ID: 905195834

View in Genome Browser
Species Human (GRCh38)
Location 1:36276558-36276580
Sequence GCATCAAGAAAGTGTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905195831_905195834 25 Left 905195831 1:36276510-36276532 CCAGACTCTGTCTCAAAAAAAAA 0: 996
1: 2879
2: 4518
3: 4666
4: 4860
Right 905195834 1:36276558-36276580 GCATCAAGAAAGTGTAAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905195834 Original CRISPR GCATCAAGAAAGTGTAAAGC TGG Intronic
902872204 1:19321011-19321033 CCATCAAGAAAGTGAAAAGACGG - Intronic
903759497 1:25687811-25687833 GTATCAAAAAAGTGCAAATCAGG + Intronic
904241495 1:29149151-29149173 GGAGCAAGAAAGAGAAAAGCAGG - Exonic
904649740 1:31996052-31996074 ACATCAACAAAGTGTCAAGTGGG + Intergenic
904783738 1:32969996-32970018 GCCTCAAGAAAGAAAAAAGCAGG - Intergenic
905195834 1:36276558-36276580 GCATCAAGAAAGTGTAAAGCTGG + Intronic
907618684 1:55952952-55952974 GCTTCGAGAGAATGTAAAGCAGG + Intergenic
908653681 1:66364429-66364451 TCATCAACAATGTGTACAGCAGG + Intronic
910013991 1:82498095-82498117 AAATCATGAAAGTGTAGAGCAGG + Intergenic
910146574 1:84086585-84086607 GCAGCAAGAAAGAGAAATGCAGG - Intronic
910820832 1:91344055-91344077 GCTTCAAGAAAGTGGCAAACAGG - Intronic
913594477 1:120360253-120360275 AGAACAAGAAAGTGAAAAGCAGG + Intergenic
914092787 1:144518733-144518755 AGAACAAGAAAGTGAAAAGCAGG - Intergenic
914305743 1:146415142-146415164 AGAACAAGAAAGTGAAAAGCAGG + Intergenic
914596313 1:149157664-149157686 AGAACAAGAAAGTGAAAAGCAGG - Intergenic
914880467 1:151542530-151542552 ACATCAAGAAAGAGTAAAAGGGG - Intronic
919114018 1:193258408-193258430 GGGTGAAGAAAGTGTAAAGCTGG - Intergenic
919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG + Intergenic
920748855 1:208655129-208655151 TCTTCAAGAAACTGTAAACCTGG + Intergenic
922112335 1:222572966-222572988 CCATCAAGATAGTGAAAAGAAGG + Intronic
923872616 1:238012462-238012484 GCAGCAAGAAATTGCAAAACAGG - Intergenic
1063948534 10:11200998-11201020 TCATCAAGAAAGTGTAAATGTGG + Intronic
1064105492 10:12497723-12497745 GCAGCAAGAAAGTGCAAATTAGG + Intronic
1064371140 10:14752353-14752375 GGATCGAGAAACTGCAAAGCTGG - Intronic
1067856850 10:49801596-49801618 CCATCAAGAAAGTGAAAAGATGG - Intergenic
1067912837 10:50364429-50364451 ACAACCAGAAAGTGAAAAGCAGG - Intronic
1067963985 10:50888560-50888582 GCATCTAGAAAGGGTAATACTGG + Intergenic
1069246524 10:66213900-66213922 GCTTCAAGAAAGTGGAATTCAGG + Intronic
1070649418 10:78223952-78223974 GCATCAAGAAAGTGGCATCCAGG - Intergenic
1072646586 10:97260228-97260250 CCATCAAGAAACTATAAATCAGG + Intronic
1073829503 10:107365783-107365805 GAATTAAGAAAGTGAAGAGCTGG - Intergenic
1074643821 10:115420746-115420768 GCATCAAGAAAATGAAGAGTTGG + Intronic
1076260886 10:129065112-129065134 GCATCAAAGAAATGTGAAGCTGG + Intergenic
1078701327 11:13686653-13686675 TAATCAGAAAAGTGTAAAGCTGG - Intronic
1084660042 11:70541380-70541402 TCATCAAGAAAATGGACAGCTGG + Intronic
