ID: 905184756

View in Genome Browser
Species Human (GRCh38)
Location 1:36188259-36188281
Sequence GTGCCCGTGGGCCCTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905184750_905184756 -6 Left 905184750 1:36188242-36188264 CCCCAGCTCCACTGTGTGTGCCC No data
Right 905184756 1:36188259-36188281 GTGCCCGTGGGCCCTCTCAAAGG No data
905184751_905184756 -7 Left 905184751 1:36188243-36188265 CCCAGCTCCACTGTGTGTGCCCG No data
Right 905184756 1:36188259-36188281 GTGCCCGTGGGCCCTCTCAAAGG No data
905184748_905184756 29 Left 905184748 1:36188207-36188229 CCTCAACACACACACAATCTTTC No data
Right 905184756 1:36188259-36188281 GTGCCCGTGGGCCCTCTCAAAGG No data
905184752_905184756 -8 Left 905184752 1:36188244-36188266 CCAGCTCCACTGTGTGTGCCCGT No data
Right 905184756 1:36188259-36188281 GTGCCCGTGGGCCCTCTCAAAGG No data
905184747_905184756 30 Left 905184747 1:36188206-36188228 CCCTCAACACACACACAATCTTT No data
Right 905184756 1:36188259-36188281 GTGCCCGTGGGCCCTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905184756 Original CRISPR GTGCCCGTGGGCCCTCTCAA AGG Intergenic
No off target data available for this crispr