ID: 905200751

View in Genome Browser
Species Human (GRCh38)
Location 1:36314935-36314957
Sequence ATCCATGTGGACCAAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905200746_905200751 -8 Left 905200746 1:36314920-36314942 CCTACCCTGCAGAACATCCATGT 0: 1
1: 0
2: 6
3: 25
4: 174
Right 905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
905200745_905200751 -7 Left 905200745 1:36314919-36314941 CCCTACCCTGCAGAACATCCATG 0: 1
1: 0
2: 0
3: 23
4: 152
Right 905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
905200744_905200751 5 Left 905200744 1:36314907-36314929 CCTCACAGTTTGCCCTACCCTGC 0: 1
1: 0
2: 1
3: 9
4: 225
Right 905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 142
905200743_905200751 22 Left 905200743 1:36314890-36314912 CCAGTTAAGCTGCTGATCCTCAC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905200751 Original CRISPR ATCCATGTGGACCAAGCTGA GGG Intronic
902030667 1:13419831-13419853 ATTCATGTTCACCAAGCTGTGGG - Intronic
902371871 1:16012670-16012692 ATCCAGGTTGACCCAGCAGATGG + Intergenic
904987677 1:34565282-34565304 AACCCTGTGGGCCAAGCTGGTGG - Intergenic
905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG + Intronic
905450085 1:38050750-38050772 AACCATGTGGACCAAACTCTGGG - Intergenic
907045992 1:51300331-51300353 CTGCCTGGGGACCAAGCTGAAGG - Intronic
907957003 1:59238791-59238813 ATCCGTCTGGTCCAGGCTGAAGG + Intergenic
913442439 1:118912426-118912448 ATCCATGTACTTCAAGCTGAAGG + Intronic
914322378 1:146577620-146577642 ATCCATGCTGACCACTCTGAGGG - Intergenic
923203429 1:231734142-231734164 ATATATGTGGTCCAAGCTTATGG - Intronic
1063351420 10:5359559-5359581 ATCCAAGAGGACCCAGCTGTTGG + Intergenic
1063877384 10:10494167-10494189 AACCATGTAGACCACGCTGCAGG + Intergenic
1073767869 10:106703301-106703323 ATCGATGTGGACCAGGATGCAGG - Intronic
1073919200 10:108439663-108439685 ATCACTATGGAACAAGCTGAAGG - Intergenic
1074277024 10:112012905-112012927 ATCCAGGTGGCTCAAGCTGGTGG - Intergenic
1075062009 10:119263478-119263500 ATCCCTGTTTGCCAAGCTGATGG - Intronic
1075646352 10:124099378-124099400 AGCCATGTGGATGGAGCTGATGG - Intergenic
1076132057 10:128019961-128019983 ACACATGTCGACCAACCTGAGGG - Intronic
1076269251 10:129136456-129136478 AGCCATGTGGACGTGGCTGATGG - Intergenic
1076335201 10:129702254-129702276 AGCCATGTGGACCTGGCTCAAGG - Intronic
1076582316 10:131520066-131520088 AGCCACGTGGCCCAAGCTCAGGG - Intergenic
1077084766 11:743808-743830 ATCCATGTGGACAGATCTCATGG + Intergenic
1080273066 11:30471271-30471293 AGCAATGTGGACTAAGATGAAGG - Intronic
1087146900 11:94821689-94821711 AGGCATCTGGACCAAGCTGCTGG - Exonic
1089017558 11:115179005-115179027 ATGCATGTGGAACAAGCTTAGGG + Intronic
1089293073 11:117450103-117450125 CTCCACATGGAGCAAGCTGAGGG - Intronic
1090907501 11:131089750-131089772 ATCCATGTGTTCCTTGCTGAAGG - Intergenic