1086197744 11:84161288-84161310 GCATAAAGAAAGGTGAAAGCTGG + Intronic
1087386453 11:97475097-97475119 GCATCAACAAAGTATAATGGTGG + Intergenic
1087490320 11:98818272-98818294 GCATCAAGAAAATGGAAACCTGG + Intergenic
1089119188 11:116120442-116120464 GCATTAAAAAAGTAAAAAGCAGG - Intergenic
1098636827 12:72794172-72794194 GGATCAAGAAGATGAAAAGCAGG + Intergenic
1100169618 12:91959435-91959457 GTCTCAAGAAAGTCTAAAGCGGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102103996 12:110304704-110304726 CCATCAAGAAAGTGAAAAAAAGG - Intronic
1102844645 12:116166354-116166376 GCTTCCAGCAAGTATAAAGCAGG + Intronic
1102954099 12:117048366-117048388 TCATCAAGAAAATGTAAACATGG - Intronic
1103183693 12:118937337-118937359 GCAGCAGGAAAGTGTGAGGCTGG + Intergenic
1104410916 12:128556986-128557008 GCAACATGAAAGTGAAAAACAGG + Intronic
1105398533 13:20065496-20065518 CCATCAGGAAAGTGAAAAGGGGG + Intronic
1105834507 13:24197279-24197301 GTAGGAAGAAATTGTAAAGCTGG + Intronic
1109120959 13:58456529-58456551 GGATCAACAAAATGAAAAGCTGG + Intergenic
1110524575 13:76521586-76521608 GGATTAAGAAAGAGAAAAGCTGG + Intergenic
1110916206 13:81024275-81024297 GTATCAACAAAATGTAAAGTTGG + Intergenic
1111024190 13:82497922-82497944 CCATCAAGAAAGTGGAAAGAAGG - Intergenic
1112123731 13:96441321-96441343 GCATCAAGAAAATGAATGGCAGG + Intronic
1113905348 13:113816941-113816963 GCATAAAGCAAATGTACAGCCGG - Exonic
1114747507 14:25165919-25165941 GAATGAAGAAAATGTGAAGCTGG + Intergenic
1115149571 14:30268967-30268989 GCCTCAAGAAAGTTTCAGGCTGG - Intergenic
1116561090 14:46379384-46379406 ACATTAAGAAAGTGAAAAGGTGG - Intergenic
1117120290 14:52560524-52560546 TAATCAAGAGAGTGTAATGCTGG + Intronic
1118640060 14:67783580-67783602 GCATAAAGAAATTGTAAGACTGG - Intronic
1118774888 14:68967585-68967607 GCCCCAAGAAAGTGTAATGAAGG + Intronic
1118964774 14:70570325-70570347 GCATCAACAAAATGAAAAGCTGG + Intergenic
1119761836 14:77157343-77157365 GCAGCAACAAAGTGAACAGCTGG - Intronic
1119837839 14:77766929-77766951 TCATCAAGAAAGTGAAGGGCCGG + Intronic
1121855584 14:97266421-97266443 GCATAAAGAAAGTATATACCCGG - Intergenic
1122515426 14:102305041-102305063 GCCTCAGGGAAGTGGAAAGCAGG - Exonic
1126764661 15:52000237-52000259 CCATCAAGAAAGTGAAAACGAGG - Intronic
1127356151 15:58202184-58202206 TCATCAAGAAAGTGAAAAGATGG + Intronic
1128009994 15:64283781-64283803 CCATCAAGAAAGTTAAAAGTTGG - Intronic
1128413988 15:67427020-67427042 GGATCAAGATAGTCTAGAGCAGG + Intronic
1131814014 15:96203625-96203647 CCTTCAAGAAATTTTAAAGCTGG + Intergenic
1134008475 16:10834123-10834145 GCCTCAAGAAAGTTTTGAGCAGG - Intergenic
1134395377 16:13857851-13857873 GCATCTAGAAAGTGGAAAACTGG - Intergenic
1138373948 16:56549576-56549598 GAATCAAGGAATTGTACAGCAGG - Intergenic
1142474099 17:179833-179855 GCCTCTAGAAAGTGCAAAGCAGG + Intronic
1144612860 17:16739404-16739426 CCATCAAGAAAGTGAAAAGGAGG - Intronic
1144899925 17:18576183-18576205 CCATCAAGAAAGTGAAAAGGAGG + Intergenic
