ID: 905183502

View in Genome Browser
Species Human (GRCh38)
Location 1:36180233-36180255
Sequence AAGGACTTCTGGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 391}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905183502_905183513 15 Left 905183502 1:36180233-36180255 CCTGTTTTTCCCCAGAAGTCCTT 0: 1
1: 0
2: 2
3: 45
4: 391
Right 905183513 1:36180271-36180293 TGGATCCGGGCACAGTTGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 89
905183502_905183510 1 Left 905183502 1:36180233-36180255 CCTGTTTTTCCCCAGAAGTCCTT 0: 1
1: 0
2: 2
3: 45
4: 391
Right 905183510 1:36180257-36180279 AAGAGGGTTTGCCTTGGATCCGG 0: 1
1: 0
2: 0
3: 15
4: 132
905183502_905183508 -5 Left 905183502 1:36180233-36180255 CCTGTTTTTCCCCAGAAGTCCTT 0: 1
1: 0
2: 2
3: 45
4: 391
Right 905183508 1:36180251-36180273 TCCTTTAAGAGGGTTTGCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 110
905183502_905183511 2 Left 905183502 1:36180233-36180255 CCTGTTTTTCCCCAGAAGTCCTT 0: 1
1: 0
2: 2
3: 45
4: 391
Right 905183511 1:36180258-36180280 AGAGGGTTTGCCTTGGATCCGGG 0: 1
1: 0
2: 1
3: 7
4: 143
905183502_905183514 16 Left 905183502 1:36180233-36180255 CCTGTTTTTCCCCAGAAGTCCTT 0: 1
1: 0
2: 2
3: 45
4: 391
Right 905183514 1:36180272-36180294 GGATCCGGGCACAGTTGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905183502 Original CRISPR AAGGACTTCTGGGGAAAAAC AGG (reversed) Exonic
902513472 1:16978307-16978329 GAGGACAGCTGGGGAAAGACCGG + Exonic
902577581 1:17388158-17388180 AAGGAATACTGGTGAATAACTGG + Intronic
903307031 1:22420202-22420224 AAGGAATTGTGGGGAAAAATTGG - Intergenic
903715146 1:25359810-25359832 ATGGGCTTTTGTGGAAAAACAGG - Intronic
904926597 1:34054165-34054187 AAGGACATTTGTGGAAAAACAGG - Intronic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905193365 1:36254229-36254251 AAGGACTTAGTTGGAAAAACTGG - Intronic
905840141 1:41169712-41169734 AATCCCTTCTGGGGAAAAACAGG + Intronic
905911011 1:41654637-41654659 AAGGACATTAGTGGAAAAACTGG - Intronic
905948892 1:41928550-41928572 AAGGACATCAGTGGAAAAACTGG - Intronic
906224698 1:44111971-44111993 AAGGACATTAGTGGAAAAACTGG - Intergenic
906371857 1:45260710-45260732 ATGGACTTTGGGGGGAAAACTGG + Intronic
906716466 1:47973341-47973363 ATGGACTACTGGGGAGAAAGGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908161157 1:61409846-61409868 AAGGGCTTCAAAGGAAAAACTGG - Intronic
908928651 1:69288959-69288981 AAGGACATTAGTGGAAAAACTGG - Intergenic
908998012 1:70182318-70182340 AAGGACATTAGTGGAAAAACTGG + Intronic
909554396 1:76937317-76937339 TAGGACTTATGGGGAAAATTGGG + Intronic
910080037 1:83330742-83330764 AAGGAAGTCTGGAGAAATACTGG - Intergenic
910354929 1:86342783-86342805 AAGGAATTGTGGGGAAAAAAAGG - Intergenic
910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG + Intronic
911344877 1:96684283-96684305 AAGGATATTTGTGGAAAAACTGG - Intergenic
911866773 1:103036609-103036631 AATGCCTTCTGGGAAAAAATAGG - Intronic
912965696 1:114235347-114235369 CAGGGCTTCTGGAGAAAAAGAGG - Intergenic
913001613 1:114586248-114586270 AGGGACTTCTGAGGCAAAAGAGG - Intronic
913596241 1:120380064-120380086 AAGAACTTCTGGGAAAAACACGG + Intergenic
914091033 1:144498911-144498933 AAGAACTTCTGGGAAAAACACGG - Intergenic
914307569 1:146435294-146435316 AAGAACTTCTGGGAAAAACACGG + Intergenic
914376992 1:147080457-147080479 AAGGACAGCTGGGGAGAAAGAGG - Intergenic
914587082 1:149072565-149072587 AAGGACTTCTTGGGTAAGAACGG - Intronic
914594539 1:149137844-149137866 AAGAACTTCTGGGAAAAACACGG - Intergenic
915355656 1:155254187-155254209 AAGGAGATCTGGGGAAAACAGGG + Exonic
915502693 1:156330244-156330266 ATGGACTTTTAGGGAAAACCTGG - Intronic
915699751 1:157780620-157780642 AAGAACTTCTGGGACAGAACTGG + Intergenic
916222287 1:162457054-162457076 TAAGACTTCTAGAGAAAAACAGG + Intergenic
