAGCCAGCAGGAGGTGGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971195243 4:24467089-24467111 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
971230589 4:24798068-24798090 AGACAGAGAGAGAGGAAGGAAGG - Intronic
971345645 4:25809645-25809667 AGAGAGAGAGAGATGGAGGAAGG - Intronic
971447062 4:26762172-26762194 AGACAGATTCAGAAGGAGGTAGG + Intergenic
971513423 4:27456300-27456322 TGACATAGTCAGGAGGAGGAGGG - Intergenic
971803256 4:31319671-31319693 AGGCAGAGCCACAAGAAGGAAGG - Intergenic
972268587 4:37486636-37486658 AGAAAGAGAAAAAAGGAGGAAGG + Intronic
972279606 4:37589591-37589613 GAAGAGAGCCAAAAGGAGGAAGG - Intronic
972332156 4:38073964-38073986 AGACTGTGGCAGAGGGAGGATGG + Intronic
973260743 4:48160816-48160838 AGAGAGAGACAGAGGGAGGGAGG + Intronic
973320377 4:48804231-48804253 AGAGAGAGAGAGAAAGAGGATGG - Intergenic
974014838 4:56639446-56639468 AGACAGAGCTAGCAAGAGCAGGG - Intergenic
974155755 4:58070043-58070065 CCACAGAGACAGAAGGAGGGAGG + Intergenic
974204930 4:58689718-58689740 AGAAAGAGACAGAGAGAGGAAGG - Intergenic
974316931 4:60294656-60294678 TGAAAGAGAAAGAAGGAGGAAGG + Intergenic
974569238 4:63623537-63623559 AGAAAGAGCGAGCATGAGGAGGG + Intergenic
974845794 4:67350224-67350246 AAAAAGAGAAAGAAGGAGGATGG + Intergenic
975112312 4:70641828-70641850 AGAGAGAACCAGAAAGAGTATGG + Intronic
975260059 4:72287512-72287534 AGAGAGAGCCAGGAAGAGGCAGG + Intronic
975421790 4:74173152-74173174 GGACAGGGGCAGAAGGAAGAAGG + Intronic
975738113 4:77401496-77401518 AGACAGGGAAAGAAGGAAGAGGG - Intronic
975779131 4:77820217-77820239 AGAGAGTGCGAGAACGAGGAGGG + Intergenic
975787466 4:77907515-77907537 AGAGAGAGAGGGAAGGAGGAAGG - Intronic
975826070 4:78320648-78320670 AGAGAGAGACAGAAGGAGGGAGG - Intronic
976467132 4:85383564-85383586 AGACAGAGACATAGGGAAGATGG + Intergenic
977336850 4:95710347-95710369 AGAAAGGGACAGAGGGAGGAAGG - Intergenic
977730788 4:100349228-100349250 AGAAAGAGACAGAAAGAGAAAGG + Intergenic
978012488 4:103704543-103704565 AGACAGAGCAAGCAAGAGCAGGG + Intronic
978139737 4:105304920-105304942 ACCCACAGCCAGAAGAAGGAAGG + Intergenic
978408817 4:108407184-108407206 AGACAGAGCCAGAGAGAAGGGGG + Intergenic
978706471 4:111718797-111718819 AGACACAGCCAGAGGGGGGAGGG + Intergenic
979072597 4:116228023-116228045 AGACATCACCAAAAGGAGGAAGG + Intergenic
979495139 4:121374972-121374994 CGGCACAGCCAGAGGGAGGATGG - Intronic
979579654 4:122342276-122342298 TGACAGAGTCAGGAGTAGGAAGG + Intronic
979834138 4:125340486-125340508 AGACTGAGGCAGGAGGAGAATGG - Intronic
980096331 4:128495024-128495046 AGAGAGAGCGAAAAGAAGGAAGG - Intergenic
980115751 4:128677673-128677695 AGATGGAGCCACAAGGTGGATGG + Intergenic
980568898 4:134584164-134584186 AGAGAGAGACAGAGAGAGGAAGG - Intergenic
980609017 4:135132407-135132429 AGAGAGAGAAAGAAGAAGGAAGG - Intergenic
980734494 4:136867419-136867441 ATACAAAGCAAGAAGGGGGATGG - Intergenic
980928681 4:139164097-139164119 AGAGAGAGAAAGAGGGAGGAAGG + Intronic
980982538 4:139666849-139666871 ACAAACAGCCAGAAGCAGGAAGG + Intronic
981437430 4:144741974-144741996 AGAGAGAGAGAGAAGGAGGGAGG - Exonic
981632599 4:146837731-146837753 AAACAGAGCCAGGATCAGGATGG + Intronic
981964272 4:150581983-150582005 AGAGAGAGCGAGCACGAGGAAGG + Exonic
982437081 4:155392169-155392191 AGACAGAGAGAGAAAGAGGAAGG + Intergenic
982882087 4:160731944-160731966 AGAAAGAGACAGAGGGAGGGAGG - Intergenic
982941228 4:161559327-161559349 AGAAAGAACAAGGAGGAGGATGG - Intronic
983043135 4:162954316-162954338 TGACAGAGACAGAGGGAGGGGGG + Intergenic
983274921 4:165605269-165605291 AGACAGACAGAAAAGGAGGATGG - Intergenic
983679048 4:170330840-170330862 ACACAGAGCCAGAAAGATGGGGG - Intergenic
983768156 4:171512725-171512747 ATACAGAGGCAGAGGGAAGAGGG - Intergenic
983830654 4:172322630-172322652 AGAGAGAGCGTGAAGGTGGAGGG + Intronic
984070303 4:175103252-175103274 AGAAAGAGAAAGAAGGAGAAGGG + Intergenic
984471870 4:180186371-180186393 AGAAGGACCCAGAAGTAGGATGG - Intergenic
984563789 4:181302773-181302795 AGAAAGAGACAGAAAGAAGAGGG - Intergenic
984844255 4:184096704-184096726 AGAATGAGCCAGAATGACGAGGG - Intronic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
984888465 4:184472549-184472571 AGTCACAGCCATAAGGAGGCCGG + Intronic
984922455 4:184777794-184777816 AGACAGAGACAGAGGGAGGCAGG + Intronic
984941545 4:184936471-184936493 ATACAGAGACAGAGGGAGGGGGG - Intergenic
985009309 4:185566327-185566349 ATACAGAGACAGAGGGAGGGGGG + Intergenic
985300208 4:188480553-188480575 AGAAAGAGCTAGAAGAAGAAGGG - Intergenic
985489885 5:173008-173030 AGCAAGACCCAGAAGGTGGAGGG + Exonic
985661652 5:1160274-1160296 AGACAGAGACAGAGAGAGGGAGG + Intergenic
985670922 5:1206230-1206252 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
