ID: 905202144

View in Genome Browser
Species Human (GRCh38)
Location 1:36322576-36322598
Sequence GGGTGCTGCTGCGGGGGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 380}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905202127_905202144 29 Left 905202127 1:36322524-36322546 CCCAGCCGAGTCACCGTGTCCTC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 40
4: 380
905202132_905202144 7 Left 905202132 1:36322546-36322568 CCTCGTCCTCGTCGTCGTCCTCG 0: 1
1: 3
2: 18
3: 110
4: 660
Right 905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 40
4: 380
905202131_905202144 10 Left 905202131 1:36322543-36322565 CCTCCTCGTCCTCGTCGTCGTCC 0: 2
1: 3
2: 36
3: 277
4: 4487
Right 905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 40
4: 380
905202129_905202144 24 Left 905202129 1:36322529-36322551 CCGAGTCACCGTGTCCTCCTCGT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 40
4: 380
905202135_905202144 1 Left 905202135 1:36322552-36322574 CCTCGTCGTCGTCCTCGGGCTCC 0: 1
1: 0
2: 3
3: 28
4: 188
Right 905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 40
4: 380
905202130_905202144 16 Left 905202130 1:36322537-36322559 CCGTGTCCTCCTCGTCCTCGTCG 0: 1
1: 1
2: 8
3: 88
4: 1092
Right 905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 40
4: 380
905202128_905202144 28 Left 905202128 1:36322525-36322547 CCAGCCGAGTCACCGTGTCCTCC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 40
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905202144 Original CRISPR GGGTGCTGCTGCGGGGGTCC CGG Exonic
900164020 1:1237568-1237590 GGATGCAGCTGAGGAGGTCCTGG - Intergenic
900181577 1:1313373-1313395 GGCTGCTGCTGCTGGGGAACGGG - Intronic
900447472 1:2688544-2688566 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900450324 1:2746324-2746346 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900594112 1:3472649-3472671 TGGTGCGGCAGCGGGGGCCCGGG + Intronic
900682294 1:3923764-3923786 GGGTGCTGGTGCCGAGGGCCAGG - Intergenic
901051409 1:6427550-6427572 GGGTACTGGTGGGCGGGTCCGGG - Intronic
901198554 1:7453871-7453893 CCGGGCTGCTGCGGGGGGCCGGG - Intronic
901496700 1:9626474-9626496 GGCTGCTGGAGAGGGGGTCCGGG + Intergenic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902214351 1:14924781-14924803 GGGGGCTGCACCGGGGGGCCAGG + Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
903128630 1:21263960-21263982 GGAGGCTGCTGCAGGGGACCAGG + Intronic
903352700 1:22727507-22727529 GGGTGCTGCTTGGGTTGTCCAGG - Intronic
903605768 1:24574071-24574093 GGGGGCCGCTGTGTGGGTCCTGG - Intronic
903627923 1:24744918-24744940 GGGTGCTGCAGCGGGGGAGTGGG + Intergenic
903972029 1:27125175-27125197 GGATGCTGCTGCAGTGGTCCAGG - Intronic
904286527 1:29456243-29456265 TGGAGCTGCTGCAGGTGTCCAGG + Intergenic
904680001 1:32222462-32222484 GGGTATTGCAGTGGGGGTCCTGG + Intronic
905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG + Exonic
905959878 1:42035251-42035273 GGCTGCTGCTGCAGGGCGCCCGG - Intronic
906797850 1:48711806-48711828 GGGTGCTGCTTCTGGGGTCCAGG - Intronic
907513450 1:54979190-54979212 GGTTGCTGATGTTGGGGTCCAGG - Intergenic
907646304 1:56247157-56247179 GGGAGCTGCTACGCGAGTCCTGG - Intergenic
912550655 1:110483333-110483355 GGGCGCTCCTGCCTGGGTCCTGG - Intergenic
914242028 1:145858788-145858810 AGGGGCTGCGGCGGGGCTCCGGG - Intronic
915902374 1:159855970-159855992 TGCTGCTGCTGCGGGGGCTCCGG - Exonic
917508309 1:175648964-175648986 GGATGCTGCTGAGGTAGTCCAGG - Intronic
917972920 1:180220011-180220033 GTGGGCTACTGTGGGGGTCCAGG + Intergenic
918139545 1:181708986-181709008 GGGTGCTATTGCAGTGGTCCAGG + Intronic
918424357 1:184393088-184393110 GGCTGATGCTGCGGTGGTCTTGG - Intronic
920172549 1:204080755-204080777 GGCAGGTGCTGTGGGGGTCCAGG + Intronic
920989732 1:210925515-210925537 CGGTGCTGTTGCGGGGGACATGG + Intronic
922798611 1:228353645-228353667 TGGGGCTGCTCCTGGGGTCCTGG + Intronic
922950969 1:229558420-229558442 GGCTGCCGGGGCGGGGGTCCGGG - Exonic
1062946081 10:1463157-1463179 GGGGGCTGCAGCGGGGGCACAGG + Intronic
1063418272 10:5890415-5890437 GGGTCCTGCGCGGGGGGTCCGGG + Intronic
1063418287 10:5890442-5890464 GGGTGGGGCAGCGGGGGCCCCGG + Intronic
1064060072 10:12129765-12129787 GGCTGCTGCTGGGGAGGCCCAGG - Exonic
1064972818 10:21083372-21083394 GGGTGCTGCTACTGGGGTGGAGG - Intronic
1065188921 10:23193218-23193240 GCGGGCGGCTGCGGGGGGCCGGG + Exonic
1067204753 10:44203064-44203086 GGGTGTTGCTGAGAGGGTGCTGG + Intergenic
1067567622 10:47350062-47350084 GGGTGCTGTAGCGTGGGCCCGGG - Exonic
1068072301 10:52210346-52210368 GGGTGCAGCTGTGACGGTCCTGG - Intronic
1069932448 10:71891865-71891887 TGGTGCTGCTGGGAGGGTACAGG - Intergenic
1070280246 10:75043492-75043514 GCGTGCTGCTGGTGGGGTTCGGG - Intronic
1072784123 10:98268602-98268624 GGGTGCTGTGCCGGGGGCCCTGG - Intergenic
1073559332 10:104483380-104483402 GAGTGCTGCTTGGAGGGTCCAGG + Intergenic
1074121714 10:110498267-110498289 CGGTGGTGCTGCGGCGGGCCCGG + Exonic
1074980953 10:118619689-118619711 GGAGGCTGCTGCAGAGGTCCAGG + Intergenic
1075020919 10:118951911-118951933 GTGTGGTGCAGTGGGGGTCCTGG + Intergenic
1075088577 10:119430253-119430275 TGGGGCTGCTGTGGGGCTCCTGG + Intronic
1075520024 10:123137617-123137639 GGCTGCAGCCGCGGGGGCCCCGG + Exonic
1076139462 10:128068108-128068130 GGGAGCTGCTGCGGGGGACGCGG - Exonic
1076364250 10:129911637-129911659 GGGGGCTGCTGCTGGGCTCACGG + Intronic
1076573622 10:131449319-131449341 GGGGGATGCTGGGGGCGTCCTGG + Intergenic
1076715475 10:132361849-132361871 GGGTGCTGCTGTGGGCGCCAAGG + Intronic
1076946090 10:133651483-133651505 GGGTGCGGATGGGTGGGTCCTGG - Intergenic
1077011322 11:380583-380605 GTGTGCTGGTGCGGGGGGACTGG - Intronic
1077023955 11:431311-431333 GGGGGCTTCTGCGGGGGTGTGGG + Intronic
1077089622 11:772548-772570 GGGTGCGGGTGGCGGGGTCCAGG - Intronic
1077112609 11:868646-868668 GGGAGCTGGGGAGGGGGTCCTGG - Exonic
1077331721 11:1986929-1986951 GGGGGCTGCTCAGGGGGTGCAGG + Intergenic
1077556328 11:3227828-3227850 GGGGGCTGCAGCTGGGGTCGGGG + Exonic
1077610335 11:3639965-3639987 GGGGGCTGCAGCAGGGGACCTGG - Exonic
1078608019 11:12794714-12794736 GGGTGCTCCTGCCGGGTTGCAGG - Intronic
1078679529 11:13462964-13462986 GGCTGCTGCGGCGGTGGTCTGGG - Intronic
1080641974 11:34163586-34163608 GGGTGGTGCTGCAAGGTTCCTGG + Intronic
1081700151 11:45147373-45147395 GGGGGCTGCTGCGGGGTGCTCGG + Exonic
1081846360 11:46243412-46243434 GAGTCCTGCTGCGGGGCGCCGGG + Intergenic
1083259529 11:61515673-61515695 GAGGGCAGGTGCGGGGGTCCTGG + Intronic
1083593130 11:63906816-63906838 GGGTGCTGGGGCAGGGGTGCGGG - Intronic
1084328191 11:68413984-68414006 AGTTGCGGCTGCTGGGGTCCAGG - Exonic
1084604690 11:70165629-70165651 GGTGGCTCCTGCGGGGGTCTGGG + Intronic
1084736314 11:71107965-71107987 TGATGCTGCTGCGGGGGACTGGG - Intronic
1084980258 11:72825097-72825119 GGAGGCTGCTGCAGGGGTCCAGG + Intronic
1085134554 11:74074352-74074374 TGGTGCTGCTGCAGGGGACCTGG + Exonic
1085200007 11:74696226-74696248 AGGTGCTGCAGTGGGGGGCCTGG + Intergenic
1085872197 11:80363833-80363855 GGGTGCTGCAGTGGCTGTCCTGG - Intergenic
1086107036 11:83157463-83157485 GGCCGGTGCTGCGGGGGCCCGGG + Exonic
1089043534 11:115477776-115477798 TGCTGCTGCAGCTGGGGTCCAGG + Intronic
1089300764 11:117497431-117497453 GGGGGCTGCGGCGGGGAGCCTGG + Intronic
1089396508 11:118139387-118139409 CGATGCTGCTGTGGGGGTTCAGG - Intronic
1089928773 11:122287533-122287555 AGGTGCTGCTGAGGGGGGCCTGG + Intergenic
1202814702 11_KI270721v1_random:42105-42127 GGGGGCTGCTCAGGGGGTGCAGG + Intergenic
1091398788 12:170505-170527 AGGGGCTCCTGCGGGGGTCGGGG + Intronic
1091624217 12:2110229-2110251 AGGTGCTGCTGCTGGGGACCAGG - Intronic
1094488932 12:30946605-30946627 GGGTGCTGCTCTGGGGATCTGGG + Intronic
1094834182 12:34314570-34314592 GGGTGGGGCTGCAGGGATCCTGG - Intergenic
1095945130 12:47749369-47749391 AGGTGCTGCTGCTGGGGTTGGGG - Exonic
1097690443 12:62729609-62729631 GGGTGCTGATGATGGGGTGCTGG - Intronic
1100616457 12:96235189-96235211 GGGGGCGGCTGTGGGGGTGCAGG - Intronic
1103943946 12:124516124-124516146 GGCAGCTGGTGCGGGGGGCCTGG + Intronic
1103956927 12:124582488-124582510 GGGAGCTGCTGTGGGGGCCTGGG + Intergenic
1104320713 12:127748407-127748429 GGGTGCTCATGCTGGGGTCTGGG + Intergenic
1104801526 12:131558197-131558219 GGGTGCTGTGGTGGGGGCCCCGG - Intergenic
1104878528 12:132053412-132053434 GGTGGCTGCTGCGGGGGTGGTGG - Exonic
1105503087 13:20989088-20989110 GGGTGCTGGTGCTGGTGGCCGGG + Exonic
1105998868 13:25700155-25700177 TGGTGCAGCTGTGGGGGACCTGG + Intronic
1106591694 13:31103960-31103982 GGGTGTTGGTGGGGGGGACCTGG + Intergenic
1108682642 13:52792620-52792642 GGGTGAGGCTGTGGGGCTCCTGG + Intergenic
1112496990 13:99913121-99913143 AGGAGCTGCTGAGGGTGTCCTGG - Intergenic
1115028015 14:28765920-28765942 GGGTGCTGCTGCGGCGGCCGGGG - Intergenic
1115651375 14:35404661-35404683 GGGCGCTGCTGCGGGTGCGCTGG + Exonic
1118819529 14:69336038-69336060 GGGTGTGGCTGCGGGGCTGCAGG - Intronic
1119329431 14:73783227-73783249 GGGTGATGTTGCTGGAGTCCCGG + Intronic
1121632168 14:95429415-95429437 TGATGCTGCTGCTGGGGGCCTGG - Intronic
1121717996 14:96089807-96089829 GGGTGCTTCTGCTGGGCTCCTGG - Exonic
1122059188 14:99125244-99125266 AGGAGCTGCTGCGAGGTTCCAGG + Intergenic
1122235234 14:100327538-100327560 GTGTGCTGCTGAGGGGTTCCAGG - Intronic
1122529827 14:102417907-102417929 GGAGGCTGCTGCAGGAGTCCAGG + Intronic
1122657919 14:103274182-103274204 CGGGGCTGCTGCGGGGCTGCTGG - Intergenic
1122719938 14:103716188-103716210 GTGTCCCGGTGCGGGGGTCCCGG + Intronic
1122736890 14:103848180-103848202 GGGAGCTGGTGCGGGGGGCGCGG - Intergenic
1122848990 14:104516537-104516559 GGGTGCTGCTGAGAGGGGCCAGG - Intronic
1122947698 14:105020777-105020799 GGCCGCTGCTGAGGGGGCCCGGG - Intronic
1123037983 14:105479066-105479088 GGGGGCGGGGGCGGGGGTCCGGG - Intronic
1123039347 14:105484039-105484061 GGGGGCTGCTGCAGTGTTCCGGG - Intergenic
1124613262 15:31223615-31223637 GGGGGGTGCTGCAGGCGTCCTGG + Intergenic
1126436713 15:48645113-48645135 GGCTGCTGCCGCCGGGGGCCTGG - Intronic
1127324267 15:57880122-57880144 GGCTGCTGCTGCAGTGGCCCAGG - Intergenic
1127920060 15:63487458-63487480 AGGTGGTGCTGCGTGAGTCCGGG - Intergenic
1128115434 15:65102185-65102207 GGGTGCTGGGGCGCGGGCCCCGG + Exonic
1128245995 15:66133219-66133241 TGGTGCTGATGGGGTGGTCCAGG - Intronic
1129082286 15:73052104-73052126 GGGCGCTGCTGCTGGCGTCAGGG - Intronic
1131009110 15:89002705-89002727 CGGTGCTCCTGCCGGGGTCAGGG - Intergenic
1132250950 15:100335060-100335082 GGGTGCTGATGCTGCCGTCCTGG - Intronic
1132586591 16:708201-708223 GGGTGCTGCAGGGGAGCTCCAGG - Intronic
1132785906 16:1656893-1656915 GGGAGCCGGGGCGGGGGTCCTGG - Exonic
1132810011 16:1792938-1792960 GGGTGCTGCGGGAGGGGACCGGG + Intronic
1132858677 16:2058950-2058972 GGGTCCTGCTGCGGGGGCTGCGG + Intronic
1132897434 16:2235795-2235817 AGGTGCTGCTGCGGGGGCCTGGG - Exonic
1133460933 16:5985590-5985612 GGGGGCTGCTGGGGCAGTCCTGG - Intergenic
1134038257 16:11048673-11048695 GGGTGCTGCTGGGGTGTTTCTGG - Intronic
1136293982 16:29291443-29291465 GGGTGCTCCTGCTGCTGTCCTGG + Intergenic
1136403362 16:30030280-30030302 GGGAGCTCCTGTGGGGGTCCGGG - Intronic
1136574892 16:31117693-31117715 GGGAGCTGCTGCGGCGGTTGCGG + Exonic
1137625149 16:49903065-49903087 GGAGGCTGCTGTGGGTGTCCAGG + Intergenic
1137958051 16:52852894-52852916 GGTTGCTGCTGCCGGGGTTGAGG - Intergenic
1140067853 16:71625994-71626016 GGGTGCTGCTGCTGGAAACCCGG - Intergenic
1141940859 16:87275081-87275103 GGGTGCTGCTGAGAAGGTGCTGG - Intronic
1141962692 16:87420178-87420200 ATGTGCTGCTGCCGGGGCCCTGG - Intronic
1142099886 16:88265489-88265511 GGGTGCTCCTGCTGCTGTCCTGG + Intergenic
1142267651 16:89071864-89071886 GGGCTCTGCTGCGGTGTTCCTGG + Intergenic
1142994637 17:3753457-3753479 GGGTGCAGGAGCGGGGCTCCTGG - Intronic
1143514709 17:7413935-7413957 TGGAGCTGCTGGGAGGGTCCTGG - Intronic
1144685192 17:17221505-17221527 GGGTGCTGTTGCCGGGGCCTTGG - Intronic
1145017323 17:19407813-19407835 GGGTGCTGCTGGGGAAGTCAAGG - Intergenic
1145112818 17:20179225-20179247 GGATGCTGCTGCTGTGTTCCTGG + Intronic
1147325547 17:39667914-39667936 GGGTGCTGGGACGGGTGTCCGGG + Intergenic
1147643586 17:42020179-42020201 GGCTGGTGCTGCGGGGGCCCCGG + Intronic
1147978111 17:44259403-44259425 AGATGGGGCTGCGGGGGTCCAGG + Intronic
1147988594 17:44320227-44320249 GGCTGCTGCTGCGGAGGATCCGG - Exonic
1148002716 17:44399088-44399110 TGGTGCTGCGGCTGCGGTCCCGG + Exonic
1148104707 17:45113049-45113071 GGGTGGTGCAGGGTGGGTCCTGG - Intronic
1148754942 17:49968601-49968623 GGGTGCAGCGGCGGCGGTCTCGG + Intergenic
1150220071 17:63491137-63491159 GCGTGCTGCCGTGGGGATCCCGG - Intronic
1150289720 17:63974177-63974199 GGGCGCTGCTGCAAGGGTCAAGG - Intergenic
1150488199 17:65558569-65558591 GGAAGCTGCTGCTGGGGTCCGGG + Exonic
1151156115 17:72123884-72123906 GGGGGCTGCTGCGGGGGTGGCGG - Exonic
1151314126 17:73311543-73311565 GGGTGCCGCTGAGGGGGTTGGGG - Intronic
1151815641 17:76470218-76470240 GGGAGGTGCTGTGGGGTTCCTGG + Intergenic
1152278449 17:79371665-79371687 GAGGGCTGCTGGGGGTGTCCTGG - Intronic
1152291118 17:79440789-79440811 GGATGCTGATGAGGGGGTGCAGG - Intronic
1152614240 17:81330580-81330602 GGGGGCTGCCGTGGGGATCCAGG + Exonic
1152618105 17:81346924-81346946 GGGCCCTGGTGCGGGTGTCCTGG - Intergenic
1152727610 17:81955574-81955596 GGGGGCAGCAGCGGGGGTCAGGG - Intronic
1152921363 17:83068157-83068179 GGGGGCGACAGCGGGGGTCCCGG + Intergenic
1152921378 17:83068192-83068214 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921392 17:83068226-83068248 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921430 17:83068328-83068350 GGGGGCGGCAACGGGGGTCCCGG + Intergenic
1152921466 17:83068430-83068452 GGGGGCGGCAACGGGGGTCCCGG + Intergenic
1152921504 17:83068532-83068554 GGGGGCGGCAACGGGGGTCCCGG + Intergenic
1152921541 17:83068634-83068656 GGGGGCGACAGCGGGGGTCCCGG + Intergenic
1152921555 17:83068668-83068690 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921625 17:83068842-83068864 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152924114 17:83079759-83079781 GGGGTCTGCTCCGGGGGTCGCGG + Exonic
1153060583 18:990858-990880 GAGTGCTGCTGCTGGGGGGCGGG + Intergenic
1156480935 18:37435973-37435995 GGGCCCTGCAGCGGGGGTCCTGG - Intronic
1158436010 18:57435861-57435883 GGGGGCGGCGGCGGGGGCCCGGG + Exonic
1159016650 18:63106317-63106339 GTGTGCTGCTGAGGGGATCTTGG + Intergenic
1159955360 18:74515144-74515166 GGGCGCTGCTGTGGAGCTCCGGG + Intronic
1160505890 18:79426698-79426720 GGGTGTTGCTGCGGGTGTGGAGG + Intronic
1160518196 18:79489891-79489913 CGGTGCCGCTTCGGGGGTCGGGG + Intronic
1160746469 19:713474-713496 GGGTGGTGCTCAGAGGGTCCAGG - Intronic
1160776037 19:856137-856159 GGGTCCTGCTGGCCGGGTCCGGG - Exonic
1160866599 19:1259020-1259042 GGGTCGGGCTGTGGGGGTCCCGG + Exonic
1161332566 19:3695309-3695331 GTGTGCTGCTTCCGGGGCCCAGG - Intronic
1161358195 19:3831454-3831476 GGCAGCTGCTGCGGGGGTCCCGG + Exonic
1161398540 19:4057840-4057862 GGGTGCTGCCGGTGGGGTTCGGG - Intronic
1161494694 19:4580817-4580839 CGGGGCTGGTGTGGGGGTCCTGG - Intergenic
1162031205 19:7917970-7917992 GGGGGCTGCTGCGGGCATCGCGG - Intronic
1162122046 19:8476831-8476853 GGATGCCGCTGCGGGGCTGCAGG + Intronic
1162340159 19:10087051-10087073 CGGTGAGGCTGCAGGGGTCCCGG + Exonic
1163727544 19:18931431-18931453 AGGGTCTGTTGCGGGGGTCCTGG + Intronic
1163740602 19:19009569-19009591 GGGTCCTGCTGCTGGGGCCGTGG - Intronic
1164992175 19:32692370-32692392 GCGTGCTGCTGCTGCGGCCCAGG + Exonic
1165236471 19:34426241-34426263 GGGTGCTGGTGCCGGGGCCGGGG + Intergenic
1167097543 19:47382370-47382392 GGGTGCTGCCTGAGGGGTCCTGG + Exonic
1167664555 19:50816560-50816582 GGGTGCTGTTGAGGGTGTCTGGG + Intergenic
1168339121 19:55613802-55613824 GGGGGCTGCGGCGGGGGGCCGGG - Exonic
1168406976 19:56115608-56115630 GGAGGCTGCTGCGCGAGTCCAGG - Intronic
1168408027 19:56120889-56120911 GGGTGCGCGTGCGCGGGTCCGGG - Intronic
925744517 2:7032948-7032970 GGGTGCTGACTCGGGGGACCCGG + Intronic
925928325 2:8685827-8685849 GGCTGCGGCTCCAGGGGTCCCGG - Intergenic
926422865 2:12716642-12716664 GGGTGCTGCGCCCGGGGCCCCGG + Intergenic
927200373 2:20574687-20574709 GGGTGCTGCTGGGGGAAGCCAGG - Intronic
927894424 2:26772234-26772256 GGGTGCTGCGGGGGAGGTACAGG + Intronic
929581918 2:43086815-43086837 GGGTGCTGCTGAGGGTGTCCAGG - Intergenic
930785276 2:55266065-55266087 GCATGCGGCAGCGGGGGTCCTGG + Intronic
931663844 2:64595903-64595925 TGGCACTGCTGCGGGGCTCCTGG - Intergenic
933847511 2:86337569-86337591 GCGGGCTGCTGCGGCGTTCCCGG + Intronic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
934758065 2:96838573-96838595 GGGTGCAGCTGCAGCGTTCCAGG + Exonic
935854006 2:107255795-107255817 GGGGACTGCTGCAGTGGTCCTGG + Intergenic
938144066 2:128819676-128819698 GGATGCTGTTGCAGGGGCCCAGG - Intergenic
938206799 2:129431111-129431133 GTGTGCTGCTGGGCTGGTCCTGG - Intergenic
938236371 2:129709801-129709823 GGGTGCGGCTGCAGGGGTGAGGG - Intergenic
941065185 2:160893723-160893745 TGGGGCTGATGCTGGGGTCCAGG + Intergenic
943046357 2:182866508-182866530 GGATGCTGCTGCTGCGGGCCGGG - Exonic
944138148 2:196423439-196423461 GTGTGCTGCTGTGACGGTCCTGG + Intronic
944699983 2:202238241-202238263 GGGGCCTGCTGCGGGGCTCCCGG - Intronic
946647125 2:221849583-221849605 AGGTGCTGCTGAGGCGGGCCAGG - Intergenic
948284781 2:236775094-236775116 TGGTGCTGATGCTCGGGTCCTGG + Intergenic
948751537 2:240136137-240136159 GCGTCCTGGTGCGCGGGTCCCGG - Intronic
948807684 2:240460024-240460046 GGCAGCTGCTGCTGGGGCCCTGG + Intronic
948809272 2:240466581-240466603 GGCTGCTTCTGCGGCGGTGCAGG - Exonic
948912159 2:241010163-241010185 GGGTGCTGCTTCCTGGCTCCTGG + Intronic
949018750 2:241728607-241728629 AGGTGCTGCTGCTGGGGACATGG + Exonic
949042918 2:241857759-241857781 GGCTCCTGCCCCGGGGGTCCTGG - Intronic
949045312 2:241870096-241870118 GGCTGCTGACGCAGGGGTCCCGG + Intronic
1168777721 20:462212-462234 CGGGGCTGCTGCGGGGTTCCGGG - Intronic
1168869152 20:1114147-1114169 GAGAGCTGCTTCTGGGGTCCTGG - Intronic
1170073331 20:12392263-12392285 GGAGGCTGCTGCAGGAGTCCTGG + Intergenic
1170929976 20:20760702-20760724 GGCTGCCTCTGGGGGGGTCCTGG - Intergenic
1172038851 20:32029740-32029762 CGATGCTGCTGCGGGAGTACCGG + Exonic
1172335009 20:34108415-34108437 GGGTGCTGCTTCGGGATCCCTGG - Intronic
1174047118 20:47741373-47741395 GGGCACCGCTGCGGGGCTCCGGG - Intronic
1174525819 20:51170397-51170419 GGGTGATGCTGGGGGAGGCCAGG - Intergenic
1174575522 20:51534235-51534257 GGGGGCTGCAGCGGGGGCCAGGG + Intronic
1174578596 20:51555115-51555137 GGAGGCTGCTGCAGTGGTCCAGG - Intronic
1174656388 20:52175847-52175869 GGGGGCGGCAGCGGGGGTGCGGG - Intronic
1175457350 20:59125445-59125467 GGGTGATGCTGCGGGGGGGTGGG - Intergenic
1175900549 20:62358313-62358335 GGGGGGTACGGCGGGGGTCCTGG - Intronic
1175908233 20:62392233-62392255 GGGAGCTGCTGCTGGGGGCCTGG + Intronic
1175913707 20:62416101-62416123 GGGTGCTGCTCGGGGGGTGCTGG + Intronic
1176146566 20:63568140-63568162 GGGTGCCTCTGCCGGGGCCCTGG - Intronic
1177225177 21:18244829-18244851 GGCTGCTGCTGCTGTGATCCAGG + Exonic
1177730816 21:25025079-25025101 GGCTGCTGCTGCTGGGGCCAAGG - Intergenic
1179123337 21:38569046-38569068 GGGAGCTGCTGCTGGGGTCTGGG - Intronic
1179478476 21:41662937-41662959 GGGTGCAGCTGCTGGGGACGGGG + Intergenic
1179534030 21:42039846-42039868 GGCGGCTGCTGGGGGTGTCCTGG + Intergenic
1179729150 21:43357912-43357934 GGGAGCTGCCCCGAGGGTCCTGG - Intergenic
1180064382 21:45405280-45405302 AGATGCGGCTGCGGGGGTCGCGG + Intronic
1180147379 21:45928927-45928949 GGGTGCTGCAGAGGGTGTCCTGG - Intronic
1180620576 22:17159167-17159189 GCGCGCGGCTGCGGGGCTCCAGG - Exonic
1180801947 22:18636086-18636108 GGGGGCTGCTGCGGGGACCGAGG + Intergenic
1180853185 22:19031627-19031649 GGGGGCTGCTGCGGGGACCGAGG + Intergenic
1181219773 22:21359175-21359197 GGGGGCTGCTGCGGGGACCGAGG - Intergenic
1181335743 22:22126329-22126351 GGGTGCTGCAGCGTGGGCCTCGG + Intergenic
1181466590 22:23113761-23113783 GAGTGCTGCCGAGGGGGTCTGGG - Intronic
1181695867 22:24592595-24592617 GGGGGCTGCTGAGTGTGTCCGGG - Intronic
1182123105 22:27799489-27799511 GGCTGCTGCTGAGGGGGTGGCGG + Exonic
1182145140 22:27992904-27992926 GGGTGGTGCTGCCTGGGTCCTGG - Intronic
1182577360 22:31282129-31282151 AGGTGGTCCTGCGGGCGTCCAGG - Exonic
1182804377 22:33058075-33058097 GGCTGCCGCTGCCGGGGCCCTGG - Intronic
1183048478 22:35241270-35241292 TGGGGCTGTTGCGGGGGTCAAGG - Intergenic
1183727550 22:39597916-39597938 GGGTCCTGCAGCTGGGGGCCTGG + Intronic
1184149523 22:42630233-42630255 GGGGTCTGCTGCGGGGTTCGAGG - Intronic
1184310445 22:43637794-43637816 GTGTGCTTCTGCGGGGGCCACGG - Intronic
1184347575 22:43923172-43923194 GGGTGCTGGGGCTGGGGTCGGGG - Intergenic
1184549725 22:45198066-45198088 GGGTGCTGGTGTGGGGGTGTTGG - Intronic
1185273394 22:49938867-49938889 GGGTGCAGCTGCTGGTGTCCTGG - Intergenic
1185327663 22:50234973-50234995 GGATGATGCTGCGGTGGACCTGG - Intronic
949870234 3:8582104-8582126 GGGTGGCTCTGCTGGGGTCCCGG - Intergenic
950416030 3:12869440-12869462 GGGCCCAGCTGCGGGAGTCCTGG - Intronic
952212878 3:31247151-31247173 GGGTGCTGTTGGGGAGGGCCTGG - Intergenic
952382893 3:32818207-32818229 GGGGGCGGCGGCGGGGGCCCTGG + Exonic
954035459 3:47848769-47848791 GGCTGCTGCTGAAGGGGTCCCGG - Exonic
954036651 3:47854492-47854514 GGCTGCTGCTGCTCGGGTTCAGG - Intronic
954680625 3:52344132-52344154 GGGTGCTGCAGGGGAGGTGCAGG + Intronic
954879478 3:53823790-53823812 GCGTGCTGCTGCTGGAGGCCGGG - Exonic
955364543 3:58299846-58299868 GGGTGCTGGGGCAGGGGACCAGG + Intergenic
957215721 3:77317648-77317670 GGTTGCTGCTGGGGGGCTGCTGG + Intronic
957215760 3:77317740-77317762 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215789 3:77317809-77317831 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215803 3:77317842-77317864 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215814 3:77317865-77317887 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
960995120 3:123335626-123335648 GGGAGCTGCTGCTGTGGTACCGG + Intronic
961046799 3:123714262-123714284 AGATGCTGCTGGTGGGGTCCTGG + Intronic
961531070 3:127540754-127540776 GGAGGCTGCTGCTGTGGTCCGGG + Intergenic
961551665 3:127673228-127673250 GGGGGCTGCGGCGGGGGTCCGGG - Intronic
961734551 3:128993398-128993420 GGGTGCTTCTGCAGGAGGCCGGG - Intronic
961735744 3:129001387-129001409 TGGTGGCGCTGCCGGGGTCCCGG + Intronic
966886522 3:184380362-184380384 GGCTGCTGCTGCTCGGCTCCCGG + Exonic
967971617 3:195003702-195003724 GGGTGCTGCTGCGGGGGCTGGGG - Intergenic
968048151 3:195635438-195635460 GGGGGCGCCCGCGGGGGTCCGGG - Intergenic
968048177 3:195635500-195635522 GGGGGCGGCCGCGGGGGTCGGGG - Intergenic
968099227 3:195954120-195954142 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968099253 3:195954182-195954204 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968306434 3:197654421-197654443 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968306460 3:197654483-197654505 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968452210 4:681045-681067 GCGGGCTGATGCGGGGGTGCAGG - Intronic
968662956 4:1806382-1806404 GGGGACTGCAGCTGGGGTCCTGG - Intronic
969281564 4:6174381-6174403 GAGGGCTGCTGGGAGGGTCCAGG + Intronic
969344827 4:6563920-6563942 GGGTGCGGCTGCGGGCGCCGAGG + Intergenic
969447173 4:7252078-7252100 GGGTGGTACTGCAGGGGTCAGGG - Intronic
969584509 4:8084282-8084304 GGGGGCTCCTGCGAGGATCCTGG + Intronic
969636560 4:8372854-8372876 TGGTGCTGCTGCGGTGGGCAGGG - Intronic
969637434 4:8377522-8377544 GCGTGGTGCTGCTGGGGTCAGGG + Intronic
971446194 4:26751828-26751850 GGATGCTGCTACAGTGGTCCTGG - Intronic
977884925 4:102243727-102243749 GGGCGCTGCTGCAGGGGGTCTGG - Intergenic
981128579 4:141133243-141133265 GGGTGCTGCCCAGGGTGTCCCGG + Intronic
984206461 4:176792763-176792785 GGGCGCTGCGGCGGGGGCGCTGG + Intergenic
985449500 4:190052137-190052159 GGGTGCGGATGGGTGGGTCCTGG - Intergenic
985749487 5:1666203-1666225 GGGTGAGGATGTGGGGGTCCAGG + Intergenic
985766027 5:1779984-1780006 GGGTTCCCCTGCGGGGGTCCAGG - Intergenic
986590044 5:9359063-9359085 GGGTGCTGCTGCTGAGGATCTGG - Intronic
989230114 5:39075036-39075058 GGGTGCAGCGGCCGGGGACCAGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998431008 5:142069938-142069960 GGAGGCTGCTGCAGTGGTCCAGG + Intergenic
998648508 5:144091084-144091106 GCATGTTGCTGAGGGGGTCCAGG - Intergenic
1001313949 5:170629713-170629735 GGGTGCTGGTGCCGGGGTTGTGG - Intronic
1002435192 5:179227320-179227342 GGGAGCTGCTGGGAGAGTCCTGG - Intronic
1002538977 5:179893737-179893759 GGGAGCTGCTGGGTGGGTCTCGG - Intronic
1002722788 5:181273586-181273608 GGGTTCTCCTGCGCTGGTCCGGG + Intergenic
1003427527 6:6007549-6007571 GTGTGCTCGTGCGGGGGGCCGGG - Intronic
1003648557 6:7937218-7937240 GGTTGCTGCTGTGGGTGTCAGGG - Intronic
1004000483 6:11592718-11592740 GGGAGCAGCTGCAGGGGTCTGGG + Intergenic
1006150337 6:31983624-31983646 GGGTGCTGCTGTTGGATTCCAGG - Exonic
1006156638 6:32016362-32016384 GGGTGCTGCTGTTGGATTCCAGG - Exonic
1007444652 6:41895461-41895483 GGGTGCCGGTGCCGGGGTCGCGG - Intergenic
1007488663 6:42200638-42200660 GGGATCTGCTGCGGTGGACCAGG - Intergenic
1009385222 6:63079089-63079111 GGGTGCTGCTGCAGGAGGTCTGG + Intergenic
1013429582 6:110043728-110043750 GGGAGCTGGGGCGGGGGTGCTGG - Intergenic
1014272650 6:119350185-119350207 GGGCGCTCCCGAGGGGGTCCCGG + Intergenic
1017497528 6:154995193-154995215 GGGAGCTGGCGCGGGGGTCCTGG + Intronic
1018091225 6:160348228-160348250 CGGGGCTGCTGCGGGCGCCCGGG + Intergenic
1018823560 6:167392916-167392938 GGGTGCAGGTGAGGGGGTGCAGG - Intergenic
1018901533 6:168054174-168054196 CATTGCTGCTGCGGGGGTCTGGG - Intergenic
1019094405 6:169567164-169567186 CGGTGCTGCTGGGGAGGACCCGG + Intronic
1019317036 7:391583-391605 GGGTGCTGCCGCAGGAGGCCAGG + Intergenic
1019647789 7:2140285-2140307 GGGGGCTGCTGGAGGGGTGCTGG - Intronic
1020118761 7:5491349-5491371 GGGTGCCGCTGCGAGAGACCAGG + Exonic
1020211325 7:6159946-6159968 GGTGGCTGCTGGGGGGGTGCTGG - Intronic
1021631027 7:22647522-22647544 TGGTTCTCCTGTGGGGGTCCAGG + Intergenic
1022098749 7:27156909-27156931 GGGGGGTGCTGCGTGGGGCCGGG - Intronic
1023037631 7:36147359-36147381 GGGTTGTGCAGCGGGGGTGCAGG - Intergenic
1023292822 7:38686011-38686033 TGGGGCTGCTCCGTGGGTCCGGG + Exonic
1023302595 7:38789687-38789709 GGAGGCTGCTGCAGGGATCCAGG + Intronic
1023418263 7:39951238-39951260 CACTGCTGCTGCGGCGGTCCCGG - Exonic
1023862709 7:44225680-44225702 GGGGGCTGCTGCAGGCGGCCAGG - Intronic
1024131819 7:46361019-46361041 GGCTGCTGCTGCTGCTGTCCAGG - Intergenic
1024868100 7:53926931-53926953 GGGTGCTGCTCCTGGTGTCATGG + Intergenic
1024983961 7:55180088-55180110 GGGTGCTGCTCCAGGGTGCCCGG - Intronic
1024986986 7:55202665-55202687 GGCTGCTGCTGAGTGGGTCGAGG - Intronic
1026300055 7:69089924-69089946 GGGGGCTGCTTCTGGGGTTCTGG - Intergenic
1026760915 7:73125104-73125126 TGGTGGTGGTGAGGGGGTCCAGG - Intergenic
1027037257 7:74933900-74933922 TGGTGGTGGTGAGGGGGTCCAGG - Intergenic
1027086305 7:75267552-75267574 TGGTGGTGGTGAGGGGGTCCAGG + Intergenic
1029188206 7:98754449-98754471 GGGAGCTGCTGGGGTGTTCCGGG - Intergenic
1029362917 7:100100460-100100482 GGGTGCGGTGGCGGAGGTCCCGG - Intronic
1029640084 7:101815408-101815430 GCACGCTGCTGCGGGGGGCCTGG + Intergenic
1032800060 7:135310624-135310646 GGCAGCTGCTGCGGGACTCCCGG + Intergenic
1033220536 7:139524052-139524074 AGGGGCTGCTGCGGCGATCCGGG + Exonic
1033607965 7:142941326-142941348 GGGTGCTGCTGAGGGGCCCGTGG + Exonic
1033636595 7:143217848-143217870 GAGGGCTGCTGCTGGGATCCTGG - Intergenic
1034161560 7:148997649-148997671 GGGTGCTGCTGCTTGGCCCCAGG - Intergenic
1034455400 7:151167484-151167506 GGGGGCGGCGGCGGGGGCCCGGG - Exonic
1034491569 7:151395806-151395828 GGGAGCAGCTGCGGGTGTTCCGG - Exonic
1034855740 7:154544917-154544939 GTGGGCGGCTGCGTGGGTCCAGG + Intronic
1034977351 7:155456223-155456245 GGCTGCCTCTGCGGGGGTCTGGG + Intergenic
1035050717 7:155997738-155997760 GGGTGCTGCTGCGGGGAGCAGGG - Intergenic
1035160717 7:156948730-156948752 GGCTGCTGCTGTGGGGTTCTCGG - Intergenic
1036028629 8:4940099-4940121 GGGGGCTGCTGAGGAGGTCTTGG + Intronic
1036207991 8:6819274-6819296 GGCTGGGGCTGCGTGGGTCCCGG + Intronic
1036793580 8:11739930-11739952 GGGAGAGGCTGCGAGGGTCCAGG - Intronic
1039303530 8:36236247-36236269 GGGTCCTGCAGCTGGAGTCCTGG + Intergenic
1039798202 8:40933173-40933195 GGGGGCTGCTGGGGTGGGCCTGG - Intergenic
1039901823 8:41758205-41758227 AGGGGCTGCTGCGGGGGCCTGGG - Intronic
1041002657 8:53467302-53467324 GGGTGCTGTTGCAGGGGGTCCGG - Intergenic
1045245008 8:100435159-100435181 GGATGCTGCTGCTGCTGTCCAGG + Intergenic
1045497553 8:102721038-102721060 GGGTCCTGCTGGGGGTTTCCAGG - Intergenic
1045663994 8:104466770-104466792 GGGCGCTCCTGCGGGGCTGCGGG - Exonic
1046915373 8:119673266-119673288 GGGTCATGCTGCGGGAGTCTCGG + Intronic
1048997831 8:139805035-139805057 GGGTCCTCATGCTGGGGTCCAGG + Intronic
1049092213 8:140524777-140524799 GGGTGCTCGTGTAGGGGTCCGGG - Intergenic
1049195886 8:141315418-141315440 GGGGCCTGCCGCAGGGGTCCTGG - Intergenic
1049417201 8:142500491-142500513 AGGGGCGGCTGCAGGGGTCCAGG + Intronic
1049683962 8:143931860-143931882 TGGAGCTGCCGAGGGGGTCCAGG + Intronic
1049836004 8:144735957-144735979 GGGTCCCGCTGTGGGGGGCCAGG - Intronic
1053046426 9:34922985-34923007 GGGTGCTGCTGGGCCGGGCCTGG + Intergenic
1053055401 9:34990653-34990675 GGGTGCTGCTGGGGGTGGGCAGG - Exonic
1053624921 9:39859727-39859749 GGTTGCTGCTGCTGGGGTGGGGG + Intergenic
1053879949 9:42583501-42583523 GGTTGCTGCTGCTGGGGTGGGGG - Intergenic
1054218976 9:62390971-62390993 GGTTGCTGCTGCTGGGGTGGGGG - Intergenic
1054231741 9:62518198-62518220 GGTTGCTGCTGCTGGGGTGGGGG + Intergenic
1057869357 9:98707243-98707265 GGGCGCTTCTGCTGGAGTCCAGG - Intronic
1057907884 9:98996297-98996319 GCGAGCTGCTGCTTGGGTCCAGG + Intronic
1058486667 9:105448351-105448373 GGCTGCTGCTGCGGAGGGCAAGG + Intronic
1058623232 9:106905740-106905762 CGGGGCTGTTGCGGGGGTCACGG - Intronic
1060592831 9:124829929-124829951 GCGTGCTCCTGCTGGGGTCGGGG - Intergenic
1060811829 9:126614577-126614599 GGGTGCTGCTGGGTGAGTGCGGG + Exonic
1062194628 9:135266051-135266073 GGCTGCTGGTGAGGGGGTCGTGG + Intergenic
1062275714 9:135729565-135729587 GGGTGCTGCTGTGAGCTTCCAGG + Intronic
1062318066 9:135978001-135978023 GGCTGCTGGTGGGGGGGTCTAGG - Intergenic
1062338234 9:136081908-136081930 GGGTGCTGCTGCAGGTGGGCTGG - Intronic
1062492177 9:136810934-136810956 GGGAACTGCTGCGGGTTTCCAGG + Intronic
1062585823 9:137249495-137249517 GGGTGATGCTTGGGGGGTGCGGG + Intergenic
1062633296 9:137477085-137477107 GGGTGCCTGGGCGGGGGTCCAGG - Intronic
1062688517 9:137828564-137828586 GTGTGCTCCTGCGGGGGTGCGGG + Intronic
1203760671 EBV:12048-12070 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1203761600 EBV:15120-15142 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1203762529 EBV:18192-18214 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1203763458 EBV:21264-21286 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1203764387 EBV:24336-24358 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1203765316 EBV:27408-27430 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1203766245 EBV:30480-30502 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1203767174 EBV:33552-33574 GGTTGCTGAGGCCGGGGTCCAGG - Intergenic
1189282896 X:39831726-39831748 GGGGGCGGGTGGGGGGGTCCTGG - Intergenic
1190301033 X:49057732-49057754 GTGGGCTGCTGCAGGGGTCTGGG + Intronic
1190598766 X:52069165-52069187 GGGCGCGGCTGCGGGGTTCCTGG - Exonic
1190610058 X:52184908-52184930 GGGCGCGGCTGCGGGGTTCCTGG + Exonic
1192341517 X:70267406-70267428 TGTTGCTGTTGTGGGGGTCCTGG + Intergenic
1196828266 X:119757962-119757984 GGGTGCTGCGGCGAGGGTCAAGG + Intergenic