916360332 1:163960905-163960927 AAGGCTTTCTGGAGAAAAATTGG - Intergenic
916369606 1:164075802-164075824 AGGGATATCTGGGGAAAACCTGG - Intergenic
917084129 1:171288760-171288782 AAGGACTGTTGGGGAAAATAAGG - Intergenic
917179720 1:172282980-172283002 AAGAAGTTCTGGAGTAAAACAGG - Intronic
917693755 1:177496170-177496192 AAGGCCTGCTGAGGAATAACAGG + Intergenic
917849363 1:179047316-179047338 TAAGTCTTCTGGGGAAGAACGGG - Intronic
917942554 1:179936653-179936675 AAGGACCTCTGAAGAAGAACAGG + Intergenic
918134265 1:181657503-181657525 AAAGACTTCTAATGAAAAACTGG - Intronic
920742033 1:208590114-208590136 AAGGACTTCTGGAAGAAAACAGG - Intergenic
920877461 1:209849863-209849885 TAGCCCTTCTGAGGAAAAACGGG - Intronic
921427936 1:215026358-215026380 TAGGATTTCTGGGGAAGACCAGG - Intronic
922191259 1:223320512-223320534 AAGGACATCTGGCTAAACACGGG + Intronic
922315882 1:224441401-224441423 AAGTTCTTCTGGGGAATAAAGGG + Intronic
922414744 1:225410831-225410853 AAGGACAACAGCGGAAAAACTGG + Intronic
923433217 1:233943932-233943954 AATGACTTTTGGGGAAAAAATGG + Intronic
924144781 1:241062677-241062699 AAAGACCTTTGGGGAAAAAAAGG - Intronic
924209226 1:241747782-241747804 AAAGACTTCCTGGGAAAGACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1064177503 10:13087600-13087622 ATGGAAGTCTGGGGAAAAACAGG + Intronic
1066453961 10:35556799-35556821 AACTACTTCTAGGGATAAACAGG - Intronic
1067199434 10:44154533-44154555 AGGGCCTGCTGGGGAAAGACTGG - Intergenic
1067354172 10:45509670-45509692 AAAGCCTTCTTTGGAAAAACTGG + Intronic
1067565523 10:47333514-47333536 AGTGACTTCTGGAGAAAAATTGG - Intergenic
1067957250 10:50805991-50806013 TAGGAGTTCTAGGGAAAAATAGG + Exonic
1068599268 10:58938228-58938250 AAGCACTGCTGGGGGAAAAGTGG - Intergenic
1069100649 10:64316512-64316534 AAGGACTTCTGAGTTGAAACAGG - Intergenic
1069446536 10:68477846-68477868 AAAGAGTTCAGGGGAAAGACTGG - Intergenic
1069585307 10:69596527-69596549 AAGGGGATCTGAGGAAAAACAGG - Intergenic
1070000575 10:72373662-72373684 CAGGACTTCTAGGGAAAAGGGGG + Intronic
1070287032 10:75091572-75091594 AAGGACATAAGTGGAAAAACTGG - Intergenic
1071113033 10:82184426-82184448 AATGGTTTCTGGGGAAACACTGG + Intronic
1071933090 10:90496105-90496127 AACTCCTTCTGGGGAAAAACAGG + Intergenic
1073168116 10:101476314-101476336 AAGGACATTAGTGGAAAAACTGG + Intronic
1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG + Intronic
1073605125 10:104887194-104887216 AAGGACTTCAGGATAAAAAATGG + Intronic
1074568224 10:114600851-114600873 ATGGCCAACTGGGGAAAAACAGG - Intronic
1075792746 10:125096851-125096873 AATGACTTCTAGATAAAAACAGG - Intronic
1076688023 10:132206886-132206908 AAGAACATTTGGGGAAGAACCGG - Intergenic
1076689401 10:132213746-132213768 AAGGGCTCCAGGGGAAAAGCAGG + Intronic
1077838046 11:5942049-5942071 AAGGTCCTCCTGGGAAAAACAGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077923912 11:6661815-6661837 AAGGACATTAGTGGAAAAACTGG - Intergenic
1078825046 11:14921687-14921709 AAGGACATTAGTGGAAAAACTGG + Intronic
1079933100 11:26589591-26589613 AGGGACTTTTGGGGGAAAATAGG - Intronic
1080240385 11:30120878-30120900 GAGAACATCTGGGGAAAAAGAGG - Intergenic
1080394502 11:31877304-31877326 CGGGACTTCTGGGGGTAAACTGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080846966 11:36035191-36035213 AAAGAGTTTTGGGGAAAAGCAGG - Intronic
1080867173 11:36205558-36205580 AAAGACTTTGGGGGAATAACAGG - Intronic
1082168693 11:48975436-48975458 GAGGGCTTTTGGGGATAAACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1084414719 11:69024946-69024968 AAGGAGCTCTGGGTAAAATCTGG + Intergenic
1085216454 11:74836942-74836964 AAGGGCTTCTGGGCCAAACCTGG + Exonic
1085860856 11:80233629-80233651 AATGACTTCTGGGTAAATAATGG + Intergenic
1086090658 11:83001495-83001517 ATGGACCTCTGGGTAAAAATTGG + Intronic