986641504 5:9876133-9876155 AAACAGCTCCAGAAGGATGAGGG + Intergenic
986649077 5:9946252-9946274 AGAGAGAGCCAGAAAGATGCGGG - Intergenic
986784185 5:11096766-11096788 AGAGAGAGACAGAGGGAGGGAGG + Intronic
987038279 5:14038949-14038971 AGACAGAGACAGATGGGAGAAGG - Intergenic
987040843 5:14060885-14060907 AGACAGATTCAGAAGGGGAATGG + Intergenic
987083263 5:14445384-14445406 AGACAGAGCGAGCAGCAGAAGGG + Intronic
987429968 5:17820818-17820840 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
987507978 5:18798071-18798093 ATACAGAGACAGACGGAGGGAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988314728 5:29610117-29610139 ACCCAGAGCCAGAGGGTGGAAGG - Intergenic
988329335 5:29815045-29815067 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
988456276 5:31389732-31389754 AGAAAGAGAAAGAAAGAGGAAGG + Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988832748 5:35003478-35003500 AGATAGAGGCAGACAGAGGATGG - Intronic
988940563 5:36140702-36140724 AGAGAAAGCCATAAAGAGGACGG + Intronic
988980931 5:36568449-36568471 AGACGCAGCCTGAAAGAGGATGG - Intergenic
989034601 5:37156784-37156806 AGACAGAGAAGGAGGGAGGAAGG + Intronic
989251349 5:39319429-39319451 AGACAGGCCCAGAATGAGGCTGG + Intronic
989708947 5:44373048-44373070 AGACAGAGCAAGTTGAAGGAAGG - Intronic
990202414 5:53391566-53391588 AGAGAGAGAGAGAAGGAGGTAGG + Intergenic
990736577 5:58870053-58870075 AGACAGAGACAGAGAGAGGCAGG + Intergenic
990991187 5:61685632-61685654 AGACACAGCCAGAAGTTGCAAGG - Intronic
991173520 5:63657509-63657531 AGACAGAGACAGAGAGAGGATGG + Intergenic
991210238 5:64096125-64096147 AGACAGTAGAAGAAGGAGGAGGG - Intergenic
991605437 5:68396135-68396157 AGACAGTGGAAGAATGAGGAAGG + Intergenic
992004465 5:72463706-72463728 AGAAAGGACCAGCAGGAGGATGG + Intronic
992187257 5:74256273-74256295 AGATGGAGCCAGGTGGAGGAGGG - Intergenic
992203066 5:74402856-74402878 AGAAAGAGCACGTAGGAGGAGGG + Intergenic
992484514 5:77181549-77181571 AGATTGAGCCAGAAGCAGAATGG - Intergenic
992531990 5:77660791-77660813 AGAAAGAGCAAGAGGGAGAAAGG - Intergenic
992543307 5:77785407-77785429 AGCCAGGTCCAGAAGCAGGATGG - Intronic
992586971 5:78250961-78250983 AGACAGAGGCAAACAGAGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993128411 5:83863986-83864008 AGGCAGAGCCAGAAGTAGATCGG - Intergenic
993427398 5:87784898-87784920 AGACAGAGGGAAAAGGAGGAAGG + Intergenic
994107048 5:95960606-95960628 AGCCAGAGCCAGAAGGTGTGGGG - Intronic
994279451 5:97884366-97884388 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
994694934 5:103062377-103062399 AGAAACAGGCAGAAGGAGTAAGG + Intergenic
994728536 5:103464599-103464621 AAACAAGGCCAGGAGGAGGAGGG - Intergenic
994815121 5:104576227-104576249 GGACAGAGAGAGAGGGAGGAGGG - Intergenic
995248990 5:109967614-109967636 AGACAAGGCCAGTAAGAGGATGG - Intergenic
996187182 5:120491494-120491516 AGACAGAGAGAAAAGAAGGAAGG - Intronic
996545203 5:124670691-124670713 AGACAGAGACAGAGAAAGGAAGG + Intronic
996904927 5:128588031-128588053 AGACAGTGGCTGGAGGAGGAGGG - Intronic
997204240 5:132032926-132032948 AGAAAGAGAGAGAAGGAGGGAGG + Intergenic
998520973 5:142800285-142800307 AGACAGAGAGAGGGGGAGGAAGG - Intronic
998564885 5:143208015-143208037 ACACAGAGACAGAAGCAGGCTGG - Intronic
998615523 5:143736102-143736124 AGATTGAGGCAGAAGGAGGCAGG - Intergenic
998740537 5:145195709-145195731 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999154429 5:149448262-149448284 GGACAGTGACAGAAGGATGAAGG - Intergenic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
999454003 5:151699627-151699649 AGACAGAGTCAGACAGTGGAAGG + Intergenic
999537004 5:152528682-152528704 ATAAGGAGCCAGAAGGGGGATGG + Intergenic
999694987 5:154180743-154180765 TGGCAGTGCCAGGAGGAGGATGG + Intronic
999719832 5:154391453-154391475 AGACAGACAGAGAAGGAGGGAGG - Intronic
999794570 5:154977012-154977034 ACACAGAGACAGAAGTAGAATGG - Intergenic
1000302114 5:159965658-159965680 TGGCAGAGGAAGAAGGAGGAAGG + Intronic
1000305640 5:159991995-159992017 AGAGAGAGTCATAAGGAGGCTGG + Intergenic
1000652037 5:163830231-163830253 ACACAGTGTGAGAAGGAGGAGGG + Intergenic
1000767429 5:165309427-165309449 AGATAAAGCCAGAAGGAGGGAGG + Intergenic
1001408736 5:171495379-171495401 AGGGAGAGCGGGAAGGAGGAAGG + Intergenic
1001514338 5:172344972-172344994 AGAGAAAGAAAGAAGGAGGAAGG + Intronic
1001588137 5:172847146-172847168 GGACAGAGCCAGAAGACGCAAGG - Intronic
1001791540 5:174461799-174461821 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1001852632 5:174982924-174982946 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
1001856179 5:175012665-175012687 AGACAGAGCCAGAAGTGGGTGGG - Intergenic
1002000931 5:176195946-176195968 AGCCACAGACAGATGGAGGAAGG + Intergenic
