ID: 905194269

View in Genome Browser
Species Human (GRCh38)
Location 1:36262590-36262612
Sequence ATGTCTGTATATCAGTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905194264_905194269 11 Left 905194264 1:36262556-36262578 CCAGGCTTTATGTAGAACTCTTT 0: 1
1: 0
2: 2
3: 7
4: 235
Right 905194269 1:36262590-36262612 ATGTCTGTATATCAGTATGGGGG 0: 1
1: 0
2: 0
3: 14
4: 161
905194263_905194269 27 Left 905194263 1:36262540-36262562 CCTACTGTAGTTCTATCCAGGCT 0: 1
1: 0
2: 0
3: 10
4: 90
Right 905194269 1:36262590-36262612 ATGTCTGTATATCAGTATGGGGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905194269 Original CRISPR ATGTCTGTATATCAGTATGG GGG Intronic
905194269 1:36262590-36262612 ATGTCTGTATATCAGTATGGGGG + Intronic
906296316 1:44651088-44651110 CTGTCCGTCTGTCAGTATGGGGG - Exonic
910247605 1:85157826-85157848 ATGTATAGATATCAGGATGGGGG - Exonic
911631577 1:100189518-100189540 ATGTCTGTAGATCAGGACAGAGG + Exonic
914205931 1:145529083-145529105 ATGGCTGCATATCTGGATGGCGG - Intergenic
916372247 1:164111569-164111591 ATGTTTGTATACCAGTACAGAGG + Intergenic
917591971 1:176485623-176485645 ATCTATGTATTTCAGTAGGGTGG - Intronic
918876620 1:190054151-190054173 ATGTATGTATATGGGTATGTTGG + Intergenic
919579759 1:199357054-199357076 CTGTCTTTTTTTCAGTATGGGGG - Intergenic
920854995 1:209654835-209654857 TTGACTGTATATCAGTGAGGAGG - Intergenic
922565666 1:226600171-226600193 ATGCCTGTATCTCAGCATGTTGG + Intronic
1068439115 10:57029581-57029603 ATTTCTGTAAATCAGAAAGGGGG - Intergenic
1069972320 10:72182471-72182493 TAGTCTGGATATCAGGATGGAGG + Intronic
1071971525 10:90912626-90912648 AGGTCTGAATATCAGTAGCGTGG + Exonic
1073085905 10:100888616-100888638 ATGTCTGTCTGGCAGGATGGTGG + Intergenic
1073488404 10:103836535-103836557 GTGTCTGTATATGAGTTTGAAGG - Intronic
1077941214 11:6845739-6845761 ATGACTGTATTTCAGTAGGTAGG - Exonic
1077943468 11:6869769-6869791 ATGACTGTATTTCAGTAGGCAGG - Exonic
1079170877 11:18094393-18094415 ATGTGTGGATTTCAGTATGGGGG + Intronic
1079199556 11:18364222-18364244 ATACCTGTTTATCATTATGGGGG - Intronic
1082833041 11:57633678-57633700 ATATCTGTATATGACAATGGAGG + Intergenic
1085819867 11:79780879-79780901 ATGTCAGTGTATCAGGATAGTGG - Intergenic
1086597321 11:88588547-88588569 ATGTCTGTATATGGGTAAGCAGG - Intronic
1091819237 12:3462406-3462428 ATTTCTGTAAATCAGTAAGATGG - Intronic
1092074867 12:5664727-5664749 TTTTCTGTTTTTCAGTATGGGGG - Intronic
1092506855 12:9110762-9110784 ATTTCTGTATTTCACTATAGAGG - Intronic
1094468238 12:30777772-30777794 AAGTCTATATATCAGTAGGCAGG - Intergenic
1096227840 12:49879368-49879390 ATGTGTGTATATGTGTATGTGGG + Intronic
1097727422 12:63090900-63090922 ATGTCAGTATCTCAGTGTGTGGG + Intergenic
1097748092 12:63321509-63321531 ATGTCTGTATCTGAGTAAGTAGG + Intergenic
1100189543 12:92176163-92176185 TTGTCTGTCAATCACTATGGAGG - Intergenic
1103175449 12:118859438-118859460 ATGTATGTATACAAGGATGGAGG - Intergenic
1106689941 13:32104201-32104223 ATTTCTGAATCTCAGTATTGTGG + Intronic
1106862499 13:33925721-33925743 ATTTATGTATGTCAGTAGGGTGG + Intronic
1108404810 13:50090000-50090022 ATGTATTTTTATCAGCATGGAGG + Intronic
1114505543 14:23209519-23209541 ATTTGTTTATATCAGTATGGAGG - Intronic
1114526821 14:23371763-23371785 ATGTCTGTGTATGGGTATGTTGG + Intergenic