1087372732 11:97305333-97305355 AACAACTACTGGGGAAAAAATGG - Intergenic
1087884633 11:103464206-103464228 AAGAACTTCTGGAGAGAAACAGG + Intronic
1088101677 11:106162868-106162890 AAAGTCTTGTGGAGAAAAACTGG + Intergenic
1088262728 11:107959614-107959636 TAGGAATTCTGAGGAGAAACAGG + Intronic
1088318377 11:108530436-108530458 AAGCACTTCCTGGGACAAACAGG + Intronic
1088687467 11:112297197-112297219 AGGGTCTGCTGGGAAAAAACAGG - Intergenic
1088819468 11:113445233-113445255 AAGGACATTAGTGGAAAAACTGG + Intronic
1089082703 11:115790363-115790385 AGGGGCTTCTGGGGCAAAAAAGG - Intergenic
1091127664 11:133115912-133115934 AAGTATTTTAGGGGAAAAACGGG - Intronic
1091140727 11:133232172-133232194 AAGGACATCTGGGGAGCCACTGG - Intronic
1094103030 12:26783982-26784004 AAGGACTTTAGTGGAAAAGCTGG + Intronic
1094103034 12:26784037-26784059 AAGGACTTTAGTGGAAAAGCTGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095494546 12:42770941-42770963 AAGGACTCCTAGGAAAAGACTGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097818381 12:64100613-64100635 CAAGACTTATGGGGAAAAATAGG - Intronic
1098490160 12:71066261-71066283 AAGGACATTAGTGGAAAAACTGG + Intronic
1099854636 12:88148284-88148306 AAGCACTTCTGGACAAAAACTGG - Exonic
1100165710 12:91915280-91915302 AAGGTCATTTGGGGCAAAACTGG + Intergenic
1100959296 12:99944820-99944842 AGGGATTGCTAGGGAAAAACTGG + Intronic
1101292043 12:103380417-103380439 AAGCACTTCTTGGCAAAAGCAGG + Intronic
1101542035 12:105674095-105674117 AAGGACATCAATGGAAAAACTGG - Intergenic
1103593371 12:122007947-122007969 AAGGACATCAGTGGAAAAACTGG + Intergenic
1103763050 12:123265117-123265139 AAAGACTTTTGGGGAAAATGTGG - Intronic
1105440944 13:20415166-20415188 ACGGCCTTCTGGGCAAAGACAGG - Intronic
1105484412 13:20812644-20812666 GAGGACATTGGGGGAAAAACTGG + Intronic
1106414801 13:29537507-29537529 AAGGACACCTGGGGAAAATGAGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107360951 13:39617367-39617389 AAGGACATTAGGAGAAAAACTGG + Intergenic
1108457282 13:50629083-50629105 AAGGATTTGAGGGGAAAGACTGG + Intronic
1108744639 13:53379474-53379496 AAGGAATGCTGGGGAAGAAAAGG - Intergenic
1109647563 13:65279007-65279029 AAGGATTTGTGGGGGAAAATTGG - Intergenic
1110103771 13:71644212-71644234 AAGGATTTCTGCGTTAAAACAGG - Intronic
1110565899 13:76957279-76957301 AAGGACTTTTGGGGAATAGTTGG - Exonic
1110665656 13:78115252-78115274 AAAGCCTTCTGGGGAAGGACGGG - Intergenic
1111288866 13:86134758-86134780 AAGGATTTCTGTAGAAAAATTGG - Intergenic
1111335108 13:86810879-86810901 AAGCACATCTGGAGATAAACAGG - Intergenic
1112005504 13:95250247-95250269 AAGGGCTACTGGGGCAGAACTGG - Intronic
1112748654 13:102556425-102556447 AAGCAGTTATGGGGAAATACAGG - Intergenic
1116186953 14:41609525-41609547 AGGGAATTCAGGGGAAAAAAAGG - Intronic
1116671218 14:47845770-47845792 AAGGATCCCTGGGGAAAACCTGG - Intergenic
1117045060 14:51805284-51805306 AAGGACTTCAGGGAAATAAGAGG - Intergenic
1119047872 14:71336778-71336800 AAGAAATTCGAGGGAAAAACAGG - Intronic
1119527860 14:75336561-75336583 AAGGACATTAGTGGAAAAACTGG - Intergenic
1119856647 14:77906050-77906072 AAGGACCTCTGAGGATAAATGGG - Intronic
1120064673 14:80027165-80027187 AAGGCCTTCTGGAGAAAAGGTGG + Intergenic
1121000762 14:90450749-90450771 AAGGACATTGGTGGAAAAACTGG - Intergenic
1121349706 14:93163513-93163535 AAGACCTTCGGGTGAAAAACAGG + Intergenic
1121695037 14:95905276-95905298 AAGGACATTTGTGGGAAAACTGG - Intergenic
1121861437 14:97322367-97322389 AACGACATTTGGAGAAAAACTGG + Intergenic
1122742785 14:103881649-103881671 CAGGGCTGCTGGGGGAAAACGGG - Intergenic
1123872948 15:24594801-24594823 AAGGACTTCTGGGGACAGGCTGG - Intergenic
1127027899 15:54828349-54828371 AGGGACATCAGTGGAAAAACTGG + Intergenic
1127714871 15:61640285-61640307 AAGGTTTTCTGGGGATCAACTGG + Intergenic
1128825997 15:70717870-70717892 AAGGGCTTAAGGGCAAAAACAGG + Intronic