1002171945 5:177379824-177379846 AGAAAGAGAAAGAAGGAAGAAGG - Intronic
1002253403 5:177943026-177943048 AGCCACAGACAGATGGAGGAAGG - Intergenic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1002614085 5:180439565-180439587 GCACAGAGCCAGCAGGAGGCGGG - Intergenic
1002795677 6:469444-469466 AGACAGAGACAGGGAGAGGAGGG - Intergenic
1002795712 6:469706-469728 ACACAGAGACAGAGAGAGGAGGG - Intergenic
1003308096 6:4946823-4946845 GGTCAGTGCCAGAGGGAGGAGGG - Intronic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003714239 6:8628617-8628639 AGACAGAAAGAGAAGAAGGAAGG - Intergenic
1003893839 6:10588119-10588141 AGAGAGGGACAGAAAGAGGATGG + Intronic
1004184371 6:13409354-13409376 AGAAAGAGACAGAGGAAGGAAGG + Intronic
1004247474 6:13993664-13993686 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
1004737167 6:18419206-18419228 AGCCATAGGCAGGAGGAGGAGGG - Intronic
1004915900 6:20331883-20331905 AAAGAAAGCCAGAAGGAGGTTGG + Intergenic
1004950300 6:20662754-20662776 TGACAGACACAGAAGGTGGAAGG - Intronic
1004953808 6:20704542-20704564 AGAAAGTGCCAGAGGGAGAATGG + Intronic
1005047226 6:21653867-21653889 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1005089698 6:22043512-22043534 AGAGAAAGCCAAAAGGAGGTAGG - Intergenic
1005519186 6:26583853-26583875 AGTCAGGGGCAGAAGCAGGAAGG - Intergenic
1005714619 6:28535006-28535028 TGACAGAGTAAGAAGGAGGAGGG - Intergenic
1005885958 6:30098032-30098054 AGACAGTGCTAGGAGGAAGATGG + Intergenic
1006018269 6:31100282-31100304 GGACAGAGACAGTAGAAGGATGG - Intergenic
1006408992 6:33861383-33861405 AGACAGTGGCAGAAGCAGCATGG - Intergenic
1006562985 6:34929796-34929818 AGAGAGAGAGAGAAGGAGGAAGG - Intronic
1006682727 6:35808797-35808819 AGGCAGTGCCAGGAGGGGGAGGG + Intronic
1006832975 6:36979951-36979973 AGAAAGACCCAGAATGAGGGAGG - Intronic
1006953965 6:37850183-37850205 AAACATAACCAGAAGCAGGATGG + Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007183343 6:39946689-39946711 AGACAGATCCAGAGGTAGGATGG - Intergenic
1007341219 6:41192578-41192600 AGGCAGAGCCAGAAAGGGGCTGG - Intronic
1007522840 6:42465685-42465707 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1007625616 6:43244586-43244608 AGACACAGAGAGAAGGAGGGTGG + Intronic
1007626765 6:43251120-43251142 AGAAAGAGACAGGAGCAGGAAGG - Intronic
1007632211 6:43278831-43278853 GCACAGAGCCAGATGGGGGAAGG + Intronic
1008215838 6:48787315-48787337 AGACAGAGAGAGAGGGAGAATGG + Intergenic
1008743648 6:54642078-54642100 AGACAGAGAGAGAGGGAGGGAGG - Intergenic
1008766049 6:54916215-54916237 AGAAAGAGAAAGAGGGAGGACGG - Intronic
1008881204 6:56382430-56382452 AGACAGAGAAAGAAGGAGGTGGG - Intronic
1009859159 6:69303543-69303565 GGACATAGCCAGCAAGAGGAAGG - Intronic
1009983070 6:70748787-70748809 TGACAGAGACAGAAGTGGGAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010059273 6:71603926-71603948 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
1010248820 6:73687364-73687386 AGAAAGAGAAAGAAAGAGGAAGG - Intergenic
1010815785 6:80356882-80356904 AGGCAGAGGCAGAAGGAGTCGGG - Intergenic
1011300861 6:85872235-85872257 AGAAAGAGAGAGAAGAAGGAAGG - Intergenic
1011480552 6:87789420-87789442 AGACACAGGCAGGAGGAGAAGGG + Intergenic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1011529323 6:88302773-88302795 AGACAGAGGCAGGAGATGGAGGG + Intergenic
1011601446 6:89064102-89064124 AGAAAGAGAAAGAAGGAGGGAGG - Intergenic
1011720900 6:90155683-90155705 AAACAGAGCAGGAAAGAGGAGGG - Intronic
1011744601 6:90397293-90397315 AGACAGAGCAATTAGCAGGAGGG - Intergenic
1011925930 6:92644787-92644809 AGACATGGACAGAAGGTGGATGG - Intergenic
1012874411 6:104709527-104709549 AGACAGAGCAAGCAGGGGGTTGG - Intergenic
1013023637 6:106246352-106246374 AGACAGAGACAGAGAGAGAATGG - Intronic
1013269662 6:108534225-108534247 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1013308305 6:108870510-108870532 AGAGAGAGACAGAAAGAGAAAGG + Intronic
1013797507 6:113904023-113904045 AGACAGAGGGAGGAGGAGGGAGG - Intergenic
1013805674 6:113993367-113993389 AGACAGAGCCACAAGATGGAAGG + Intronic
1014078669 6:117265258-117265280 AGAGAGAGAGAGAAGGAGGCGGG - Intergenic
1014241062 6:119017904-119017926 AGAGAGAGCGAGAGAGAGGAAGG - Intronic
1014511002 6:122322225-122322247 AGACAGAGAGGGAAGGAGGAAGG + Intergenic
1014831050 6:126103276-126103298 AGACACAGCCAGAAACAAGAAGG - Intergenic
1014869563 6:126576256-126576278 AAACAGAGGCAGAAGAAGAAAGG - Intergenic
1014949301 6:127536697-127536719 AGAAAGAGATAGAGGGAGGAAGG + Intronic
1014959031 6:127659492-127659514 AGACAGAGGCAGACGGATCAAGG - Intergenic
1015221339 6:130806855-130806877 AGACAGAGTCTCCAGGAGGAGGG + Intergenic
1015366468 6:132401824-132401846 AGGCAGAGGGAAAAGGAGGAGGG + Intergenic