1095142143 12:38677264-38677286 ATCCAGGGGGATCAAGCTAAGGG - Intronic
1099091496 12:78315989-78316011 ATGCATGTGGCCAAAACTGATGG + Intergenic
1099900404 12:88703972-88703994 AGCAATGTGGGCAAAGCTGAAGG - Intergenic
1101008341 12:100424681-100424703 AACCACGTGGGCCAAACTGAAGG + Intergenic
1103884513 12:124190671-124190693 ATCCATGTCGAAAAGGCTGATGG - Intronic
1105977407 13:25484270-25484292 ATACATGTGGACCAAGTTTAAGG - Intronic
1109843660 13:67954103-67954125 ATGAATGTGGAAGAAGCTGAAGG - Intergenic
1116646447 14:47534905-47534927 ATCCGTTTGGACACAGCTGAAGG + Intronic
1116826361 14:49677073-49677095 AGCCATGTGGACCTAGTGGAGGG + Intronic
1117234714 14:53759769-53759791 ATCCATGAGGACATAGTTGATGG - Intergenic
1118711178 14:68520928-68520950 GTCCATGGAGACCAGGCTGATGG + Intronic
1119696795 14:76719730-76719752 AGCCATGTGGACAAGACTGAGGG + Intergenic
1123137199 14:106038932-106038954 AGCCATGTGGAAGAGGCTGAAGG - Intergenic
1124917222 15:33987642-33987664 ATGCAGGTGGACCAAGCAGCTGG - Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1130272951 15:82461802-82461824 ATCCATGTGGACATATTTGAGGG + Intergenic
1130465300 15:84189155-84189177 ATCCATGTGGACATATTTGAGGG + Intergenic
1130487388 15:84405647-84405669 ATCCATGTGGACATATTTGAGGG - Intergenic
1130498966 15:84484381-84484403 ATCCATGTGGACATATTTGAGGG - Intergenic
1130587592 15:85193768-85193790 ATCCATGTGGACATATTTGAGGG + Intergenic
1130732756 15:86516216-86516238 TTCCTTGTGGACAAAGATGACGG - Intronic
1130906625 15:88245143-88245165 TAGCATGTGGACAAAGCTGACGG - Intronic
1131598130 15:93820056-93820078 TTCCATATGCACCAAGGTGATGG + Intergenic
1132365813 15:101255886-101255908 AACCATGTGGACCAGCCAGATGG + Intergenic
1134403132 16:13930248-13930270 ATCCAAATGGACCAAGCAGAGGG - Intronic
1138621464 16:58214599-58214621 TTCCATGTTGCCCAAGCTGAAGG - Intergenic
1139412089 16:66771047-66771069 TGCCATGTTGCCCAAGCTGAAGG + Intronic
1140011245 16:71133549-71133571 ATCCATGCTGACCACTCTGAGGG + Intronic
1140358225 16:74323769-74323791 ATCCAGTTGGCCCAATCTGAAGG + Intergenic
1141691701 16:85600349-85600371 TTCCATGTGGGCCAAGGGGAGGG + Intergenic
1143406708 17:6682522-6682544 CTCCATCTGGCCCAAGCAGAGGG + Intergenic
1143575689 17:7791911-7791933 ATCCAGGTGAACCCAGCTGACGG + Exonic
1147734283 17:42625100-42625122 ATCCTTGGGGCCCAGGCTGATGG - Intergenic
1151067821 17:71172044-71172066 ATCCATGTGAAACAAGCTGGTGG + Intergenic
1157089134 18:44614593-44614615 ATCCATGTTGACTGGGCTGAGGG + Intergenic
1158220191 18:55142389-55142411 ATCCATGTGGTCTCACCTGAAGG - Intergenic
1162030274 19:7914297-7914319 ATCCCTCTGGACCAGGCAGAGGG + Exonic
1162166408 19:8756767-8756789 ATTCACGTGGACAAGGCTGAGGG - Intergenic
1164159770 19:22618550-22618572 AGCCATGTGGACCAAAATGCAGG - Intergenic
1165080594 19:33303783-33303805 CTCCATCTGGGCCCAGCTGACGG - Intergenic
1165984345 19:39754491-39754513 AGCAATGTGGATGAAGCTGAAGG + Intergenic
