ID: 905179691

View in Genome Browser
Species Human (GRCh38)
Location 1:36157856-36157878
Sequence GTTTCAGGAGGCTTGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 79, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905179687_905179691 -8 Left 905179687 1:36157841-36157863 CCATCAGACTGGTGGGTTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 143
Right 905179691 1:36157856-36157878 GTTTCAGGAGGCTTGTAGGCTGG 0: 1
1: 0
2: 0
3: 79
4: 134
905179682_905179691 18 Left 905179682 1:36157815-36157837 CCTGGGAGAACAGGGAGGGGAGG 0: 1
1: 0
2: 8
3: 107
4: 721
Right 905179691 1:36157856-36157878 GTTTCAGGAGGCTTGTAGGCTGG 0: 1
1: 0
2: 0
3: 79
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905179691 Original CRISPR GTTTCAGGAGGCTTGTAGGC TGG Intronic
900737778 1:4310016-4310038 GGTTCAGGATGCTTGCTGGCTGG + Intergenic
902459745 1:16565047-16565069 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
903152928 1:21425648-21425670 ATTTCAGGAGGCCTGAAGGATGG + Intergenic
903160203 1:21482333-21482355 ATTTCAGGAGGCCTGAAGGATGG - Intronic
905179691 1:36157856-36157878 GTTTCAGGAGGCTTGTAGGCTGG + Intronic
909283197 1:73783835-73783857 GTTTCAGGAGGTATGTAGAAAGG - Intergenic
909478003 1:76104106-76104128 GTATCTGGAGGCTTGTGGGTGGG + Intronic
909637306 1:77830918-77830940 TTTTCAGGTTGCTTGTAGTCTGG + Intronic
913605848 1:120465112-120465134 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
913643265 1:120832724-120832746 ATTTCAGGAGGCCTGAAGGCTGG - Intronic
913643566 1:120835366-120835388 ATTTCAGGAGGCCTGAAGGCTGG - Intronic
913644032 1:120839481-120839503 ATTTCAGGAGGCCTGAAGGCTGG - Intronic
914082707 1:144424104-144424126 ATTTCAGGAGGTCTGAAGGCTGG + Intronic
914178157 1:145297376-145297398 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914178702 1:145302138-145302160 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914179080 1:145305307-145305329 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914179456 1:145308490-145308512 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914180000 1:145313246-145313268 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914180545 1:145318018-145318040 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914181088 1:145322780-145322802 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914181631 1:145327528-145327550 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914182176 1:145332295-145332317 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914182721 1:145337051-145337073 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914183266 1:145341801-145341823 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914183810 1:145346559-145346581 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914184354 1:145351331-145351353 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914184898 1:145356093-145356115 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914185443 1:145360840-145360862 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914185989 1:145365594-145365616 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914186535 1:145370354-145370376 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914187079 1:145375102-145375124 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914187622 1:145379854-145379876 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914188167 