1145132519 17:20369482-20369504 CCATCAAGAAAGTGAAAAGGAGG - Intergenic
1150216435 17:63473522-63473544 CCATCAAGAAAATGAAAAGACGG - Intergenic
1155407518 18:25505444-25505466 GCATCAAGAAAGTGGAGGCCAGG + Intergenic
1158280121 18:55815536-55815558 GTAACAAGAAACTGTAAAGAAGG - Intergenic
1158479857 18:57812394-57812416 GCTTCCAGAAAGTGGAAAGCTGG - Intergenic
1159716914 18:71835451-71835473 GCTTCTAGCAAATGTAAAGCAGG + Intergenic
1167102424 19:47412129-47412151 GCATAAAGAAACTGTGAGGCTGG - Intronic
926013219 2:9424343-9424365 GAATAAGGAAGGTGTAAAGCTGG + Intronic
928192832 2:29189210-29189232 GCATGCAGTAAGTGTAAAACAGG - Intronic
928474276 2:31609772-31609794 CCATCAGGAAAGTGAAAAGATGG + Intergenic
928567883 2:32571692-32571714 GCATCAGCAAACTGAAAAGCTGG - Intronic
928579256 2:32690077-32690099 GAATCAAGACAGTGTACAACAGG + Intronic
934732217 2:96666492-96666514 GGATGAAGAAAATGGAAAGCTGG + Intergenic
935798269 2:106666682-106666704 CCATCAAGAAAGTGAAAAGGTGG - Intergenic
936528420 2:113258165-113258187 GCCCCAAGAAAATGAAAAGCTGG - Intronic
937187089 2:120054342-120054364 CTATCAAGAAAGTGAAAAGTAGG - Intronic
937261004 2:120586844-120586866 GCAACAGGAAAGAGTCAAGCGGG + Intergenic
938015323 2:127862498-127862520 GCCTCATGAAAGTGTGTAGCAGG - Exonic
938594747 2:132776598-132776620 GCAGCAAGAAAATGGAAAGTGGG + Intronic
939304188 2:140388552-140388574 GCATGAAGAAAGAGTAATGCAGG + Intronic
939940585 2:148345918-148345940 GCTTCCAGCAAATGTAAAGCAGG - Intronic
940971213 2:159898995-159899017 GCATCAAGCCAGTGTATGGCTGG - Exonic
941038753 2:160597188-160597210 ACATCAAGAAAATATAATGCAGG + Intergenic
945103327 2:206283961-206283983 GCATCATGAAAGTAAAAAGAAGG - Intronic
945136992 2:206639989-206640011 TCATCAACAAAAAGTAAAGCAGG - Intergenic
945569896 2:211453416-211453438 ACATCAAAAAAATTTAAAGCGGG - Intronic
946316104 2:218913902-218913924 CCATCAAGAAAGTGAAAACAGGG - Intergenic
948670491 2:239565399-239565421 GCATAAAGAAGGTGTGAAGGAGG + Intergenic
948670573 2:239566152-239566174 GCATAAAGAATGTGTGAAGGAGG + Intergenic
1169941593 20:10943700-10943722 GCATCAAGAAACTAAAAACCTGG - Intergenic
1171337991 20:24404234-24404256 TAATCAAGACAGTGTGAAGCTGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173951661 20:46998245-46998267 ACATCAAGAAAATGTGATGCGGG + Intronic
1176263055 20:64193246-64193268 AGATCAAGAGAGTGGAAAGCAGG + Intronic
1180989403 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG + Intronic
1181688206 22:24543552-24543574 GCAGCATGAAAGGGTAAGGCAGG + Intronic
1182247730 22:28973278-28973300 CCATCAAGAAAGTGTAAAAAAGG - Intronic
1184833969 22:47009746-47009768 CCATCAACAAACTGTACAGCAGG + Intronic
949130088 3:489377-489399 GAATCATGAAAGTGTGAAGATGG + Intergenic
953362806 3:42313639-42313661 ACATCAAGAAATTGTTATGCAGG + Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
954465497 3:50652219-50652241 CCATAAAGAAAGTTTCAAGCAGG - Intergenic