1166548478 19:43649046-43649068 ATCAATGTGGTTCATGCTGAAGG + Exonic
1167510371 19:49892670-49892692 AGCCAGGTGGACCAAGAAGAAGG - Intronic
932172628 2:69571312-69571334 AACCATGTAGACTAGGCTGATGG + Intronic
933474055 2:82766373-82766395 ATCCATGAGGACAAGACTGAAGG - Intergenic
933957868 2:87386282-87386304 AGCCACGTGGACACAGCTGAAGG + Intergenic
936082012 2:109438688-109438710 ATCCACGTAAACCATGCTGAAGG - Intronic
942370567 2:175279864-175279886 AGCCATGTTGCCCAAGCTGGTGG - Intergenic
943091555 2:183381568-183381590 ATCTAAGGGGACCATGCTGAAGG + Intergenic
946326455 2:218986915-218986937 TTCCCTGTGGACCAAACTCAGGG + Intergenic
948305816 2:236945987-236946009 ATCCATGTGGACCGAAGTGCAGG + Intergenic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1175090088 20:56495515-56495537 ATCCAGGTGGACCAAGGTTGGGG + Intronic
1175453484 20:59091310-59091332 ATGCATGTGGAACAATTTGATGG - Intergenic
1177409117 21:20707010-20707032 ATCCATGTTGTCTCAGCTGACGG - Intergenic
1178610562 21:34074971-34074993 ATCCATGAAGAACAAGCTGGGGG - Intronic
1180918385 22:19505484-19505506 ATCCTTGTGGCCCAGCCTGAGGG + Intronic
1182052000 22:27320071-27320093 ATCCATGTGCATGGAGCTGAGGG - Intergenic
1184117305 22:42429740-42429762 ACCCCTGTGGACACAGCTGAGGG + Intronic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
1185042233 22:48510990-48511012 ATCCATGTGGGCCAGGCACATGG - Intronic
950149531 3:10675918-10675940 TTCCCTGATGACCAAGCTGAGGG + Intronic
950355725 3:12407110-12407132 ATCCAGGTCATCCAAGCTGATGG - Intronic
950559402 3:13713161-13713183 AACCATGTGGAGAAAACTGATGG + Intergenic
953744074 3:45559930-45559952 ATTCATCTGGGCCAATCTGAAGG - Intronic
955767485 3:62360068-62360090 ATCCAAGTGGATTAATCTGAGGG + Intergenic
955794126 3:62617953-62617975 AACCATGTGTACCAAGTTCAAGG - Intronic
957833322 3:85551912-85551934 ATTCATTTGGACAAAGGTGATGG + Intronic
957835999 3:85590087-85590109 ATCCATGACCAGCAAGCTGATGG - Intronic
961586640 3:127933632-127933654 ATCCAAGAGGACCAGGCAGAAGG + Intronic
961671440 3:128534546-128534568 ATCCAGGTGGCCAAGGCTGAGGG + Intergenic
962521540 3:136201661-136201683 AACCATGTGGCCTAAGCTAAAGG + Intergenic
964474305 3:157084758-157084780 ATCCTTAGGGACAAAGCTGAAGG - Intergenic
964871533 3:161318714-161318736 ATGGATGTGGACCAAGATGGTGG + Intergenic
968442587 4:631666-631688 ATCCATGTGGCTCCATCTGAGGG + Intronic
969606965 4:8206606-8206628 ATCTCTGTGGACCGAGCGGAGGG + Intronic
971898387 4:32625853-32625875 ATCCATGTGGAGGAAGGGGAGGG + Intergenic
976815875 4:89148334-89148356 ATCCATGGGGCCCAGGCTGCTGG + Intergenic
981322002 4:143402817-143402839 ATCCCTGTGCTCCAAACTGAAGG + Intronic
982027309 4:151263685-151263707 ATTCATGTGGGCCTCGCTGAAGG + Intronic
982534729 4:156596139-156596161 ATCCACAAGGACCAAGCTCAGGG + Intergenic
985970844 5:3377372-3377394 ATAAATGTGGCCCACGCTGATGG + Intergenic
986787647 5:11129578-11129600 AGCAGTCTGGACCAAGCTGATGG - Intronic
987526556 5:19057794-19057816 ATGCCTGAGGACCAAACTGAAGG - Intergenic
987670721 5:21003870-21003892 ACCCATGAGGGCCAAGCAGAAGG - Intergenic
988781837 5:34529523-34529545 ATCCATGAGGAGCAAGGGGAGGG - Intergenic
994305955 5:98204317-98204339 AGCAATGTGGATAAAGCTGAAGG + Intergenic
994332992 5:98529472-98529494 GTGCATGTGGCCCAAGCTGAAGG + Intergenic
1005440750 6:25865250-25865272 ATCCACGTGCACCCAGCTGTAGG + Intronic
1007745503 6:44040754-44040776 AACCCTGTGTACCCAGCTGAGGG - Intergenic
1007751021 6:44072158-44072180 ATCCATGGAAACAAAGCTGAGGG + Intergenic
1007909620 6:45500695-45500717 ATCTTTGAGGACCCAGCTGAAGG + Intronic
1014808240 6:125856281-125856303 ATTAATGAGGACCAAGTTGAGGG - Intronic
1016086647 6:139923121-139923143 ATCCATGTAGTCAAAGCTTAAGG - Intergenic
1019824549 7:3272997-3273019 CACCATCTGGACCAAGCTGGTGG - Intergenic
1019913132 7:4113719-4113741 TTCCATGTTGACCTAGCTTAAGG - Intronic
1022289527 7:28987730-28987752 TTTCATGTGTACCATGCTGAGGG - Intergenic
1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG + Intronic
1027358257 7:77381315-77381337 ATCCATGTCGCCCAAGAAGATGG - Exonic
1027846683 7:83386518-83386540 ATCTAAGTTGACCAAGCTTAGGG - Intronic
1027919406 7:84373205-84373227 ACTCCAGTGGACCAAGCTGATGG + Intronic
1027977290 7:85174873-85174895 AGCCATGTGGACCAGGCATATGG - Intronic
1035402281 7:158574760-158574782 ATGCATGTGGAGGAAGCTGCCGG - Intronic
1036069464 8:5424748-5424770 ATGCTTGTGGACCAAGTTAATGG + Intergenic
1037636460 8:20704799-20704821 AGCCATGTGGAACAAGCAGGCGG + Intergenic
1038183155 8:25247682-25247704 ATCCCTATGGACCAAGCTAAGGG + Intronic
1038744229 8:30242668-30242690 AGCCATGTGAACCACACTGAAGG + Intergenic
1038796590 8:30715807-30715829 ATACATGAGGAACAAACTGATGG - Intronic
1039186205 8:34919124-34919146 ATTCATGTGTGCCAAGCTCATGG + Intergenic
1049812108 8:144580239-144580261 ATCAGTGTGGACACAGCTGAGGG - Intronic
1058113889 9:101063235-101063257 GTTCTTCTGGACCAAGCTGAAGG + Intronic
1059347681 9:113641060-113641082 ATCCATGTGGACCCAGGCCAGGG - Intergenic
1059441440 9:114309270-114309292 ATTCATCTGGACCCGGCTGATGG - Exonic
1061656903 9:132098976-132098998 AACCCTGTGGAACAAGTTGAAGG + Intergenic
1186259108 X:7756913-7756935 CTCAAAGTTGACCAAGCTGAGGG - Intergenic
1187046440 X:15651720-15651742 ATCCACGTGGGCCAAGCTTCAGG - Intronic
1190453953 X:50607566-50607588 CTCCAGGTGGCCAAAGCTGAGGG + Exonic
1190732449 X:53234614-53234636 GGCCATGTGGAGCAAACTGAGGG + Exonic
1190748509 X:53341228-53341250 ATCCATGAGGACCTTCCTGAGGG - Intergenic
1194600695 X:95918150-95918172 ATCCATGTGCACTAAGCACATGG + Intergenic
1196304691 X:114087401-114087423 GTCCCTGTGGACCACCCTGAGGG + Intergenic
1197571406 X:128155516-128155538 ATTCATGTTGACAAGGCTGAGGG - Intergenic
1202369932 Y:24189548-24189570 ATCCATGTGGACATATTTGAGGG - Intergenic
1202500852 Y:25480569-25480591 ATCCATGTGGACATATTTGAGGG + Intergenic