1:145384608-145384630 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914188710 1:145389358-145389380 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914269509 1:146067417-146067439 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914269864 1:146070561-146070583 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914270404 1:146075283-146075305 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914270941 1:146080019-146080041 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914271479 1:146084755-146084777 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914272014 1:146089476-146089498 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914272550 1:146094194-146094216 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914273088 1:146098916-146098938 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914273627 1:146103638-146103660 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914274165 1:146108356-146108378 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914274703 1:146113066-146113088 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914275236 1:146117784-146117806 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914275773 1:146122520-146122542 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914367054 1:146988690-146988712 ATTTCAGGAGGCCTGAAGGCTGG - Intronic
914367590 1:146993448-146993470 ATTTCAGGAGGCCTGAAGGCTGG - Intronic
914485393 1:148104774-148104796 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914532342 1:148534098-148534120 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914532702 1:148537248-148537270 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914533237 1:148541968-148541990 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914533772 1:148546682-148546704 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914534308 1:148551390-148551412 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914534844 1:148556104-148556126 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914535379 1:148560821-148560843 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914535916 1:148565557-148565579 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914536451 1:148570279-148570301 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914536810 1:148573467-148573489 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914585356 1:149056749-149056771 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914585719 1:149059937-149059959 ATTTCAGGAGGCCTGAAGGCTGG + Intronic
914629109 1:149491875-149491897 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914629642 1:149496638-149496660 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914630177 1:149501393-149501415 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914630711 1:149506154-149506176 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914631242 1:149510915-149510937 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914631774 1:149515671-149515693 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914632311 1:149520424-149520446 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914632846 1:149525181-149525203 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914633381 1:149529910-149529932 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914633917 1:149534661-149534683 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914634452 1:149539412-149539434 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914634985 1:149544149-149544171 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914635520 1:149548886-149548908 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