1114964295 14:27938769-27938791 ATATCTATAGATCATTATGGAGG + Intergenic
1115271457 14:31558080-31558102 ATGTTTTTATATCACTATGTAGG + Intronic
1115499923 14:34040294-34040316 AAGTTTTTATATCATTATGGTGG + Intronic
1115670922 14:35611044-35611066 AAATCTGTAGATCAGTTTGGGGG - Intronic
1118141814 14:63092140-63092162 ATGGCTGTAAATCAGTAAGGTGG - Intronic
1119446491 14:74668693-74668715 ATATCTGATTATCAGTATAGTGG + Intronic
1120365834 14:83567857-83567879 ATGTCTGTTTATGAATATTGGGG + Intergenic
1122167715 14:99841822-99841844 GTGTCTCTATCTCAGTATTGGGG - Intronic
1123587141 15:21770783-21770805 TTTTCTGTTTTTCAGTATGGGGG + Intergenic
1123623779 15:22213348-22213370 TTTTCTGTTTTTCAGTATGGGGG + Intergenic
1125074660 15:35599519-35599541 CTTTCTGTATACCAGTTTGGTGG + Intergenic
1130299780 15:82671413-82671435 ATGTCTGGAGAACAGTTTGGAGG + Intronic
1131062715 15:89413911-89413933 ATGTATGTATATGAGTATGCAGG - Intergenic
1133814519 16:9186401-9186423 ATGTATGTATGTATGTATGGAGG + Intergenic
1134605347 16:15566705-15566727 ATGACTGTATATCAATATAATGG + Intronic
1137399373 16:48140917-48140939 CTGTCTGTAAAACAGCATGGTGG + Intronic
1137486352 16:48894627-48894649 ATGTCTGTATATCATTAGTCAGG + Intergenic
1139178431 16:64716908-64716930 AGAACTGTATAACAGTATGGGGG + Intergenic
1139623624 16:68167273-68167295 TTGTCTGTAAATGAGAATGGGGG + Intronic
1140942289 16:79733464-79733486 ATGTCTGTGTATCAGCAGTGTGG + Intergenic
1141216552 16:82030580-82030602 ATGTATTTATATCACTATGGAGG + Intergenic
1142742387 17:1938746-1938768 ATGTCTGTATTTCAGAAATGAGG - Intronic
1149435420 17:56629588-56629610 ATCTCTGTATATCACCCTGGTGG - Intergenic
1150486739 17:65549387-65549409 ATGTATGGACATCAGTTTGGTGG - Intronic
1150889655 17:69132849-69132871 ATGTATGTATATATGTATGTAGG - Intronic
1151212840 17:72557773-72557795 ATGTCTGTGTATGAGTGTGTGGG - Intergenic
1156951730 18:42908689-42908711 ATGTCTTTATTTCAGTATGAAGG - Intronic
1157431806 18:47634444-47634466 ATGTCTGGATATGATTATGTTGG - Intergenic
926719007 2:15944974-15944996 ATGTATGTATGTATGTATGGGGG + Intronic
927350337 2:22105149-22105171 ATGTATTTCTATCAATATGGTGG - Intergenic
929473675 2:42222750-42222772 ATTTCTATATATCAATGTGGAGG - Intronic
930274434 2:49295274-49295296 ATGTCTGTATCTCTGTAAAGTGG - Intergenic
932080940 2:68714770-68714792 ATTTCTGTGTATCAGGATGAAGG - Intronic
935153316 2:100459845-100459867 AAGCCTGTATATCAGTAGGCAGG - Intergenic
936745016 2:115565141-115565163 ATGTGTGTATATATGTATGTAGG + Intronic
938482011 2:131670591-131670613 AAGTCTGTGTATGAGGATGGTGG + Intergenic
939982826 2:148801091-148801113 AAGTCTGCATAACAGAATGGGGG + Intergenic
942557171 2:177183818-177183840 ATGTATCTATATATGTATGGTGG - Intergenic
943019760 2:182558851-182558873 ATGTCTGCAGATCAGAATGTGGG + Intergenic
945502070 2:210588723-210588745 ATGTGTGTGTATGTGTATGGAGG - Intronic
945537157 2:211031980-211032002 ACGTCTCTATCTCAGAATGGTGG - Intergenic
946635264 2:221718163-221718185 ATGTCTGTTTCTCAGAATGTTGG + Intergenic
947017034 2:225632405-225632427 TTGTATGTATATCAGTGTGGAGG - Intronic
948239162 2:236414702-236414724 CTTTCAGTATCTCAGTATGGAGG + Intronic
948498234 2:238369056-238369078 ATTTCTGTATATTAGTATTTTGG + Intronic
1168894620 20:1314926-1314948 ATATCTGTATATCAATTTGGTGG - Intronic
