ID: 905196958

View in Genome Browser
Species Human (GRCh38)
Location 1:36287194-36287216
Sequence CCATATGTGGAGCCAGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905196958_905196963 -6 Left 905196958 1:36287194-36287216 CCATCCACTGGCTCCACATATGG 0: 1
1: 0
2: 1
3: 14
4: 129
Right 905196963 1:36287211-36287233 ATATGGCTCATCTCAGAAGGAGG 0: 1
1: 2
2: 0
3: 10
4: 127
905196958_905196965 13 Left 905196958 1:36287194-36287216 CCATCCACTGGCTCCACATATGG 0: 1
1: 0
2: 1
3: 14
4: 129
Right 905196965 1:36287230-36287252 GAGGAGAGTGCTGCTTCAGGAGG 0: 1
1: 1
2: 3
3: 24
4: 215
905196958_905196962 -9 Left 905196958 1:36287194-36287216 CCATCCACTGGCTCCACATATGG 0: 1
1: 0
2: 1
3: 14
4: 129
Right 905196962 1:36287208-36287230 CACATATGGCTCATCTCAGAAGG 0: 1
1: 1
2: 0
3: 9
4: 127
905196958_905196964 10 Left 905196958 1:36287194-36287216 CCATCCACTGGCTCCACATATGG 0: 1
1: 0
2: 1
3: 14
4: 129
Right 905196964 1:36287227-36287249 AAGGAGGAGAGTGCTGCTTCAGG 0: 1
1: 1
2: 1
3: 30
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905196958 Original CRISPR CCATATGTGGAGCCAGTGGA TGG (reversed) Exonic
901095389 1:6674899-6674921 CCATATGGGTAGTCAGTGAAGGG - Intronic
905196958 1:36287194-36287216 CCATATGTGGAGCCAGTGGATGG - Exonic
905771065 1:40638334-40638356 ACATGTATGAAGCCAGTGGAGGG - Intronic
905771070 1:40638366-40638388 TCATGTATGAAGCCAGTGGAGGG - Intronic
916913795 1:169384022-169384044 CCATCTGTGGAACAAGTAGATGG - Intronic
918689640 1:187465255-187465277 CCAAATGTGGTGGTAGTGGAAGG + Intergenic
919411237 1:197245918-197245940 CCAACTGTGGTGGCAGTGGAAGG - Intergenic
919801316 1:201356310-201356332 CCATAAGTGGAGCCTGGGAAGGG - Intergenic
923681724 1:236123991-236124013 CCATGTGAGGACCCAGGGGAGGG + Intergenic
923702504 1:236313435-236313457 CCATGTGTGGTACCAGTGCATGG + Intergenic
1063771810 10:9212278-9212300 CGGTATGTGGAGTCAATGGATGG - Intergenic
1064635190 10:17358150-17358172 CCATGTGTCTACCCAGTGGAGGG + Intronic
1064769814 10:18711729-18711751 GCCTATGAGGAACCAGTGGAGGG - Intergenic
1068884092 10:62080578-62080600 CCAAATATGGAGCCAATAGAAGG - Intronic
1071109668 10:82141046-82141068 ACATATGGGGAACCAGTTGAAGG + Intronic
1073379293 10:103065949-103065971 CCATCTGTGGGGCCATGGGAAGG - Intronic
1074251907 10:111759399-111759421 TATAATGTGGAGCCAGTGGAGGG - Intergenic
1074336397 10:112580697-112580719 CCAGATGGGGAGGCAGTGAAAGG + Intronic
1080555932 11:33417545-33417567 CCAGATGCAGAGACAGTGGATGG - Intergenic
1081587787 11:44399026-44399048 TCATATGTGAAGCCACTGAATGG + Intergenic
1082861661 11:57862853-57862875 TCAGATGTGGAGACACTGGATGG + Intergenic
1083265432 11:61544692-61544714 CCAGGCCTGGAGCCAGTGGATGG + Intronic
1083668633 11:64288485-64288507 TCTTCTGTGGGGCCAGTGGAGGG + Intronic
1085313329 11:75528952-75528974 GCATATATGGACGCAGTGGAAGG - Intergenic