1130066174 15:80606731-80606753 AAGGAATTCCCAGGAAAAACTGG - Intergenic
1130806235 15:87326505-87326527 AGGGAATTCTGGGGGAAAAAAGG + Intergenic
1130976152 15:88776751-88776773 AAGGACTTCTGGGACAACACTGG + Intergenic
1131869257 15:96744837-96744859 AAGCTCATCTGTGGAAAAACTGG - Intergenic
1131957984 15:97758140-97758162 TAAGAGTTCTAGGGAAAAACCGG - Intergenic
1132014102 15:98300672-98300694 ACAGACTTCTGGGGAGAAGCAGG - Intergenic
1133941277 16:10311222-10311244 AAGGACATTAGTGGAAAAACCGG - Intergenic
1135084107 16:19461070-19461092 ATGGACATCGGTGGAAAAACTGG + Intronic
1139095034 16:63695093-63695115 AAGGAATTCTGGTGAAAGATAGG + Intergenic
1139205738 16:65026711-65026733 GAGAACATCTGGGGAAAAATGGG - Intronic
1141686265 16:85571686-85571708 AAGGACTGAGGGGGAGAAACAGG + Intergenic
1142973218 17:3627115-3627137 AAGCAGCTCTGTGGAAAAACGGG - Intronic
1143013335 17:3878437-3878459 CAGGACTTCAGGGGAAAGAAGGG + Intronic
1143615850 17:8048638-8048660 AAGGACTCCTCAGAAAAAACAGG + Exonic
1144236524 17:13266396-13266418 GAGTATTTCTGGGGAATAACAGG - Intergenic
1144381744 17:14705631-14705653 AAAGACTTCTGGGGACAATTAGG - Intergenic
1144463574 17:15478500-15478522 GAGGCTTTCTGGGGAAGAACAGG - Intronic
1144626849 17:16848203-16848225 AAGCACTGCTGGGGAGAAGCAGG + Intergenic
1144879589 17:18424509-18424531 AAGCACTGCTGGGGAGAAGCAGG - Intergenic
1144970773 17:19108181-19108203 AGGGACTTTGGGGGAAAGACTGG - Intergenic
1144991075 17:19234343-19234365 AGGGACTTTGGGGGAAAGACTGG - Intronic
1145152651 17:20519878-20519900 AAGCACTGCTGGGGAGAAGCAGG + Intergenic
1145237522 17:21219304-21219326 GAGGACATTTGTGGAAAAACAGG + Intergenic
1147009553 17:37434031-37434053 AAGGACATTTGTGGAAAATCTGG - Intronic
1147210292 17:38869452-38869474 AAGGAATGCTGGAGAAAAAGGGG + Intergenic
1148426875 17:47606393-47606415 AAAGACTTCTGGGTCAAGACTGG - Intronic
1148492534 17:48032595-48032617 GGGGACTTCAGGAGAAAAACAGG + Intronic
1148742455 17:49900592-49900614 AAGGACTTTTGGAGGAAAAGGGG + Intergenic
1150089069 17:62304979-62305001 AATAACTTATGGGGAAAAAAAGG - Intergenic
1150826909 17:68484666-68484688 AAGGACATCTGTGAAAAACCTGG - Intergenic
1151810580 17:76438510-76438532 AAGGACGTTTGAGGAATAACAGG - Intronic
1153101994 18:1482743-1482765 AAAGACTTCTGGAGGAGAACTGG + Intergenic
1155327447 18:24679150-24679172 GAGGACTTCTGGGGATCCACGGG - Intergenic
1156533833 18:37844294-37844316 AAGGCCTTCTGAGAAAAGACAGG - Intergenic
1156782986 18:40874729-40874751 AATAAATTCTGGGGAAAAAAAGG + Intergenic
1157667844 18:49502793-49502815 AAGGACATTTGGGGAACAACTGG - Intergenic
1158141137 18:54257421-54257443 AAGGACATTAGGGGAAAAACTGG - Intergenic
1158844553 18:61428167-61428189 AAGGATTACTTGGGAAACACAGG - Intronic
1160135365 18:76266743-76266765 AAGGACTTCACGGGAAAGCCTGG + Intergenic
1160352398 18:78194777-78194799 AGGGACAGCTGGGGAAAGACTGG + Intergenic
1161471092 19:4457215-4457237 AACGACCTTTGGGGAAAAACGGG - Intronic
1162838077 19:13334660-13334682 CAGGACTTCTGGGAAAAGACTGG + Intronic
1164384839 19:27763743-27763765 AAAGACATCTGGGCAAAACCAGG - Intergenic
1165713853 19:38031314-38031336 AAGGACATCCGCAGAAAAACTGG - Intronic
1166314816 19:41983519-41983541 ATGGACTTCTGGGGTGAAGCTGG + Intronic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166476706 19:43132924-43132946 AAGATGTCCTGGGGAAAAACTGG + Intronic
1166590246 19:43991487-43991509 AAGGACTACTGGGGGAGAAGCGG - Intronic
1167603912 19:50469971-50469993 AAGGTTGTCGGGGGAAAAACTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168487472 19:56776517-56776539 CAGGACTACTGAGGAAACACTGG + Intronic
925193426 2:1904188-1904210 AAGGACATCTGTGGAGAAACTGG - Intronic
925487561 2:4352788-4352810 AAGGCCTTCTCAGGAGAAACTGG + Intergenic
925604922 2:5649423-5649445 AAGAACTTCTGGGAAAAACACGG + Intergenic