1169078106 20:2774771-2774793 ATGTTTGTGAAGCAGTATGGAGG - Intergenic
1169264607 20:4160308-4160330 GTGTGTGCATATCAGTATGTGGG + Intronic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1174297208 20:49557010-49557032 AAGTCCGTATATCAGTAGGCAGG - Intronic
1175246372 20:57584744-57584766 ATGTCTGTTTCTCTGTCTGGTGG - Intergenic
1175864060 20:62165233-62165255 ATGTCTGCATTTCAGTGGGGAGG + Intronic
1176688771 21:9879995-9880017 ATCTCTGCATTTCTGTATGGTGG - Intergenic
1178342727 21:31800125-31800147 ATGTATGCATATGAGTTTGGAGG + Intergenic
1181315337 22:21967476-21967498 ATGTCTGTGTTTCAGAAAGGGGG + Intronic
949341241 3:3033311-3033333 ATGTCTGGAAATCTGTATGCTGG - Intronic
949768938 3:7557130-7557152 ATGTGTGTGGATCAGAATGGAGG + Intronic
950275917 3:11660633-11660655 ATATCTCTATCCCAGTATGGTGG + Intronic
950599945 3:14025027-14025049 AAGTCTGTATATCAGTAGGCAGG + Intronic
953396549 3:42576699-42576721 AAACCTGTATATCAGTTTGGGGG - Intronic
955547582 3:60047896-60047918 ATGTAGGTGTATCAGTTTGGTGG + Intronic
955828254 3:62972442-62972464 ATGTGTGTATATGTGTGTGGTGG + Intergenic
956017435 3:64898462-64898484 ATGGCGGAATAACAGTATGGAGG - Intergenic
956394192 3:68807310-68807332 ATGTCTGTCTATCTCTAGGGAGG + Intronic
958820500 3:98968371-98968393 ATTTATTCATATCAGTATGGAGG + Intergenic
969978458 4:11128823-11128845 ATGAATGCATATCACTATGGTGG + Intergenic
970544415 4:17112588-17112610 GTGTGTATGTATCAGTATGGTGG + Intergenic
972810278 4:42577078-42577100 ATCTCTGTATATTAGAAAGGTGG + Intronic
973610648 4:52633365-52633387 ATGTCTTTTCATTAGTATGGGGG + Intronic
977410822 4:96660200-96660222 ATGTTTGCATATCAGTGTGTAGG + Intergenic
977644111 4:99392180-99392202 CAGTATGTATAACAGTATGGTGG + Intergenic
979582413 4:122376398-122376420 ATTTCATTATATCAGTATGGAGG - Intergenic
982445871 4:155490181-155490203 ATGTGAGTAGATGAGTATGGGGG + Intergenic
983500313 4:168492373-168492395 ATGTCTGTATACGAGTATTGGGG - Intronic
984603427 4:181755854-181755876 CTGTCTGCATTTCATTATGGTGG + Intergenic
986588388 5:9343217-9343239 GTGTCTTTATGTAAGTATGGAGG + Intronic
987591215 5:19929604-19929626 ATTTCTGTATATTATTAGGGAGG - Intronic
988700761 5:33672295-33672317 CTGTGTGTATATGAGTATGTGGG - Intronic
990974940 5:61551675-61551697 ATGTCTGTATGTCTGTATATAGG + Intergenic
991905199 5:71502862-71502884 ATGTATGTATGTAAGTATGTGGG - Intronic
992185249 5:74238149-74238171 ATGTGTGTGTATCTGTATTGGGG - Intergenic
992535051 5:77692065-77692087 TTGCCTGTATATCAGTATTATGG - Intronic
994258135 5:97625039-97625061 ATGCCAGTATAACAGTATGAGGG - Intergenic
994901397 5:105775889-105775911 AAATCTGTACATCAGTTTGGGGG + Intergenic
995169066 5:109085143-109085165 AATTCTGTAAATCAATATGGGGG + Intronic
996574743 5:124968426-124968448 CTGCCTGTATAACAGCATGGTGG + Intergenic
1001349738 5:170948842-170948864 ATGTCTGTCTACCTGTATGCTGG - Intronic
1001355169 5:171014210-171014232 ATGTCTTTATATAAATAGGGTGG + Intronic
1001960274 5:175876136-175876158 ATGTGTGTATGTGAGTGTGGGGG - Intronic
1013286316 6:108685204-108685226 ATGTCTGACTTTCAGTATGCAGG - Intergenic
1014341447 6:120212546-120212568 GTGTCAGTATATCAGTATAGAGG - Intergenic
1014815350 6:125929454-125929476 ATATCTATATATCTGTATGTGGG + Exonic