1085807619 11:79650770-79650792 AGGTATGTGGAGTCAGTGGATGG - Intergenic
1091629179 12:2146512-2146534 CCTCCTGTGGCGCCAGTGGAGGG - Intronic
1093318053 12:17675922-17675944 TCATCTGTGGGGCCAGTGCAAGG - Intergenic
1093981450 12:25479667-25479689 CCATCTGTGGACTCATTGGAAGG - Intronic
1094130071 12:27065043-27065065 CCATATATGAAGCCAGTGGTAGG + Intronic
1094179527 12:27577041-27577063 CCATATATGAAGCCAGTGGTAGG + Intronic
1096843123 12:54391082-54391104 CCAGATGTGGAGCCAGATGAAGG + Intronic
1097991615 12:65840981-65841003 CCAGATGTGGAGCCATAGGAAGG - Intronic
1103259604 12:119575215-119575237 CCAAATGAGAAGCCAGGGGACGG + Intergenic
1104672503 12:130690288-130690310 CAATCTCTGGAGCCTGTGGATGG - Intronic
1105385112 13:19922542-19922564 CCATATGAAAAGCCAGTGGTTGG + Intergenic
1105683775 13:22756634-22756656 CCATATCTTGACCCACTGGAAGG - Intergenic
1106168906 13:27271863-27271885 CCACAGGTGGGGCCAGTGGTTGG + Intronic
1106522962 13:30514062-30514084 CCATATGAAGAGAGAGTGGATGG - Intronic
1108268986 13:48739990-48740012 GCATATGTGCAGTCTGTGGAAGG + Intergenic
1110641283 13:77827694-77827716 CCATATGCTGAGTTAGTGGATGG + Intergenic
1113531882 13:111033080-111033102 CCATCCCTGGAGCCCGTGGAGGG + Intergenic
1121270197 14:92632705-92632727 CCATATGTGGAGGGAGCGGCTGG - Intronic
1121303451 14:92890089-92890111 CCAGAGCTGGAGGCAGTGGAGGG - Intergenic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1128687698 15:69699147-69699169 CCATGGTTGGAGCCAGTGGGAGG - Intergenic
1129981771 15:79878710-79878732 CCCTATGTGGAGGGAGTGGTGGG + Intronic
1132421049 15:101669103-101669125 CCATATCTTGTCCCAGTGGAAGG - Intronic
1137586016 16:49664428-49664450 CCAGATGTTGACCCAGTTGAGGG + Intronic
1144087328 17:11822517-11822539 CCACTCGTGGAACCAGTGGATGG - Exonic
1146095461 17:29926174-29926196 CCATGAGTGGAGCCAGTGAGAGG - Intronic
1151246402 17:72798348-72798370 CCATGTGAGGACACAGTGGAAGG - Intronic
1151331436 17:73411516-73411538 CCACATCTGGAGGGAGTGGACGG + Intronic
1152052412 17:77991346-77991368 CCATCTCTGGAACCAGTGGATGG - Intergenic
1156500943 18:37557931-37557953 CCAAATGTGGAACAAGTAGAAGG + Intronic
1157843403 18:50980186-50980208 CCAGATGTGGTCCCAGTGGGAGG + Intronic
1159056934 18:63475575-63475597 GCATCAGTGGAGCAAGTGGAGGG - Intergenic
1167349007 19:48963467-48963489 CCATAGGTGGAGGGAGAGGAGGG - Intergenic
1168577964 19:57528699-57528721 CTCTATGTGGAGCCAGAGAAAGG + Intronic
926041278 2:9675245-9675267 CTATTTGAGGAGCCAGTGAAGGG + Intergenic
926650845 2:15343209-15343231 GCATACATGGAGCCAGTGAAGGG - Intronic
927731291 2:25474451-25474473 CCATATGTGGACTCAGTGCATGG - Intronic
936957621 2:118039180-118039202 TAATATGAGGAGTCAGTGGAAGG + Intergenic
937865456 2:126748255-126748277 CCATCTCTGGAGCCAGCAGACGG + Intergenic
939290149 2:140183290-140183312 TCCAATGTGGAGCCAGGGGAAGG - Intergenic