926003754 2:9355183-9355205 AAGGACATTTGGGGGAAAACTGG - Intronic
926167098 2:10528051-10528073 AAGGACTATTGGGGGAAATCAGG + Intergenic
926380968 2:12288862-12288884 GAAGATTTCTGGGGAAAGACAGG - Intergenic
927047779 2:19297495-19297517 CCTGACTTCTGGGGAGAAACAGG + Intergenic
928001592 2:27527538-27527560 AAGGACTTTAGTGGCAAAACTGG + Intergenic
928103992 2:28455769-28455791 AAGGACTTCTGCAGTGAAACAGG - Intergenic
928161765 2:28933423-28933445 CAAAACTTCTGGGAAAAAACAGG + Intronic
928530606 2:32187030-32187052 AATGAGTTCGGGGGAAAAAATGG + Intronic
928924655 2:36565495-36565517 AGGGACATCTGGGGAAATGCAGG - Intronic
929192738 2:39154716-39154738 AAGAACATTTGCGGAAAAACTGG - Intergenic
929271325 2:39975465-39975487 ATGGAGATCTGGGGAAACACGGG - Intergenic
929292502 2:40209485-40209507 AAGGACTTCTGAGGGAAATAGGG + Intronic
930105162 2:47633532-47633554 AAGGATTACAGGGGAAAACCAGG - Intergenic
930297417 2:49572291-49572313 AAGCTCTTCTTGGGGAAAACTGG - Intergenic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
930860751 2:56070598-56070620 AACCCCTTCTGGGGAGAAACAGG + Intergenic
931653122 2:64486529-64486551 AAGAACCTCTGGGGACAATCTGG + Intergenic
933523515 2:83405489-83405511 AAGGACATCTGGGTTGAAACTGG + Intergenic
933547714 2:83736481-83736503 AAGGACTGCAGGAGAAAAATTGG - Intergenic
937814664 2:126237967-126237989 AAGCAGTTCTGGGAAAACACAGG - Intergenic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
938760106 2:134417355-134417377 AAGGATCTCGGTGGAAAAACTGG - Intronic
939200124 2:139023192-139023214 AAGGAAGTCTGGGGAAAAGATGG + Intergenic
941190431 2:162375244-162375266 AAGGATTTGGGGGGAAAGACTGG + Intronic
941428761 2:165385680-165385702 AAAGGCTTCAGTGGAAAAACTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941778740 2:169421351-169421373 AAGGACATATGGGGAAAAAGTGG + Intergenic
942895023 2:181042080-181042102 AAGGACATTAGTGGAAAAACTGG - Intronic
943110430 2:183597644-183597666 GAGAACTTCTGGGGATAAAAGGG - Intergenic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
943756263 2:191560399-191560421 TAGTCCTTCTGGGGATAAACAGG + Intergenic
943919693 2:193689336-193689358 ATAGACTTCCAGGGAAAAACTGG - Intergenic
944179630 2:196875197-196875219 CAGGACATCTGTGGAAAAACTGG + Intronic
944664549 2:201949164-201949186 AAGGATGTTTGTGGAAAAACTGG - Intergenic
946688224 2:222292430-222292452 AAGGACTTCTTTGTAAAAGCTGG + Intronic
947437900 2:230088771-230088793 AAGAACCTGTGGGGAAAAAATGG + Intergenic
947816241 2:233039504-233039526 AAGGACATTAGTGGAAAAACTGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
948839571 2:240642366-240642388 AAGGAGGTCTGGGGAACATCAGG + Intergenic
948989902 2:241548441-241548463 AAGGTCTTCTCTGGAGAAACTGG + Intergenic
1169278171 20:4247370-4247392 AATGAGTGCTGGGGAAAAGCGGG + Intronic
1169311172 20:4541433-4541455 AAGGACTTCTGAGGAATTAGAGG - Intergenic
1170020243 20:11829590-11829612 AAGGACTTGGGGAGAAGAACGGG + Intergenic
1170073741 20:12396862-12396884 AAGGTCTCCTAGGTAAAAACTGG + Intergenic
1170307993 20:14960669-14960691 AACGAATTCAGGGGAAGAACAGG + Intronic
1170711760 20:18797719-18797741 AAGGAATTTTGGGCAAAATCAGG + Intergenic
1175197408 20:57253937-57253959 AAGGACATCTGTGGAAACACTGG - Intronic
1177374599 21:20253374-20253396 AAGGACTTCTGTGGCCAAATTGG + Intergenic
1177447653 21:21218567-21218589 AAGGACTCCTGGGGTTACACTGG - Intronic
1177532565 21:22380261-22380283 AAGGCCTTATGAGCAAAAACTGG + Intergenic
1178479325 21:32966085-32966107 AAGGACATTAGTGGAAAAACTGG - Intergenic
1178903418 21:36615881-36615903 AAGAACTTATGGAGAAAGACTGG + Intergenic
1178990757 21:37354098-37354120 AAGTACTACTAGTGAAAAACGGG + Intergenic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1181661474 22:24353194-24353216 AAGGACATTAGTGGAAAAACTGG - Intronic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