1015478436 6:133679679-133679701 AGACAGAGATGGAAGGAGGAAGG + Intergenic
1015552436 6:134426129-134426151 AGAAAGAGGGAGAGGGAGGAAGG - Intergenic
1015556779 6:134470721-134470743 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
1015615928 6:135075233-135075255 AGAAAGAGAAAGAAGGAGGAAGG - Intronic
1015973548 6:138767038-138767060 AGAAAGAGAGGGAAGGAGGAAGG - Intronic
1016393327 6:143596951-143596973 AGACACAGGCAGAAGGCAGATGG - Intronic
1016699484 6:147038157-147038179 AGAAAGAGTCTGAAGGAAGATGG + Intergenic
1016779911 6:147945718-147945740 ACACAGAGCCAGGAGGAAGGTGG - Intergenic
1016915924 6:149244435-149244457 TGACGGAGCATGAAGGAGGAAGG + Intronic
1016916580 6:149249529-149249551 AGACAGAGACAGAAAGAGAGAGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017331276 6:153200436-153200458 AGACAGAGGCACATGGGGGAAGG - Intergenic
1017385385 6:153876709-153876731 AGAGAGAGAGAGATGGAGGAAGG + Intergenic
1017558996 6:155606703-155606725 AGAGAGAGCCAGTAAGAGCAGGG + Intergenic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017586939 6:155936875-155936897 AAATAGAGAGAGAAGGAGGAGGG + Intergenic
1017776843 6:157687440-157687462 AGAAAGAGAGAGAGGGAGGAAGG + Intergenic
1018609960 6:165638385-165638407 AGACAGAGAGAGAGGGTGGAAGG + Intronic
1018739545 6:166717006-166717028 ATCCGGAGCCAGAAGGAGCAGGG + Intronic
1018816797 6:167338939-167338961 AGGGAGAGCAGGAAGGAGGAAGG - Intronic
1018891835 6:167988310-167988332 AGCCAGAGGCAGGAGGAGGCAGG + Intergenic
1018961666 6:168453663-168453685 AGACAGAGACAGAAAGAGACAGG - Intronic
1019206081 6:170363110-170363132 AGACAAAGCCAGCAGGAGGAGGG - Intronic
1019328495 7:451289-451311 AGACAGAGACAGAAGGATAGAGG - Intergenic
1019511386 7:1419358-1419380 AGAGACAGCGAGGAGGAGGAGGG - Intergenic
1019809281 7:3152706-3152728 AGAGAGAGAGAGAGGGAGGAAGG + Intronic
1019821000 7:3242661-3242683 AGAGAGAGACAGAGAGAGGAGGG - Intergenic
1019830325 7:3321824-3321846 AGAGAGAGAGAAAAGGAGGAAGG - Intronic
1020011480 7:4807970-4807992 AGACAGGGAGAGAGGGAGGAGGG - Intronic
1020135273 7:5584308-5584330 AGACAGACCCACAGGGTGGATGG + Intergenic
1020274508 7:6616048-6616070 AGAAAGAGCCAGGAGGCGCAGGG - Exonic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021176985 7:17460634-17460656 ATACAGAGACAGAGGGAGGGAGG + Intergenic
1021362096 7:19728183-19728205 AGAGAGAGAAAGAAAGAGGAGGG - Intronic
1021638679 7:22716944-22716966 AGACAAAGCAAGAAGGGGAAAGG - Intergenic
1021805891 7:24354540-24354562 AGAGATAGCCAGAAGGGGGGTGG + Intergenic
1021918347 7:25457585-25457607 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
1023325706 7:39053388-39053410 AGACAGAGAAGAAAGGAGGAAGG - Intronic
1023560668 7:41470309-41470331 GGTCAGAGTCTGAAGGAGGAGGG - Intergenic
1023709649 7:42977917-42977939 AGAAAGAGACAGAAAGGGGAGGG - Intergenic
1023870258 7:44259401-44259423 ACACAGAGCCTGAAGGCAGAAGG - Intronic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024175822 7:46839998-46840020 AGACAGGGAGGGAAGGAGGAAGG + Intergenic
1024314768 7:48005423-48005445 AGAAAGGGACAGAAGGAGAATGG - Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1025029487 7:55545505-55545527 ATACTGGGCCAGAAAGAGGATGG - Intronic
1025251675 7:57355438-57355460 AGAAAGAGAGAGAAAGAGGAGGG - Intergenic
1025718698 7:63989038-63989060 AGACAGAGAGAGAGGGAGGGAGG + Intergenic
1025994325 7:66518604-66518626 GGACAGAGGCAGCAGGAGGAGGG - Intergenic
1026033672 7:66816059-66816081 GGACAGAGCCAGCAGGAGGAGGG + Intergenic
1026110548 7:67455761-67455783 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026457376 7:70584557-70584579 ATACAGAGCCAGAATAAAGAAGG + Intronic
1026516488 7:71077833-71077855 AGAGCGAGCCAGAACGAGCAAGG - Intergenic
1026529563 7:71185176-71185198 AGAGAGAGACAGAGAGAGGAAGG - Intronic
1026549059 7:71351549-71351571 AGACAGAGACAGAAGGAAGGAGG + Intronic
1026588985 7:71680171-71680193 AGAGAGAGCGGGAGGGAGGAAGG - Intronic
1026589049 7:71680363-71680385 AGAGAGAGCGCGAGGGAGGAAGG - Intronic
1026819478 7:73537264-73537286 AGGCAGGGCCAGGAGGCGGAGGG + Exonic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026837580 7:73648645-73648667 AGAGAGAGAAAGAAAGAGGAGGG - Intergenic
1026838295 7:73652754-73652776 AGACAGAGGCACAGGGAGGTTGG + Intergenic
1026985935 7:74555293-74555315 GGACAGAGGCAGCAGGAGGAGGG - Intronic
1027220564 7:76211266-76211288 AGGCAGAGGCACAAGGAGGCAGG + Intronic
1027600759 7:80237761-80237783 AGAAAGAGCATGAAGGGGGAAGG + Intergenic
1027769882 7:82393020-82393042 AGACAGAGAGAGAGGAAGGAAGG + Intronic
1027899433 7:84091323-84091345 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1028109462 7:86921390-86921412 ACACAGACCCAGAGGGAGGACGG + Intronic
1028505478 7:91565919-91565941 AGCCAGACTGAGAAGGAGGAGGG - Intergenic