914636055 1:149553623-149553645 ATTTCAGGAGGCCTGAAGGCTGG - Intergenic
915574005 1:156763160-156763182 GTTTCAGTAGGGTTTTAGGAGGG + Intronic
915729336 1:158042103-158042125 GTCACAGGAGGCTTGGAGGGAGG + Intronic
917785246 1:178448346-178448368 GTTTCAGGAGGAAAGGAGGCAGG + Intronic
918269664 1:182885752-182885774 GTTTCAGGAGCCATGTTGCCTGG - Intronic
920182791 1:204142912-204142934 GTATCTGGAGGCTTGGAGGGAGG - Intronic
924390611 1:243551269-243551291 TTTTCAGGAGCCTTGTTGGGTGG - Intronic
1063871786 10:10424994-10425016 GTTGCAAGAGGCTTGCAAGCAGG - Intergenic
1066962702 10:42235834-42235856 GTTGTAGGAGCCTTGTAGGGAGG - Intergenic
1072357472 10:94625263-94625285 GTGTCAGAAGGCTTGCAGTCTGG + Intergenic
1074151586 10:110764143-110764165 GTTTCAGGAGCTTTGCTGGCTGG + Intronic
1075833627 10:125433194-125433216 CTTTCAAGAAACTTGTAGGCTGG - Intergenic
1076614282 10:131745879-131745901 GTACCAGGAGGCTTGAAGGAGGG + Intergenic
1081871335 11:46383913-46383935 GTTTCAGGGGGCTTGGTGGTGGG + Intergenic
1086487114 11:87318040-87318062 GATTCAGAAAGGTTGTAGGCAGG + Intronic
1086958392 11:92957632-92957654 GTTTCAGGAGGCCGGTGAGCTGG + Intergenic
1089199561 11:116715605-116715627 GAATCAGGAGGCCTGCAGGCAGG + Intergenic
1090661149 11:128882498-128882520 GTTTCAGAAGGCTGGTGGTCAGG + Intergenic
1091318278 11:134631599-134631621 GTGTCAGGAGGCTTGATGCCTGG + Intergenic
1095637953 12:44454242-44454264 GTTTCAGCGGGCTAGTAGGTGGG - Intergenic
1098573921 12:72019350-72019372 GTTGCTGGAGGGTTTTAGGCAGG - Intronic
1098962938 12:76757875-76757897 GGGTCAGGAGGATTGTAGTCTGG - Intergenic
1099294255 12:80810187-80810209 GTTTCCAGAGGCTGGGAGGCTGG - Intronic
1101499091 12:105284674-105284696 GGTTCAGGATGCTGGGAGGCTGG + Intronic
1102953064 12:117042714-117042736 GTTTTTGGAGGCTTGTCGGTGGG - Intronic
1103949938 12:124545135-124545157 GTCTCAGTAGGGTTGCAGGCTGG - Intronic
1105274497 13:18906690-18906712 GTGGTAGGAGGCTTGTAGGGTGG + Intergenic
1106054988 13:26229281-26229303 GTTTCAAGGGTCTTGGAGGCAGG + Intergenic
1106846773 13:33745214-33745236 GCTTCAGGAGGATTCCAGGCAGG + Intergenic
1109624948 13:64962528-64962550 GTGTGTGGAGGCTTGTAGCCAGG + Intergenic
1111064419 13:83072208-83072230 GATTTAGCAGGCTTGTTGGCAGG - Intergenic
1111542445 13:89686947-89686969 GTTTCAGGATACTTGAACGCGGG - Intergenic
1111928932 13:94493721-94493743 GTTGCCAGAGGCTTGTAGGGAGG + Intergenic
1114953259 14:27783768-27783790 CTTTCAGAAGGCTTGTATTCAGG + Intergenic
1126733356 15:51707380-51707402 ATCTCTGGAGGCTTGAAGGCAGG - Intronic
1127875047 15:63104818-63104840 GGTTCTGGAGGCTTGAAGTCTGG - Intergenic
1129135841 15:73550117-73550139 GTTTCGGGAGGCTTTTATGTAGG + Intronic
1130700569 15:86176352-86176374 CTTTCAGCAGGCTTGGAGTCTGG - Intronic
1131980737 15:97992173-97992195 GATTCAGGAAGCTGGGAGGCTGG + Intergenic
1132762622 16:1518161-1518183 GTTTCAGGAGCCTTGTGTGGCGG + Intronic
1135955093 16:26949703-26949725 CTTTCATGAAGCTTGCAGGCTGG - Intergenic
1136949153 16:34694011-34694033 GTCTCAAGAAGCTTGCAGGCAGG - Intergenic
1138068378 16:53965592-53965614 GGTTCAGGAGGCACTTAGGCAGG - Intronic
1139201267 16:64980045-64980067 GTTACAGGAGGCTGGGAAGCAGG + Intronic
1141468698 16:84223857-84223879 GTTTCTGATGGCTTGAAGGCTGG + Intronic
1144078029 17:11736484-11736506 CTTTCAGGATGCTTGGAGGCAGG - Intronic
1148496336 17:48055326-48055348 GTTTCTTCAGGCTTGTAGGGAGG + Intronic
1152842396 17:82578619-82578641 TTTTCTGGAGTCTTGTTGGCTGG + Intronic
1154175685 18:12086430-12086452 GTGGCAGGAGCCTTGTAGGGAGG + Intergenic
1154466183 18:14643939-14643961 GTGGTAGGAGGCTTGTAGGGTGG + Intergenic
1158438901 18:57455935-57455957 GTTTCAGCAGACTTGTGGCCAGG + Intronic
1158439037 18:57457327-57457349 GTTTCAGCAGACTTGTGGCCAGG - Intronic
1158795517 18:60841171-60841193 GTTTCTGGTGGCTTTTTGGCTGG - Intergenic
1159021483 18:63146499-63146521 GTTAAAGGAGGCTTGTAGAGCGG - Intronic
1160666858 19:334908-334930 GTTTCAGGAGTCATGGAGTCCGG - Intronic
1162336423 19:10063473-10063495 CTATTAGGAGGCTTGCAGGCTGG + Intergenic
1163813234 19:19447717-19447739 GCTGCAGGATGCTTGTAGGGAGG + Intronic
1164571617 19:29378832-29378854 GTTTGGGAAGGCTTGGAGGCTGG + Intergenic
1167603797 19:50469303-50469325 GTTTCAGGAGGCATGTTCTCAGG + Intronic
1202675989 1_KI270711v1_random:7231-7253 ATTTCAGGAGGCCTGAAGGCTGG + Intergenic
925695912 2:6578045-6578067 GTTTCAGGAGGTATGTGTGCTGG - Intergenic
925841075 2:7992952-7992974 GTTTCAGGATGCTGGTTTGCTGG - Intergenic
929962181 2:46505113-46505135 GTTGCAGGAGGCTTCTTAGCTGG + Intronic
932614064 2:73220765-73220787 GCTTCAGGAGGCATGGAGGTAGG + Exonic
934484063 2:94685660-94685682 CTTTCAGAAGGCTTGTATTCAGG - Intergenic
935595841 2:104876895-104876917 GGTTCAGGGGGCTTGAAGGAAGG + Intergenic
937293105 2:120793827-120793849 GTGTCAGGAGGCATTTTGGCTGG + Intronic
939153459 2:138498984-138499006 TTTTCAGTAGGCTTTTAGGCAGG + Intergenic
939153749 2:138501517-138501539 GTCTCAGTAGGCTTTTAGGCAGG + Intergenic
947679327 2:232015636-232015658 GTTTCAGAAGGCTTGAAGAGAGG + Exonic
1169106233 20:2997454-2997476 GTGTCAGGAGTCTTGTGGTCAGG + Intronic
1170451357 20:16487407-16487429 TGCTCAGCAGGCTTGTAGGCGGG - Intronic
1172448986 20:35008555-35008577 GCTTCAGGAGGCATGGACGCTGG + Intronic
1173608165 20:44346777-44346799 TTTCCAAGAGGCTTGTATGCAGG - Intronic
1174310315 20:49648232-49648254 GTTTCAGGATGTTTATAGTCAGG - Intronic
1175286719 20:57841539-57841561 GTTGCTGGAGACTTGCAGGCTGG - Intergenic
1176808403 21:13514657-13514679 GTGGTAGGAGGCTTGTAGGGTGG - Intergenic
1178154739 21:29838571-29838593 GTTTCTGAAGTCTTGCAGGCAGG - Intronic
1181572175 22:23773506-23773528 GTTTTGGGAGGCTTGGAGCCAGG + Intronic
1182715222 22:32352766-32352788 GTGTTAGGAGCCTTGTAGGGTGG - Intergenic
1183316448 22:37139608-37139630 GTTACAGGAGGCATGCAAGCTGG + Intronic
1183770417 22:39920478-39920500 GCTGCAGGAGGCCTGGAGGCTGG - Intronic
1184795963 22:46732676-46732698 GTTTCAGGACGCTTCTGGGCTGG - Intronic
950768028 3:15288437-15288459 GTTTCAGGAGGCAGGAAGACCGG + Intronic
951115196 3:18853008-18853030 GTGTCAGGAAGCATGTAAGCAGG - Intergenic
953658839 3:44875632-44875654 GTTACAGAGGGCTTGTGGGCTGG - Intronic
954277230 3:49550475-49550497 GTTCAAGGAGCCTTGTAGGCAGG + Intergenic
954364653 3:50139512-50139534 GGGTCAGGTGGGTTGTAGGCAGG - Intergenic
956768105 3:72501684-72501706 GAGCCAGGAGGCTTGTAGGTGGG + Intergenic
959534440 3:107469513-107469535 GTTTCAGATGGCTTGGAGGAAGG + Intergenic
961338721 3:126202902-126202924 GTCTCAGGATGCCTGCAGGCTGG + Intergenic
961443711 3:126968248-126968270 CATTCAGGAGGCTTCTAGCCTGG - Intergenic
966885089 3:184373071-184373093 GTTTCCTGATGCTTGTAGGAGGG - Exonic
968395529 4:233230-233252 GTATCAAGAGGGTTGTATGCTGG + Intergenic
969091642 4:4698339-4698361 GCTTCCTGAGGCTTGGAGGCAGG - Intergenic
970960140 4:21861964-21861986 GTTTAAGGAGGCTTGGAGGAGGG - Intronic
972015362 4:34236515-34236537 GTTTCTGGAGGCTTGGGGGAGGG + Intergenic
974447872 4:62010075-62010097 GTTTCAAGAAGCTTCTAGGGTGG - Intronic
975846194 4:78527821-78527843 ATTTCAGGATGCTTGTATGCTGG + Intronic
976261610 4:83150605-83150627 GTTTCAGGAGGTTCGTGGTCCGG + Intergenic
976703261 4:87993927-87993949 GTTTCAGGAAGCTTCCAGGTTGG - Intergenic
977332510 4:95655297-95655319 GTTTCAGGAGACTTTTAGCAGGG + Intergenic
982988749 4:162244154-162244176 TATTCAGGAGACTTGTAGCCTGG - Intergenic
985561448 5:588442-588464 GTATCAGGAGGCTTGGCCGCTGG - Intergenic
987093264 5:14525943-14525965 GTTTCAGGAGGTTTACTGGCAGG - Intronic
988595039 5:32583412-32583434 GTTTCATCAGGTTTGCAGGCTGG + Intronic
988894667 5:35659012-35659034 TTTTCAGGAGGCTTATCGGGAGG + Exonic
991655981 5:68904159-68904181 GTTTCAGGTGGCTTTTATGTTGG + Intergenic
994256399 5:97601171-97601193 GTCTCAGTTGCCTTGTAGGCAGG + Intergenic
995243920 5:109916066-109916088 GTTTCAAGAGCATTGGAGGCCGG - Intergenic
998006322 5:138659387-138659409 GACTCAGGAGGCTTGTAGCTTGG - Intronic
998523956 5:142825578-142825600 ACTTCAGGTGGCTTGTGGGCAGG - Intronic
999467731 5:151823095-151823117 GTTTCTGGAGGCTTTTTGGCTGG + Intronic
1003245469 6:4378618-4378640 GTTTCTGGATGCTTGCAGGCAGG - Intergenic
1003886145 6:10523224-10523246 GTTTCACCATGCTGGTAGGCTGG - Intronic
1014304488 6:119723481-119723503 CTTTCAGGAGGGTTTTAGGAGGG + Intergenic
1024008303 7:45243602-45243624 GTGGCAGGAGGCTTGTCAGCTGG - Intergenic
1031130883 7:117832128-117832150 GTTTCAGGTGAGTTGTAGGATGG - Intronic
1035658174 8:1327117-1327139 GTGTCAGGAGGATGGAAGGCAGG - Intergenic
1039616907 8:38962544-38962566 ATTTCAGCAAGCTTGTAAGCAGG + Intronic
1042549263 8:69979935-69979957 TGTTCAGGAGGTTTGCAGGCAGG + Intergenic
1047093347 8:121597203-121597225 GTTTCTGGAGGCTGGTATCCAGG + Intergenic
1048765606 8:137841153-137841175 GTTTTAGGAGGCTTGAAGCATGG + Intergenic
1050708436 9:8431049-8431071 GTGTAAGGAGGCTTGTGAGCTGG - Intronic
1053673720 9:40398731-40398753 CTTTCAGAAGGCTTGTATTCAGG + Intergenic
1053923522 9:43025090-43025112 CTTTCAGAAGGCTTGTATTCAGG + Intergenic
1054384825 9:64538796-64538818 CTTTCAGAAGGCTTGTATTCAGG + Intergenic
1054510907 9:65977559-65977581 CTTTCAGAAGGCTTGTATTCAGG - Intergenic
1057116738 9:92530720-92530742 GATTCAGGAGGGTTGTATGCAGG + Intronic
1060244369 9:121931745-121931767 GTGTCAGGAGGCTAGTCTGCTGG - Intronic
1061402943 9:130378359-130378381 GGATGAGGAGGCTGGTAGGCTGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1185595957 X:1307129-1307151 GTTGCAGTAGGCTGGCAGGCTGG + Intronic
1186111037 X:6256294-6256316 GTTTCACCATGCTGGTAGGCTGG + Intergenic
1189289781 X:39876923-39876945 GTGCCAGGAGGCTTGGAGCCTGG - Intergenic
1190596685 X:52059314-52059336 GTCTCAGGAGGCTGGGAGGGCGG + Intergenic
1190612139 X:52194759-52194781 GTCTCAGGAGGCTGGGAGGGCGG - Intergenic
1196189278 X:112778051-112778073 GTTTCAGGAGCTATGTAAGCTGG - Exonic
1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG + Intronic