1018135468 6:160774628-160774650 ATGTATGTATAACAATGTGGGGG - Intergenic
1018792600 6:167160806-167160828 ATTTCTGTATCTGAGTCTGGTGG - Intronic
1022291618 7:29010042-29010064 ATGTCTGAAAAACAGTATGTGGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028766416 7:94564811-94564833 ATGTCTGTAAATCTCTATGAGGG + Intergenic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1029335988 7:99899729-99899751 ATGTCTGTGTCTGTGTATGGTGG + Intronic
1030164101 7:106535732-106535754 ATCTCTGTGTATCACTAGGGGGG - Intergenic
1031572255 7:123373858-123373880 AAGTCTGTCTATCAATCTGGTGG + Intergenic
1034570015 7:151948094-151948116 ATGTGTGTATATGTGTATGAGGG + Intergenic
1034576317 7:152001791-152001813 AAATCTGTAGATTAGTATGGGGG + Intronic
1035336399 7:158130456-158130478 ATGTGTGTATATGAGTGTGTTGG - Intronic
1035772874 8:2163273-2163295 ATGTATTTATATTAATATGGAGG + Intronic
1036007557 8:4684016-4684038 ATGGTTGTACATCAGTATGATGG + Intronic
1036809352 8:11856942-11856964 ATGTCCTTTTATCAGTTTGGTGG - Intronic
1039263202 8:35795523-35795545 ATGTCTGTGTTTCAGTAATGGGG - Intronic
1041328139 8:56691719-56691741 ATGTCTGTTTCTCAATATGATGG - Intergenic
1041554638 8:59139505-59139527 ATGTATGTATATTATTAGGGTGG + Intergenic
1043465436 8:80501920-80501942 ATTTCTGTTTAACAGTATGGTGG + Intronic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1044524375 8:93235247-93235269 ATCTCTGTGTATCAGTAAGTGGG + Intergenic
1045852658 8:106721546-106721568 ATGTCTTTTTATCAGTATTTTGG - Intronic
1047822971 8:128541605-128541627 ATGTGTGTCTATCAGTGTGTAGG + Intergenic
1048112550 8:131484562-131484584 ATGTCTGTATTTCAGAAGGAGGG + Intergenic
1048785786 8:138048729-138048751 GTGTCTTTATAGCAGCATGGTGG + Intergenic
1049323239 8:142008535-142008557 ATGTGTGCATGTCTGTATGGTGG - Intergenic
1050383845 9:5062579-5062601 GTGTCTGTATATCAATAAGAGGG + Intronic
1050714434 9:8505865-8505887 ATGCCTGTATTTTAGTTTGGTGG + Intronic
1050952073 9:11610189-11610211 ATGTCTGTATATCTGTGTCCTGG + Intergenic
1051645245 9:19261763-19261785 ATGTCTGTATCCCAGCATGTTGG - Intronic
1052405486 9:28054431-28054453 ATGTCAGTATAGCAGTAACGTGG - Intronic
1053780554 9:41601905-41601927 ATCTCTGCATTTCTGTATGGTGG + Intergenic
1054168497 9:61812062-61812084 ATCTCTGCATTTCTGTATGGTGG + Intergenic
1054669032 9:67768756-67768778 ATCTCTGCATTTCTGTATGGTGG - Intergenic
1054745016 9:68845248-68845270 ATGTTTGTAAATTAATATGGTGG + Intronic
1055254168 9:74346302-74346324 ATGTGTGTATATATGTATGATGG - Intergenic
1055254169 9:74346336-74346358 ATGTGTGTATATATGTATGATGG - Intergenic
1056680432 9:88713103-88713125 ATGTGTGTATATTGGTATGTGGG + Intergenic
1060768005 9:126309408-126309430 ATGCCTGATTATCAGTATGCAGG + Intergenic
1194767522 X:97859173-97859195 ATGACTGTATAACAGTAAGATGG - Intergenic
1195318096 X:103698320-103698342 ACGTCTGTATATATGTGTGGGGG + Intergenic
1196808332 X:119608133-119608155 ATGTCTGTCTTTCTCTATGGTGG - Intergenic
1197137223 X:123075824-123075846 AAGTCTGTAAATCATTATGCAGG - Intergenic
1197665638 X:129220549-129220571 ATGTATGTATATATGTATGTGGG - Intergenic
1198318201 X:135490865-135490887 ATGTGTGTATATTAGTATAGTGG + Intergenic
1200811191 Y:7486954-7486976 ATGTATGTATGTATGTATGGAGG - Intergenic
1201059522 Y:10033332-10033354 ATGTTTGTATTTCAATATGAGGG - Intergenic