954703415 3:52464966-52464988 CCATCAAGAAAATGAAAAGATGG - Intronic
956307180 3:67838161-67838183 GCTTCCAGCAAATGTAAAGCAGG + Intergenic
957987884 3:87594715-87594737 GCATCAGTAAAGTGTATAGTTGG - Intergenic
958509020 3:95021690-95021712 GGATCAACAAAGTGAAAAGTTGG - Intergenic
958923349 3:100130825-100130847 GCATCAAGAAAGTGTATGGTTGG + Intronic
963329452 3:143897924-143897946 GCATTAAGAAAGAGCAAGGCAGG - Intergenic
964595834 3:158426856-158426878 TCATCAAAAAAGCTTAAAGCCGG - Intronic
970260423 4:14218613-14218635 TCATCAAGACAGTGTAACTCTGG + Intergenic
970814241 4:20135154-20135176 CAATCAAGAAAGTGTAGTGCTGG + Intergenic
972185782 4:36526304-36526326 GGATCAACAAAGTGAAAAGTTGG - Intergenic
972560347 4:40221998-40222020 GCTTAAAGAAATTGTATAGCTGG - Intronic
974975959 4:68891714-68891736 GTATAAAGAAAGTATAAAGAAGG - Intergenic
976760968 4:88548960-88548982 CCATTAAGAAAGTGAAAAGATGG - Intronic
977754034 4:100644563-100644585 ACATGAAGAAAATGTAAAGAAGG + Intronic
978572954 4:110159143-110159165 GCATGAAGATAGTGTCATGCTGG + Intronic
980820596 4:138011035-138011057 GCATCCATCAAGTGGAAAGCTGG + Intergenic
986362354 5:6992595-6992617 GAAGCAGGAAAATGTAAAGCAGG - Intergenic
988870017 5:35378975-35378997 GCAACAGGAGAGTGCAAAGCTGG + Intergenic
989732218 5:44662798-44662820 GCATAAAGAAGGTGGAAAACTGG - Intergenic
992416216 5:76554358-76554380 CCATTAAGAAAGTGAAAAGACGG + Intronic
993379778 5:87193219-87193241 GCATAAATAAAGTGTATATCAGG + Intergenic
993634624 5:90328568-90328590 GCATCAATAAAATGAAAAGTTGG - Intergenic
995537955 5:113156358-113156380 GCATCCAGAAAGTGACTAGCAGG + Intronic
995570411 5:113474298-113474320 GCATCAGGAAAGTGTCCAGAGGG + Intronic
996575385 5:124972415-124972437 GCATCTAGAAAGAGGGAAGCAGG - Intergenic
997867768 5:137479882-137479904 GCATCAAGAAATTATATAGTAGG + Intronic
998520703 5:142797997-142798019 ACATCAAGAAAGAGAAAGGCTGG - Intronic
999168490 5:149572065-149572087 TAATCAAGAAAGTGTAATACTGG + Intronic
1000741136 5:164971797-164971819 GCATTACCAAACTGTAAAGCAGG + Intergenic
1001440125 5:171736416-171736438 TCATTAAGAAAGTACAAAGCTGG + Intergenic
1003166748 6:3686150-3686172 GAACAATGAAAGTGTAAAGCAGG - Intergenic
1004654958 6:17650659-17650681 GCATGAAGAACTTGTAGAGCAGG - Intronic
1005719914 6:28590934-28590956 ACATCAACAAAGTGGAAAGAAGG - Intronic
1007849140 6:44787503-44787525 GAATCAACAAAGTCAAAAGCGGG - Intergenic
1009780803 6:68267103-68267125 CCATCAACAAAATGAAAAGCTGG + Intergenic
1011715527 6:90101190-90101212 CCATTAAGAAAGTGAAAAGATGG - Intronic
1012610028 6:101206016-101206038 TCATCATGACAGTTTAAAGCTGG + Intergenic
1013152769 6:107462035-107462057 GCATAAAGAAAGAATACAGCAGG + Intergenic
1014117298 6:117679846-117679868 GCATCAAGAAAGTGGAGAAATGG + Intronic
1016155221 6:140798101-140798123 GCATCAAAAAATTGGAAAGGGGG - Intergenic
1017827398 6:158092172-158092194 TGACCAAGAAAGTGTTAAGCCGG - Intronic
1022045748 7:26620938-26620960 GCATCGAGAAAGTGTAGCTCTGG - Intergenic