949307125 3:2654720-2654742 AAGGACTGGGGGGAAAAAACAGG - Intronic
949882101 3:8669918-8669940 AAGGACATGAGTGGAAAAACTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950303008 3:11898312-11898334 AAGGACCTTCGTGGAAAAACCGG - Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952451552 3:33438771-33438793 GAGGACTTCTGGGTTAAAGCTGG - Intronic
952852971 3:37744272-37744294 GAGGGCTTCTTGGGGAAAACTGG - Intronic
952914766 3:38226851-38226873 AAGGACATTAGTGGAAAAACTGG + Intronic
954505328 3:51065636-51065658 AATGGCTACCGGGGAAAAACTGG + Intronic
955885621 3:63595311-63595333 AAGGAATTCTGGGGTAAGAGTGG - Intronic
956782238 3:72613121-72613143 CAGCACCTCTGGGGAAAAAAAGG - Intergenic
957015752 3:75062989-75063011 GGGGACTTCTGGGGAAGAATGGG - Intergenic
960348203 3:116561037-116561059 AAGGATTGCTAGGGAAAAAGAGG - Intronic
961211374 3:125128663-125128685 ATGGACTTATGGGCAGAAACAGG - Intronic
961354432 3:126327070-126327092 AGGCACCTCTGTGGAAAAACTGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962840582 3:139228889-139228911 ATGGACTTCTGGGACAATACAGG - Intronic
962918333 3:139928846-139928868 AACGACTTCTGTGTAAAACCTGG + Intergenic
963057841 3:141201894-141201916 AAGTAACTCTGGGGAAAAACAGG + Intergenic
963346103 3:144098297-144098319 AATGACATCTGGGGAGAATCTGG + Intergenic
964160382 3:153639134-153639156 AAAGACATCCGTGGAAAAACCGG + Intergenic
964167138 3:153722088-153722110 AAGGATTTCTGTTGAAAAATTGG + Intergenic
964493201 3:157259235-157259257 AAGGATTTTTCAGGAAAAACAGG - Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965112240 3:164442244-164442266 AAGAACATTTGTGGAAAAACGGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968029596 3:195472338-195472360 AAGGATATCTGAGAAAAAACAGG - Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968752678 4:2398353-2398375 AAGGACTTCTGCTGAAAAGAGGG + Intronic
971364339 4:25965591-25965613 AAGGAGTTAAGGGGAAAAAGAGG - Intergenic
971454609 4:26832617-26832639 AATGACTTCAGAGGAAAAAGAGG + Intergenic
972540852 4:40037976-40037998 AAGGACATTAGGGGGAAAACTGG + Intergenic
972694867 4:41435195-41435217 AAGGACTTCTGTGGTAACATAGG - Intronic
972695071 4:41437362-41437384 AAGGACTGCTGGCTAAAAACAGG - Intronic
973745288 4:53958072-53958094 TATTACTTCTGGGGAAATACAGG - Intronic
975774890 4:77775332-77775354 AATGCCTACTGGGGAAAAAATGG + Intronic
975801463 4:78062967-78062989 AAGGAAAACTGAGGAAAAACCGG - Intronic
976373374 4:84315930-84315952 AAGCAATTCTGGAGAAAAAATGG + Intergenic
976629533 4:87222288-87222310 AAGGACTTTTAGGGGAAAATGGG - Intronic
977354155 4:95924795-95924817 AAGGACTTCAATGGAAAAATAGG + Intergenic
977657517 4:99539006-99539028 AAGGACTTCTGCAGAAAAGTTGG - Intronic
977886442 4:102257468-102257490 AAGGCCTTCTTGGGCAAAACAGG + Intronic
978589922 4:110313845-110313867 AATCACTTATGGGGAAAAAAAGG + Intergenic
979856809 4:125643472-125643494 AGGGACTTCAGGGAGAAAACTGG - Intergenic
980966638 4:139527783-139527805 AAGGACATTAGTGGAAAAACTGG - Intronic
981161102 4:141499747-141499769 AAGGACTTCTGGACCAAAGCAGG + Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981543539 4:145871305-145871327 AAGGACATTAGTGGAAAAACTGG - Intronic
981992395 4:150938308-150938330 AAGGATTCCTGGAGAAAAATTGG - Intronic
984297620 4:177873260-177873282 AAGAGAATCTGGGGAAAAACAGG - Intronic
984825896 4:183924377-183924399 AAGGACTTCTGAGGAGGCACAGG + Intronic
987071071 5:14337603-14337625 TAGGACTACTGGGGAAAGAGGGG + Intronic
989374368 5:40745212-40745234 AAAGACATTTGGGGGAAAACAGG + Intronic
989806923 5:45620261-45620283 AAGGACATTAGTGGAAAAACTGG + Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990355279 5:54960750-54960772 AAGGAATTCTGAGGAAAACTGGG + Intergenic
991336503 5:65553975-65553997 AAGGACTTCTGGGGTAAGACTGG - Intronic