939478683 2:142719597-142719619 CCATATGAGGAGCAAGTCAAAGG - Intergenic
943590043 2:189785489-189785511 CCATATGTGTACCAAATGGAAGG - Intronic
947533879 2:230928935-230928957 CCAGATGGGGAGCCATAGGATGG - Intronic
1169701662 20:8454016-8454038 CCATGTGAGGAGACAGGGGAAGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170794364 20:19533515-19533537 ACCTATGTGGAGCCAGGTGAAGG + Intronic
1176670302 21:9727819-9727841 GCACATGTGGAGGCAGTGGGGGG + Intergenic
1179264271 21:39788801-39788823 CCATATGTGCACCAAGGGGAGGG + Intronic
1179951094 21:44709138-44709160 CCATCTGAGGACCCAGTGGGCGG - Intronic
1182258405 22:29054581-29054603 CCATTTCTGCAGCCAGTGGCAGG - Exonic
1183097484 22:35561911-35561933 CCATGTGCGAAGCCGGTGGATGG + Intergenic
1184420173 22:44376305-44376327 CCATATGAAGAGCCAGAGAAAGG + Intergenic
1184466416 22:44671013-44671035 CCATCTGTGGGGCCTGGGGAAGG - Intronic
949907161 3:8867295-8867317 CTATAACTAGAGCCAGTGGATGG - Intronic
950017731 3:9766022-9766044 CCATCTCTGGAGCCAGGGGATGG - Exonic
952233269 3:31453782-31453804 ACATATGTGGAGCCAATGGATGG - Intergenic
952526726 3:34218404-34218426 CAATATGAGAAGCCACTGGAGGG - Intergenic
956598002 3:70989419-70989441 CCATATTAGGAGCCACTTGATGG + Intronic
956620612 3:71217990-71218012 GCAGAGGTGGAGCCAGGGGAGGG - Intronic
958168040 3:89902459-89902481 CCATATGTTGTCCCACTGGAAGG + Intergenic
960330351 3:116352073-116352095 CCGTATGTACAGGCAGTGGAAGG + Intronic
961055157 3:123781332-123781354 CCATTTGTCCAGCCACTGGAGGG - Intronic
961517697 3:127448504-127448526 CCATACGTGGACCCAGGGGGCGG + Intergenic
962327714 3:134449676-134449698 CCATGTTGGCAGCCAGTGGAAGG + Intergenic
964724960 3:159805066-159805088 CCGTAAGTGGAGCCAGGGGATGG + Intronic
970974799 4:22031476-22031498 CCATATGTGCAGCCAAGAGAAGG + Intergenic
974195127 4:58564365-58564387 CCATATCTTGACCCACTGGAGGG + Intergenic
975976007 4:80097537-80097559 AGATATGTGGAACCAGTGGAGGG + Intronic
976194633 4:82521021-82521043 CCATATGTGTGGCCTGTGCAGGG - Intronic
977406644 4:96608229-96608251 CCATGTGTGTGGCCAGAGGAAGG - Intergenic
981047787 4:140281451-140281473 CCATATGTGGAGCCTTGGGATGG - Intronic
981603539 4:146519015-146519037 CCATATATCGAACAAGTGGAGGG - Intronic
984821357 4:183885517-183885539 CCATCTGTGGAGGCTGTGCAGGG + Intronic
985404476 4:189623715-189623737 GCACATGTGGAGGCAGTGGGGGG - Intergenic
987968483 5:24909235-24909257 CCATATGAGGACACAGTGAAAGG - Intergenic
990108875 5:52298101-52298123 CCATATGTTGTCCCACTGGAAGG + Intergenic
997200395 5:132006499-132006521 CAATCTGTGGACCCAGTGGATGG + Intronic
997439050 5:133896416-133896438 CCCTATGTGAAGCCAGTGGCTGG + Intergenic
997776027 5:136606371-136606393 CCATGTTTGGAGTCAGTGGGAGG - Intergenic
998018660 5:138752733-138752755 CCATCTGTGGAGTGAGGGGACGG + Intronic
1000360267 5:160440648-160440670 CCCCCTGTGGAGACAGTGGATGG + Intergenic