1027795070 7:82682425-82682447 CCATCAAGAGAATTTAAAGCTGG + Intergenic
1027835843 7:83240808-83240830 GCATCCAACAAGTTTAAAGCAGG - Intergenic
1028238191 7:88385655-88385677 GCTTCAAGCAAATGTAAAGTAGG + Intergenic
1029067063 7:97860803-97860825 CCATCAAGAAAGTGAAAAGACGG - Intronic
1031658316 7:124387107-124387129 GCGACAAGAAAGGGAAAAGCAGG - Intergenic
1032208772 7:129892550-129892572 GCATCAAGAAAGGGTGTAGTTGG - Intronic
1036463007 8:8970910-8970932 GAAACAAAAAAGTCTAAAGCTGG + Intergenic
1037306179 8:17506256-17506278 GTTTCAAGAGAGTTTAAAGCAGG - Intronic
1038208118 8:25488529-25488551 CTATAAAGAAAGTGTAAAGTAGG - Intronic
1039083603 8:33758134-33758156 TCATCAAGAAAGTGTAGATTTGG - Intergenic
1042000320 8:64115658-64115680 GGATCAACAAAATGAAAAGCTGG + Intergenic
1042952407 8:74214807-74214829 CCATCAAGAAAGTGAATAGATGG - Intergenic
1042977560 8:74486846-74486868 ACATCAAGAAAGTGCAATGAAGG - Intronic
1043675350 8:82945395-82945417 GCATCAAGAAAGTGTGGTGTTGG + Intergenic
1045119921 8:99025952-99025974 GGATCAACAAAATGAAAAGCTGG - Intronic
1045593601 8:103627702-103627724 TCATCAAGAAAGTAAAAAGAGGG + Intronic
1048686927 8:136915101-136915123 GCTTAATGAAACTGTAAAGCAGG + Intergenic
1049811839 8:144578905-144578927 CCATCAAGAAAGTGAAAAAAGGG + Intronic
1053439272 9:38102737-38102759 CTATCAAGAAAATGAAAAGCTGG + Intergenic
1053599544 9:39596420-39596442 GCATTAATAAAGTGTTAAGAAGG + Intergenic
1053857247 9:42350605-42350627 GCATTAATAAAGTGTTAAGAAGG + Intergenic
1054253983 9:62745966-62745988 GCATTAATAAAGTGTTAAGAAGG - Intergenic
1054568042 9:66780130-66780152 GCATTAATAAAGTGTTAAGAAGG - Intergenic
1055339781 9:75268914-75268936 GCATCATGAGAGTGTATTGCAGG - Intergenic
1058839431 9:108891907-108891929 GCAGCAGGAATGTGTATAGCAGG + Intronic
1187924849 X:24240261-24240283 TTATCAAGAAAGTGAAAAGATGG + Intergenic
1188981390 X:36730279-36730301 GCATCAACAGAGAGTGAAGCTGG - Intergenic
1188998815 X:36920094-36920116 AGATCAAGAAAATGAAAAGCTGG - Intergenic
1190500208 X:51068280-51068302 GCATCAAAAAATGGTAAAGTAGG + Intergenic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1191911031 X:66150158-66150180 GCATCAAGGAATAGTAATGCTGG - Intergenic
1191935691 X:66424790-66424812 GCATTAAACAAGTGTAAATCTGG - Intergenic
1195669116 X:107454247-107454269 CAATAAAGAAAGTGGAAAGCAGG - Intergenic
1195918938 X:109963383-109963405 GAATCAAGAGAGTCTACAGCTGG + Intergenic
1196121499 X:112056000-112056022 GCATCAAGATAGGGTGAAGTAGG + Intronic
1197570286 X:128142135-128142157 GCATCAAGAAAATCTAGAGAAGG - Intergenic
1198303653 X:135357083-135357105 CTATCAAGAAAGTGAAAAGATGG - Intronic
1200183676 X:154167763-154167785 GCATCAAGTAAGTGGAGACCAGG + Intergenic
1200189330 X:154204891-154204913 GCATCAAGTAAGTGGAGACCAGG + Intergenic
1200195085 X:154242700-154242722 GCATCAAGTAAGTGGAGACCAGG + Intergenic
1200200735 X:154279821-154279843 GCATCAAGTAAGTGGAGACCAGG + Intronic
1201320265 Y:12690908-12690930 GGAGCAAGAAAGAGTGAAGCGGG + Intergenic