992663875 5:78986561-78986583 AAGGATTCTTGGGGAAAAAAAGG - Intergenic
992857738 5:80880433-80880455 CAGGTCTTTAGGGGAAAAACTGG - Intergenic
993200467 5:84809800-84809822 AAGAACCTCTGGGGAATTACTGG - Intergenic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
995433247 5:112105789-112105811 AAGGTCTTCAGGGCAATAACAGG - Intergenic
995684084 5:114751934-114751956 AAAGTCTGCTGGGGAACAACTGG + Intergenic
997233614 5:132259987-132260009 AAGGACTATTTGAGAAAAACAGG - Intronic
1000022970 5:157334834-157334856 AAGGACTTTAGTGGGAAAACTGG + Intronic
1000330230 5:160199849-160199871 AAGGACTGCTGAGGAGAGACAGG + Intronic
1001240159 5:170062811-170062833 AATGCCTTCTGGGGAGAAGCAGG - Intronic
1001733888 5:173982473-173982495 AAGACCTACTGGGGAAAAAATGG - Intronic
1004162288 6:13225334-13225356 AAAGACTTCTGGGGCCAATCAGG - Intronic
1004267677 6:14163283-14163305 AAAGACTAATGGGGAAAAAAGGG + Intergenic
1004268325 6:14169689-14169711 AATGAATTCTGGTGAAAAACTGG - Intergenic
1004874014 6:19937078-19937100 AAGGACATTAGTGGAAAAACTGG - Intergenic
1004992324 6:21152249-21152271 AGAGACTACTGGGGAACAACTGG - Intronic
1005022027 6:21427442-21427464 AGGGGATTCTGGGGAAAGACAGG - Intergenic
1005431629 6:25763837-25763859 ATGGACTTCTGGGGGAAAAGGGG - Intronic
1006269973 6:32956883-32956905 AAGGAGATCTGGGGAAGAACAGG + Intronic
1007559047 6:42790729-42790751 GAGCAAATCTGGGGAAAAACGGG + Intronic
1008289286 6:49694067-49694089 AAGGCCTTCTGAAGAAAAACAGG - Intronic
1008818652 6:55603630-55603652 AAGGTCTTCTTGGGGAAAACTGG + Intergenic
1010153408 6:72763449-72763471 AAGGATTTATGGAGAAACACTGG - Intronic
1011255092 6:85412325-85412347 CAGGACTGCTGGGTTAAAACTGG + Intergenic
1012371414 6:98511858-98511880 AGGGATTTCTGGGGAAAGAGTGG + Intergenic
1013125980 6:107184623-107184645 AAGGACTTCTGGGGGTGAAGAGG + Intronic
1013223604 6:108102564-108102586 AAGGACTTAAGAGCAAAAACAGG - Intronic
1014637776 6:123869912-123869934 AAAGACTTTTGTGGAAAATCAGG - Intronic
1015344055 6:132134733-132134755 AAAAACTTAAGGGGAAAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015686747 6:135871608-135871630 AAAGAATTCTGGGGAAAGACAGG + Intronic
1015728482 6:136323990-136324012 GAGCAATTCTGTGGAAAAACTGG - Intergenic
1016549911 6:145268015-145268037 AAGTACTTCTGTAGAAACACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018957323 6:168418886-168418908 ATGGCTTTCTGGGGAAAAAAAGG + Intergenic
1020429845 7:8107643-8107665 AAGGACGTCATTGGAAAAACTGG - Intergenic
1020721112 7:11746373-11746395 AAGGACATCAGTGGAAAAACTGG - Intronic
1020885276 7:13812368-13812390 AAGGACTACTGGGTAAATAACGG + Intergenic
1021179350 7:17487928-17487950 AATGACTTCTGGGGGCAAAATGG - Intergenic
1022356397 7:29618976-29618998 AAGGACATTGGTGGAAAAACTGG + Intergenic
1022543615 7:31163636-31163658 AAAGACATTTGTGGAAAAACTGG + Intergenic
1023148693 7:37178943-37178965 AAGGACATCAGGGAAAAACCTGG + Intronic
1023423502 7:40009789-40009811 AAGGACATCTTATGAAAAACAGG + Intronic
1024013656 7:45292140-45292162 TAGGAATTCAGGGGAAAAAAAGG + Intergenic
1024879485 7:54069378-54069400 AGGGACATCAGTGGAAAAACTGG + Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027297801 7:76796021-76796043 AAGGAAGTCTGGAGAAATACTGG - Intergenic
1027537279 7:79419462-79419484 AAGTACTTCTAGGGAAATAAAGG - Intronic
1028094453 7:86743274-86743296 AAGGACTTTTTGGGAGAAATTGG + Intronic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029883457 7:103841614-103841636 AAGTATTCCTGGGGGAAAACGGG - Intronic
1030114216 7:106050761-106050783 GAGGACTTCTGCGGGAAAAGGGG + Intergenic
1030149877 7:106393366-106393388 AAGGTCTTCGGGGCAATAACAGG - Intergenic
1030667510 7:112296164-112296186 AAGTCCTTCTGGGGAAAAAATGG + Intronic
1031400699 7:121323462-121323484 AAGGATTGCTGGGGAAATGCTGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1034069479 7:148169462-148169484 AATGAATTCTAAGGAAAAACTGG + Intronic