1001932396 5:175682715-175682737 CCCTCTCTGGAGTCAGTGGAGGG - Exonic
1006519959 6:34565520-34565542 CCACATGTGGATCCTGGGGAGGG - Intergenic
1007905248 6:45453352-45453374 ACCTATGTGGGGACAGTGGAGGG + Intronic
1010256349 6:73762388-73762410 ACATATGGGAAGCCAGTGAAAGG + Exonic
1011841063 6:91499552-91499574 CCATATGAGGACACAGTGTAAGG - Intergenic
1013806249 6:113998945-113998967 CCATCTGTCAAGCCTGTGGAAGG + Intronic
1015327593 6:131941079-131941101 CCAGATGTGGAGCGGGTGGTGGG + Intergenic
1015917004 6:138227708-138227730 CCATCCGTGGAGCCTGTGAAAGG - Intronic
1017647630 6:156553643-156553665 ACACATGTGGTGCCTGTGGAGGG - Intergenic
1017787673 6:157769750-157769772 CCATGTGGAGAGGCAGTGGAAGG + Intronic
1018697358 6:166400843-166400865 CTGTATGAGGAGCCAGTGGCAGG + Intergenic
1019530900 7:1502900-1502922 CCATCTGTGGTGCCAATTGAAGG - Exonic
1023366146 7:39465337-39465359 CCATGGGTGGAGACAGTAGATGG - Intronic
1024000989 7:45189305-45189327 CCATGGGTGGGGACAGTGGAGGG + Intergenic
1024514050 7:50228852-50228874 CCATGTCTGGAGCCAATGGGAGG - Intergenic
1029223429 7:99008209-99008231 CCATCTGTTGAGCAAATGGATGG + Intronic
1031347821 7:120691186-120691208 CCAGATTGGAAGCCAGTGGAAGG + Intronic
1032700407 7:134373951-134373973 CCTTGTTTGGAGCCAGGGGAAGG + Intergenic
1034139185 7:148800529-148800551 GAATATTTGGAGCGAGTGGATGG + Exonic
1034981770 7:155483704-155483726 CTCTATGAGGAGGCAGTGGAGGG - Intronic
1038000796 8:23389846-23389868 CAAGATGTGGAGCCAGTGCTGGG - Intronic
1038039870 8:23715447-23715469 CCACATATACAGCCAGTGGAGGG - Intergenic
1038721198 8:30037085-30037107 CTGTATGTGGAGTCAGGGGAGGG - Intergenic
1039195731 8:35029309-35029331 CCATTTGTGGACCCAGTGCAGGG + Intergenic
1039748672 8:40456672-40456694 GCTTATGCGGAGCCCGTGGAGGG - Intergenic
1042405692 8:68403186-68403208 CCATAGGGGAGGCCAGTGGAAGG + Intronic
1048441462 8:134462529-134462551 CCAGCTGGGGAGCCAGAGGAAGG - Intergenic
1050648918 9:7754262-7754284 CCAGATGTGGAGAGAGTGAAGGG - Intergenic
1055179790 9:73371260-73371282 CCATATCTTGACCCACTGGAAGG - Intergenic
1056812978 9:89778538-89778560 TCATGAGTGAAGCCAGTGGAGGG - Intergenic
1058006550 9:99922287-99922309 CCATATTTGGTGAGAGTGGAGGG + Intronic
1058642432 9:107100524-107100546 CCACAGGAGCAGCCAGTGGAAGG - Intergenic
1060198707 9:121639567-121639589 CCACATGGGGAGCCTGCGGAGGG + Intronic
1060220234 9:121760640-121760662 GCCTGTGTGGAGCCAGTGGATGG + Intronic
1062549702 9:137080379-137080401 CCATGGGTGGGGGCAGTGGAAGG - Intronic
1186220086 X:7341383-7341405 CCAGGCATGGAGCCAGTGGAAGG - Intronic
1188792979 X:34426497-34426519 CCACAGGCTGAGCCAGTGGAAGG + Intergenic
1192103264 X:68288380-68288402 CCATTTGTGGGGCCAGTTGGAGG - Intronic
1198603757 X:138314005-138314027 CCAAATGGGGAGCCATGGGAGGG - Intergenic
1201322663 Y:12717340-12717362 CCATGGATGGAGCCAGTTGAGGG - Intronic