1028636766 7:92997921-92997943 AGAAAAAGAGAGAAGGAGGAAGG - Intergenic
1028636791 7:92998010-92998032 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1029106480 7:98180942-98180964 AGAGAGAGAGAGAAAGAGGAGGG + Intronic
1029249157 7:99223701-99223723 AGAAAGAGAAAGAGGGAGGAAGG + Intergenic
1029253817 7:99255453-99255475 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1029416345 7:100445562-100445584 AGACAGAGACAGAAAGGGGCAGG - Intergenic
1029421154 7:100472483-100472505 AGACAGAGACAGCAGGAGGCTGG + Intronic
1029578332 7:101418967-101418989 AGAAAGAGCCAGAAGGCTGAAGG - Intronic
1030120740 7:106108439-106108461 AGACAGGGATAGAAGCAGGAGGG - Intronic
1030509918 7:110471390-110471412 AGAGAGAGAGAGATGGAGGATGG + Intergenic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031164813 7:118215106-118215128 AGACAGAGCCAGAAGAGGACAGG - Intronic
1031220250 7:118956522-118956544 TGACAGAGACAGAGGGAGGGGGG + Intergenic
1031303553 7:120095268-120095290 AGAAAGAGAAAGAAGGAAGATGG + Intergenic
1031985832 7:128164218-128164240 TGAGAAAGCCAGAAGGAGGCAGG + Intergenic
1032089558 7:128904419-128904441 AGAGAGAGAAAGAGGGAGGATGG - Intronic
1032228851 7:130056183-130056205 AGAGAGAGAGAGAAGAAGGAAGG + Intergenic
1032305109 7:130725771-130725793 AGAGAGAGAAAGAGGGAGGAAGG - Intergenic
1032319851 7:130875972-130875994 AGAAAGAGCAAGAGAGAGGAAGG + Intergenic
1032362082 7:131265410-131265432 AGAAAGAGGCCGAAGGAGCAAGG - Intronic
1032526764 7:132583708-132583730 AAATAGGGCCAGAAGGAGAATGG - Intronic
1032528107 7:132595282-132595304 AAACAGAGAAAGAAGGAGCATGG + Intronic
1032631833 7:133661590-133661612 ATACAGAGACAAAAGGAGGGGGG - Intronic
1032734844 7:134682576-134682598 AGACAGAGCCAGAGTTAGTAGGG - Intergenic
1032915293 7:136482866-136482888 AGAAAGATCCTCAAGGAGGAAGG - Intergenic
1033586876 7:142780646-142780668 AGACAGAGGCAGGAGGCGCATGG - Intergenic
1033983180 7:147191219-147191241 AGACATAGCTAGAAGGTGGTGGG + Intronic
1034020824 7:147640767-147640789 ATACAGAGACAGAGAGAGGAAGG + Intronic
1034184111 7:149161143-149161165 AGCCAGAGCAAAGAGGAGGAGGG - Intronic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035638617 8:1165163-1165185 AGACAGAGAGAGAGGGAGGGTGG + Intergenic
1035677729 8:1467149-1467171 AGATCCAGCCAGAGGGAGGAGGG + Intergenic
1036098848 8:5755525-5755547 AGGCAGAGTTAGAAGGAGGCAGG + Intergenic
1036121324 8:6020790-6020812 AGACAGAGACAGGAGGATGAGGG - Intergenic
1036212077 8:6850408-6850430 AGCCAGGGCCAGAAGAGGGATGG + Intergenic
1036293750 8:7518212-7518234 GGGCAAAGCCAGGAGGAGGAAGG + Intergenic
1036328811 8:7802783-7802805 GGGCAAAGCCAGGAGGAGGAAGG - Intergenic
1036422173 8:8607394-8607416 GGAGAGAGACAGTAGGAGGATGG - Intergenic
1036443438 8:8801363-8801385 AAACAGAGCACGAAGGTGGAAGG + Intronic
1037064860 8:14565720-14565742 AAACATATCCAGAAAGAGGAGGG + Intronic
1037280760 8:17239356-17239378 AGAGAGTGCCATAAGAAGGAAGG - Intronic
1037410873 8:18595459-18595481 AGACAGAGACAGACGGAGGGAGG + Intronic
1037648040 8:20811578-20811600 AGGCAGAGACAGATGGAGGGTGG + Intergenic
1037927547 8:22855938-22855960 AGGCTGAGGCAGGAGGAGGATGG + Intronic
1038350824 8:26774815-26774837 AGAAAGAGAGAGCAGGAGGAGGG - Intronic
1038364573 8:26918150-26918172 AGCAAGAGCAAGATGGAGGAAGG + Intergenic
1038384631 8:27130741-27130763 AGATAGAGAGAGAAGGAGAAAGG + Intergenic
1038448423 8:27620789-27620811 AGGGAGAGCCAGAGGGAGGGAGG - Intergenic
1038537957 8:28368112-28368134 TGACAGTTCCAGAAGGAGGTGGG + Intronic
1039221680 8:35338751-35338773 AGACTGAGGCAGAAGGCAGAAGG - Intronic
1039226504 8:35393979-35394001 AGAAAGAGGAAGAAGGATGAAGG - Intronic
1039583779 8:38688199-38688221 AGAAAGAGAAAGAAGAAGGAAGG + Intergenic
1039791276 8:40877712-40877734 AGACAGAGAGAGACGGAGTAGGG + Intronic
1040079432 8:43272342-43272364 AGAAAGAGTGAGAAGAAGGAGGG + Intergenic
1040601610 8:48890369-48890391 AGACAGAGCCAGGAGCAGAGGGG + Intergenic
1040817701 8:51526566-51526588 ATACAGAGGCAGGAGGAGGTTGG - Intronic
1041111153 8:54483904-54483926 TGACAGAGCAAGAAAAAGGAAGG - Intergenic
1041182841 8:55266348-55266370 AGACAGAGACAGCTGGAGGATGG - Intronic
1041278889 8:56191346-56191368 AGACAAAGTCAGCAGGAGCAAGG + Intronic
1041392993 8:57363829-57363851 AGACAGAGCCAGATTGAGCCAGG - Intergenic
1041510186 8:58647642-58647664 AGACAGAGCAAGAGAGAGAAAGG - Intronic
1042171936 8:66000088-66000110 AGACACAGACAGAGGGAGGGAGG - Intergenic
1042349570 8:67763400-67763422 AGACAGAGACAGAGAAAGGAAGG - Intergenic
1042460914 8:69067296-69067318 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
1042492068 8:69410797-69410819 AGAGAGAGAGAGAAAGAGGAAGG + Intergenic
1042497567 8:69472006-69472028 AGAGAGAGAGAGAAGGAGGGAGG + Intronic
1042592814 8:70414265-70414287 AGGCAGAGGCAGAAAGAGAAGGG - Intergenic
1042742451 8:72065974-72065996 AGAGAGAGAAAGAAGGAGGGAGG + Intronic
1043318240 8:78948071-78948093 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1044152361 8:88797285-88797307 AGACAGAGTCAGAGAGAGAAAGG + Intergenic
1044516365 8:93143320-93143342 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1044542138 8:93419929-93419951 AGACAGAGACAGAGAGAGGAAGG - Intergenic
1044611366 8:94095494-94095516 AGGCAGAGCCAGCATGAGAATGG + Intergenic
1044624753 8:94226241-94226263 AGACAGAGACAGAGGGAAGGAGG - Intergenic
1045062989 8:98424661-98424683 AGACAGGAACAGAAGGAGGCGGG + Intronic
1045133659 8:99187996-99188018 AGACAGAGACAGACAGAGGCAGG + Intronic
1045322547 8:101092740-101092762 AGAGAGAGAAAGAAGAAGGAAGG - Intergenic
1045361959 8:101441159-101441181 AGAGAGGGACAGAAGGAGGGAGG - Intergenic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045844675 8:106619912-106619934 ATACAGAGGCAGAAGCAGCAAGG - Intronic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1046813440 8:118557243-118557265 AGACAGAGCAAGCAAGAGCAGGG - Intronic
1046834098 8:118780078-118780100 AGACACAGAGAGAAGGAGGGAGG - Intergenic
1047304997 8:123645518-123645540 AGACAGAGACAGATGGAGGTGGG + Exonic
1047305505 8:123649834-123649856 AGACAGAGCAAAGAGGAGAAGGG - Intronic
1047505923 8:125480124-125480146 AGACAGAGACAGAGAGAGGTGGG - Intergenic
1047527734 8:125648009-125648031 AGGCAGAGCCCAAAGGAGCATGG - Intergenic
1047751347 8:127883114-127883136 AGACAGAGAGAGAGAGAGGAAGG + Intergenic
1048176050 8:132153804-132153826 ACTCAGAGATAGAAGGAGGAAGG + Intronic
1048184657 8:132228810-132228832 AGATAGAGCCAGGAAGATGAAGG + Intronic
1048253167 8:132884055-132884077 AGACAGACACAGAGGGAAGATGG - Intronic
1048260107 8:132938040-132938062 AGACAGAGCCAGGAAGAGGGAGG - Intronic
1048348287 8:133595134-133595156 AGAGAGAGAGAGAAGGAGGTAGG + Intergenic
1048348982 8:133600465-133600487 AGACAGGGAGAAAAGGAGGAGGG + Intergenic
1048383905 8:133893251-133893273 AAACAGAGAGAGAAGGAGGGAGG + Intergenic
1048709666 8:137195211-137195233 AGACAGAGCGGGAAGGAGGGAGG + Intergenic
1049091982 8:140522687-140522709 AGACAGAGACAGAGAGAGGGAGG + Intergenic
1049249659 8:141581559-141581581 AGAGAGAGACAGAAAGAGGCGGG + Intergenic
1049518412 8:143074293-143074315 AGACAGAGACAGAGAGAAGAGGG - Intergenic
1049675994 8:143889444-143889466 AGACGGAGCCAGAAAGAAAATGG - Intergenic
1049850866 8:144829415-144829437 AGGCAGCGCCAGAAGGGGGCTGG + Intronic
1050154637 9:2653022-2653044 AGAGAGAGCCATTAGGATGATGG + Intronic
1050475925 9:6041031-6041053 AGAAAGAGGAAGGAGGAGGAAGG - Intergenic
1050858688 9:10395994-10396016 AGCGAGAGACAGAAGGAGAAAGG + Intronic
1051326902 9:15981760-15981782 AGACGGAGCCAGAAAAAGGTGGG - Intronic
1051428605 9:16959871-16959893 AAACAGAGGGAGAAGCAGGAGGG - Intergenic
1052295761 9:26894753-26894775 ATACAGAACCAGAGGGAAGAGGG - Intergenic
1052333649 9:27297561-27297583 AGAGATAGTGAGAAGGAGGATGG + Intergenic
1052370142 9:27655144-27655166 TGAGAGAGCCAGAAGGGAGATGG - Intergenic
1052412893 9:28145665-28145687 AGAGAGAGGGAGAAGGAGGGAGG - Intronic
1052441493 9:28501960-28501982 AGAGAGAGAAAGTAGGAGGAAGG + Intronic
1052748939 9:32469090-32469112 TGACAGAGCCATAACAAGGAAGG + Intronic
1053177744 9:35940947-35940969 AGAAAGAGTGACAAGGAGGAAGG - Intergenic
1053580422 9:39398417-39398439 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1053844922 9:42226497-42226519 ACACAGAGAGAGAGGGAGGAAGG - Intergenic
1054102009 9:60957222-60957244 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1054584346 9:66949637-66949659 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
1054720221 9:68596259-68596281 AGACAGAGCCAGAAAATGGATGG - Intergenic
1054788130 9:69229279-69229301 AGACAGAGCTGTAAGGAAGAAGG - Intronic
1054884998 9:70186823-70186845 AGACAGAGCAAGAGGGAGGCAGG + Intronic
1054984897 9:71250703-71250725 AGAAAGAGCCAGCAGTAAGAAGG + Intronic
1055062293 9:72082337-72082359 TGCCAGAGCCATAAGGAGCAGGG - Intergenic
1055071856 9:72174804-72174826 AGACAGAGACAGAGTGGGGATGG + Intronic
1056225728 9:84493369-84493391 AGACAGAGGCCAGAGGAGGATGG + Intergenic
1056326001 9:85479512-85479534 GGACAGTGGCTGAAGGAGGAAGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056422501 9:86442979-86443001 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1056427612 9:86492772-86492794 AGCAAGAGCCAGAGGGAGTAGGG - Intergenic
1056499895 9:87198406-87198428 TGACAGAGCCAGAATTATGAAGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056605025 9:88078432-88078454 ACACATGGCGAGAAGGAGGAAGG + Intergenic
1056622167 9:88223639-88223661 AGACAGAGACAGAGACAGGAAGG + Intergenic
1056798970 9:89678214-89678236 TGACAGAGACAAAAGGAGGGAGG + Intergenic
1056933883 9:90900785-90900807 AGACAGAGCATGGAGCAGGAGGG - Intergenic
1057081296 9:92176462-92176484 TGACAGAAGCAGATGGAGGAGGG - Intergenic
1057115977 9:92522536-92522558 AGAGAGAGACAGAAAGAGGGAGG - Intronic
1057177492 9:93010632-93010654 ACACAGAGACAGAGGAAGGAGGG + Intronic
1057177505 9:93010701-93010723 ACACAGAGACAGAGGAAGGAGGG + Intronic
1057226066 9:93293821-93293843 AGAGAGAGAGAGAAGGAGAAAGG - Intronic
1057260636 9:93581133-93581155 AGACAGGGCCCTGAGGAGGAGGG - Intronic
1057398447 9:94701255-94701277 ATACAGGGCCAGGTGGAGGATGG - Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057933282 9:99214602-99214624 AGACAAGCCCAGAAAGAGGAAGG - Intergenic
1057997917 9:99836637-99836659 AGACAGATCTAGAGAGAGGAGGG + Intronic
1058164087 9:101601236-101601258 AGACAGAACCAGATGAAGCAGGG + Intronic
1058464843 9:105216842-105216864 AGACAGAGACAGAGAGAGAAGGG + Intergenic
1058466717 9:105236282-105236304 AGACAGAGCAAGAAAAAGAAGGG + Intergenic
1058482529 9:105411387-105411409 AGACAGAGCAAGAGAGAGGGAGG - Intronic
1058735146 9:107887284-107887306 AGACAGGGCAATAGGGAGGAAGG - Intergenic
1058877694 9:109258782-109258804 AGGCAGAGCGAGAGGGAGGCAGG + Intronic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059098023 9:111439891-111439913 AGACACAGCAAGGAGAAGGAAGG + Intronic
1059308938 9:113375423-113375445 AGACTGAGCCAGAAAGGGGCAGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059419801 9:114183773-114183795 AGACAGAGCCAGGGGGAGGCTGG + Intronic
1059507668 9:114814403-114814425 GGACAGAGATAGAAAGAGGAAGG + Intergenic
1059508424 9:114820689-114820711 AGACAGAGCCAGAATGAGAGGGG - Intergenic
1059521811 9:114949806-114949828 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
1059580732 9:115545804-115545826 AGACTCAGTCAGAAGGGGGAAGG + Intergenic
1059580915 9:115547330-115547352 AGACTCAGTCAGAAGGGGGAAGG + Intergenic
1059645543 9:116263159-116263181 ACACACAGCTAGAAGAAGGAAGG + Intronic
1059665887 9:116446234-116446256 AGACAGAGACAGAGGGGAGAGGG + Intronic
1059835373 9:118146283-118146305 AGAAAGAGAGAGAGGGAGGAAGG - Intergenic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060023314 9:120150609-120150631 TGCCAGAGCCAGATGGAGGGAGG - Intergenic
1060219783 9:121758282-121758304 AGACAGAGAGGGAAGGAGAAGGG + Intronic
1060518783 9:124282324-124282346 AGACAGACGCACAAGGAAGAAGG - Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060860810 9:126953413-126953435 TGAGAGAGGCAGAAGGAGGGTGG + Intronic
1060906206 9:127308297-127308319 AGACAAACCCAAAATGAGGAGGG + Intronic
1061116927 9:128619545-128619567 AGACAGACTCAGAGGGAAGATGG - Intronic
1061191316 9:129084343-129084365 TCACACAGCCAGAAGGAGGTGGG - Intronic
1061205547 9:129161032-129161054 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
1061221815 9:129256502-129256524 AGAGAGAGAGAGAAGGAGGGAGG - Intergenic
1061294087 9:129667574-129667596 AGACAGAGGAAGAGGAAGGAAGG + Intronic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061478729 9:130885877-130885899 AGACGGAGCGGGGAGGAGGAAGG - Intronic
1061643963 9:131984058-131984080 AGACAGAGCAACACAGAGGATGG - Intronic
1061861413 9:133470404-133470426 AGCCAGAGACAGCAGGAGAAGGG + Exonic
1061892243 9:133629059-133629081 AGACAAAGGCAGAAAGAGGCAGG - Intergenic
1061999477 9:134208672-134208694 TGGCAGAGCCAGATGGAGAATGG - Intergenic
1062053663 9:134459738-134459760 CCACAGAGCCAGCAGGAGGGAGG - Intergenic
1062128500 9:134879921-134879943 AGACAGAGACAGTAGCAGGTGGG - Intergenic
1062185757 9:135217646-135217668 AGACAGAGGTAGAAGGAGGAGGG - Intergenic
1062543723 9:137052754-137052776 AGACAGAGGAGGAAGGAAGAGGG - Intronic
1062638413 9:137503598-137503620 AGAAGGAGGAAGAAGGAGGAGGG + Intronic
1062722953 9:138053832-138053854 AAACACAGCCTGCAGGAGGAGGG - Exonic
1203747426 Un_GL000218v1:48801-48823 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1203474095 Un_GL000220v1:135574-135596 AGACAGAGAGAGGGGGAGGAAGG - Intergenic
1203362513 Un_KI270442v1:230225-230247 AGACAGAGAGAGGAGGAGGAAGG + Intergenic
1185485800 X:481357-481379 AGAGAGAGAGAGAAGGAGGGAGG + Intergenic
1185526632 X:785360-785382 AGAAAGAGAAAGAAAGAGGAAGG - Intergenic
1185562542 X:1070772-1070794 AGAAAGAGAGAGATGGAGGAAGG + Intergenic
1185966819 X:4614907-4614929 AGACAGAGACAGAGAGAGGAGGG + Intergenic
1185966842 X:4615088-4615110 AGAAAGAGACAGAGAGAGGAGGG + Intergenic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1186045568 X:5532885-5532907 GGACAGAGGAAGAAGGAGGGAGG + Intergenic
1186053601 X:5626462-5626484 AGACAGAGAGAAAAGAAGGAAGG + Intergenic
1186110060 X:6246291-6246313 AGAGAGAGAAAGAGGGAGGAAGG - Intergenic
1186505886 X:10091787-10091809 AGTCAGGGGCAGTAGGAGGATGG - Intronic
1186544149 X:10431636-10431658 AGGCAGAGAGAGAAAGAGGAGGG - Intergenic
1186645027 X:11497550-11497572 AGAGAGAGAGAGAAGGAGGGAGG - Intronic
1186699193 X:12071176-12071198 TGACGAAGCCAGGAGGAGGAAGG - Intergenic
1186926021 X:14334459-14334481 ACACAAGGCCAGAAGGAGGGAGG - Intergenic
1186980611 X:14954182-14954204 TGGCAGAGCCATAAGGTGGAAGG + Intergenic
1187169410 X:16836601-16836623 AGCCACAGCCAGCAGGGGGACGG - Intronic
1187283534 X:17881315-17881337 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1187737015 X:22315035-22315057 AGACAGAGGAGGAAGAAGGAGGG - Intergenic
1187843369 X:23511141-23511163 ACACAGACACAGAAGGAAGAAGG - Intergenic
1187885291 X:23883498-23883520 AAACGGAGCCAGAAGGGGTATGG - Intronic
1188382124 X:29507422-29507444 AAACAGAGCAAGATGAAGGAAGG - Intronic
1188606865 X:32041996-32042018 AGAGAGAGAGAGAGGGAGGAAGG - Intronic
1188728644 X:33617335-33617357 AGACATAGAGAGAAGAAGGATGG + Intergenic
1189074767 X:37904535-37904557 AGCCAGAGACAGGGGGAGGAAGG + Intronic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189240022 X:39517654-39517676 AGGCTAAGCCAGGAGGAGGACGG - Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1189756628 X:44278530-44278552 AGAAAAAGGCAGAAGCAGGAAGG + Intronic
1189834334 X:45005200-45005222 AGTCAGAGTTATAAGGAGGAGGG + Intronic
1189846237 X:45141454-45141476 AGGGAGAGCGAGATGGAGGAGGG + Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190214717 X:48472410-48472432 AGACAGAGGCTGGAGGAGGTTGG - Intergenic
1190357157 X:49616662-49616684 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1190359820 X:49638260-49638282 AGAGAGAGAGAGAAAGAGGAAGG - Intergenic
1190463154 X:50698910-50698932 AGCCAGAGTTAGGAGGAGGAAGG - Intronic
1190538813 X:51456616-51456638 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1191936197 X:66429621-66429643 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192215454 X:69154929-69154951 AGACAGAGAAAGAGGGAGGGAGG - Intergenic
1192777522 X:74260347-74260369 ATACAGAGGCAGAGGGAGGGGGG - Intergenic
1193207309 X:78764484-78764506 AGAGAAAGCAAGAAGGGGGAGGG - Intergenic
1194663171 X:96648391-96648413 TGACAGTGCCAGATAGAGGAGGG - Intergenic
1194975593 X:100393433-100393455 AGAGAGAGAAAGAAGCAGGAGGG - Intronic
1195121333 X:101755981-101756003 AGAAAGAGAGAGAAAGAGGAAGG - Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195385644 X:104311531-104311553 AGAGAGAGACAGAAAGACGAAGG - Intergenic
1195990289 X:110675734-110675756 AGAGAGAGAGAGAAGGAGGGAGG + Intronic
1196315158 X:114213664-114213686 AGCAAGAGAGAGAAGGAGGAAGG + Intergenic
1196332498 X:114488886-114488908 AGACATAGAGAGAAGAAGGATGG - Intergenic
1196536214 X:116847814-116847836 AGACAGAGAGAGAGAGAGGAGGG - Intergenic
1196715653 X:118808455-118808477 AGACAGAGGAACAAGGAGGATGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197230557 X:123999435-123999457 AGACAGGGAGAGAAGGGGGAGGG - Intronic
1197689787 X:129485782-129485804 AGACAGTACCAGAGAGAGGAGGG - Intronic
1197773142 X:130102917-130102939 AGAAAGAGAGAGAAGGAGGGAGG + Intronic
1198060523 X:133041817-133041839 GGACAGAGCACGTAGGAGGAAGG - Intronic
1198130035 X:133684591-133684613 ATACAGAGCCAAGAGGAAGAGGG - Intronic
1198183549 X:134233147-134233169 AGACACACACAGAAGGAGGATGG + Intergenic
1198474582 X:136983299-136983321 AGCCAGATCAAGAAGGAGGTGGG - Intergenic
1198481912 X:137049326-137049348 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1198786421 X:140293242-140293264 AGAAAGTGACAGAAGCAGGAAGG - Intergenic
1198801160 X:140449070-140449092 AGAAAGAGCCTGAGGGGGGAGGG - Intergenic
1198932121 X:141872698-141872720 AGACGGAGGAAGAAGGAAGAGGG + Intronic
1199018648 X:142848787-142848809 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1199161293 X:144615048-144615070 AGAAGGAGCAAGAAAGAGGAGGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199665825 X:150095662-150095684 TGTCAGAGTCAGGAGGAGGATGG - Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199861770 X:151807417-151807439 AGCCTGAGCAAGAAAGAGGATGG + Intergenic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1200878072 Y:8180528-8180550 AGAGAGAGAGAGAGGGAGGATGG + Intergenic
1201075723 Y:10185982-10186004 AGACAGAGAGAGGAGGAGGAAGG - Intergenic
1201240711 Y:11954611-11954633 AGAGAGAGACAGAGGGATGAGGG - Intergenic
1201528139 Y:14959521-14959543 AGAAAGAGACAGAAAGAGAAAGG + Intergenic
1201696176 Y:16828993-16829015 AGAAAGAGAGAGAAGGAGGGAGG + Intergenic
1201741758 Y:17331835-17331857 AGAGACAGCAAGAAGGAGGGGGG - Intergenic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic
1202193523 Y:22270926-22270948 AGAAAGAGAAAGAAAGAGGAAGG + Intergenic
1202302929 Y:23436903-23436925 ATACAGAGTAAGAAGAAGGACGG + Intergenic
1202567882 Y:26233691-26233713 ATACAGAGTAAGAAGAAGGACGG - Intergenic