1036008032 8:4689457-4689479 AAGGATTTGTGGGGAAAAAAGGG + Intronic
1036915870 8:12803205-12803227 TAGGATTTCAGGGGGAAAACTGG - Intergenic
1038090543 8:24248083-24248105 AATGAATTCTGGGGAACAATTGG + Intergenic
1038809059 8:30821584-30821606 CCAGACTTCAGGGGAAAAACTGG - Intergenic
1040293508 8:46137452-46137474 GAGGACTTCTGGGATAAAAGAGG + Intergenic
1042809714 8:72810734-72810756 AAGGACTTCTGTTTAAAAAGAGG + Intronic
1042868579 8:73377468-73377490 AAGGACTTTTGAGGAAACTCAGG - Intergenic
1043203146 8:77397666-77397688 AATTTCTTCTGGGGCAAAACTGG + Intergenic
1043666313 8:82819991-82820013 AAGGACTTCTGAAGAAGGACAGG - Intergenic
1045017107 8:98009674-98009696 AAAGGCCTCTGGGGAAAATCTGG - Intronic
1045380787 8:101622839-101622861 GGGGACTTCTGGGGAAAAGTGGG - Intronic
1046353270 8:113044765-113044787 AAGGATATTTGGGGAGAAACTGG - Intronic
1047702533 8:127463933-127463955 AAGAAATTCTGGGGCAATACCGG - Intergenic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1048331438 8:133473452-133473474 AAGGCCTTTTGGGGACAAACAGG - Intronic
1048351623 8:133621178-133621200 AAAGACTCCTGGGGGAAATCAGG - Intergenic
1048679987 8:136830795-136830817 AATGATTTCTGGAGAAAAAAGGG - Intergenic
1048712678 8:137229558-137229580 AAGGACTTCAGAGGACAATCGGG - Intergenic
1051647753 9:19286905-19286927 AAGGAATTCTGGGGTCGAACTGG - Exonic
1051904066 9:22075117-22075139 TAAGACTTCTGGGGAAACTCAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053062594 9:35043725-35043747 AAGGACTTCTGGGGAACCGTGGG + Exonic
1055785806 9:79867494-79867516 AAGGGCTTATTGTGAAAAACGGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059803339 9:117772987-117773009 AGGAAATTCTGGGGAAAAAATGG + Intergenic
1060113189 9:120921039-120921061 ATGGACTTCTGGTGAAAAGCTGG - Intronic
1060401323 9:123351125-123351147 AAAGACTTGTGGGCAAAACCTGG + Intergenic
1061076419 9:128344126-128344148 AAGGCCTCCTGGAGAAAAAGCGG + Intronic
1062065107 9:134522497-134522519 AGGGGCTTCTGGGGAAAAAACGG - Intergenic
1062453552 9:136625447-136625469 CAGGACAGCTGGGGAAAAATGGG + Intergenic
1186186754 X:7028521-7028543 AAGATGTTCTGGGGAAAAACTGG + Intergenic
1186222068 X:7360073-7360095 AAGGACTTCTGTGTCAAAATGGG + Intergenic
1186921060 X:14280821-14280843 AATGGCTTCTGGGGAACAAGTGG + Intergenic
1188482490 X:30649794-30649816 AAGCACTTCTGGGGGAAAAGGGG + Intergenic
1188496500 X:30788320-30788342 AAGAACTTTAGTGGAAAAACTGG - Intergenic
1189909980 X:45800963-45800985 AAGGACATAAGTGGAAAAACTGG + Intergenic
1189915148 X:45849541-45849563 GGGGACATCTGGGGAAAAAGTGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191814727 X:65231016-65231038 AAGGACCTATGGTGAAATACTGG - Intergenic
1192267369 X:69547939-69547961 CAGAACTTCTGGAGAAAAATTGG - Intergenic
1192627293 X:72743712-72743734 AAGGGGCTCTGGGGACAAACAGG - Intergenic
1192654415 X:72977101-72977123 AAGGGGCTCTGGGGACAAACAGG + Intergenic
1193174808 X:78380171-78380193 GAGGACTTCAGGGGAAGAAGGGG - Intergenic
1193908288 X:87269589-87269611 AAGAAATTCAGGGCAAAAACTGG + Intergenic
1195877770 X:109560141-109560163 AAGAACTTCAATGGAAAAACAGG - Intergenic
1196288492 X:113911234-113911256 GAGGACTGCTGGGGAAAGGCAGG + Intergenic
1196310831 X:114162929-114162951 AAGGACTTCTGGGAGAAGAGGGG - Intergenic
1197133032 X:123027415-123027437 AATGACTTCTGGGTAAATAATGG - Intergenic
1197164526 X:123361850-123361872 AAGATCTTGGGGGGAAAAACTGG - Intronic
1197689831 X:129486249-129486271 AAGGACATTAGGAGAAAAACTGG + Intronic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198589728 X:138164207-138164229 AAGGACATTAGTGGAAAAACTGG - Intergenic
1199143410 X:144336438-144336460 AACATCTTCTGGGGTAAAACAGG - Intergenic
1199663054 X:150071835-150071857 AAAGACATCAGTGGAAAAACTGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic