ID: 905175587

View in Genome Browser
Species Human (GRCh38)
Location 1:36133561-36133583
Sequence CCTCATCTGCAGATAGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905175584_905175587 8 Left 905175584 1:36133530-36133552 CCACGGTGTTACTAGCTGTGCTC No data
Right 905175587 1:36133561-36133583 CCTCATCTGCAGATAGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905175587 Original CRISPR CCTCATCTGCAGATAGTAGT AGG Intergenic
No off target data available for this crispr