ID: 905208192

View in Genome Browser
Species Human (GRCh38)
Location 1:36355014-36355036
Sequence TCACCAGGAAGGTGGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905208186_905208192 2 Left 905208186 1:36354989-36355011 CCACAGCTGGGCTGCAGGTCAGC 0: 1
1: 0
2: 6
3: 64
4: 395
Right 905208192 1:36355014-36355036 TCACCAGGAAGGTGGCCTGCAGG 0: 1
1: 0
2: 0
3: 22
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905208192 Original CRISPR TCACCAGGAAGGTGGCCTGC AGG Intronic
900397244 1:2458140-2458162 GCACAGGGAAGGTGGCCGGCTGG + Intronic
901474226 1:9478538-9478560 CCATCTGGAAGGTGGCCTCCCGG + Intergenic
904130055 1:28268863-28268885 CCACTAAGAAGGTGGCCTCCTGG + Intronic
904756219 1:32770214-32770236 TCGACAGGTAGGTGGCCTGGGGG - Exonic
904971918 1:34426058-34426080 TAACCATGAAGGTGGCAGGCAGG - Intergenic
905208192 1:36355014-36355036 TCACCAGGAAGGTGGCCTGCAGG + Intronic
906204262 1:43978938-43978960 TCCCCAGGAAGGGGACCTGGAGG - Intronic
906322889 1:44827699-44827721 GCACCAGCACGATGGCCTGCGGG + Exonic
906323331 1:44829730-44829752 TCAGCAAGAAGGTGCTCTGCAGG + Exonic
911926994 1:103845453-103845475 TCACCAAGAAGTTGGTCTGGAGG - Intergenic
912431156 1:109629130-109629152 TCTCCTGGAAGTTGGCCAGCTGG - Exonic
917657531 1:177141385-177141407 TCTCCAGTAAGGTAGCATGCTGG + Intronic
917959330 1:180129769-180129791 TCTGCAGGAAGGTGGGGTGCAGG + Intergenic
919516758 1:198534390-198534412 TGACCAGGAAGGAGGCATGGGGG + Intronic
919830336 1:201536456-201536478 CCACCGAGAAGGTGGCCTCCAGG - Intergenic
919925285 1:202188869-202188891 TGGCCAGGAAGGTGCCCAGCTGG - Intergenic
922128079 1:222748968-222748990 TCAGTAGCAAGGTGGCCTGCAGG - Intronic
922782598 1:228264623-228264645 AAACCAGGAAGGTGCCCCGCAGG - Intronic
1063911466 10:10834830-10834852 GCACCATGAAGGCTGCCTGCTGG - Intergenic
1065631813 10:27687897-27687919 TCACCACGAGGGTGGTCTGGAGG + Intronic
1067297466 10:44982902-44982924 TTGCCAGCAAGGTGGCTTGCAGG - Intronic
1067452931 10:46393405-46393427 TCTCCAGCAAGGTGGCCTCAGGG + Intergenic
1069554703 10:69390095-69390117 GCACCTGGAAGGCAGCCTGCTGG - Intronic
1071124625 10:82319711-82319733 TCTCCAGGCAGGTGGGCTGCAGG - Intronic
1071568994 10:86686247-86686269 CCACCAAGGGGGTGGCCTGCAGG + Intronic
1072422771 10:95303478-95303500 TCACCAGCAAGATGGCCAGTGGG + Intergenic
1072782298 10:98259170-98259192 TCCCCAGGCAGGTGACCTGGTGG + Exonic
1073762820 10:106648951-106648973 TCTCCTGGTCGGTGGCCTGCTGG - Intronic
1074465609 10:113679198-113679220 CCACCAGCAAGCTGGGCTGCTGG + Intronic
1075392675 10:122103850-122103872 TCACCAGGCAGCTGGTCGGCTGG - Intronic
1077056506 11:596614-596636 TCCCCAGGAACCAGGCCTGCTGG - Intronic
1077411952 11:2407802-2407824 CCAACAGGAAGGTGACCAGCAGG + Exonic
1077530447 11:3092452-3092474 TGCCCAGGAAGGTGGTCTGGCGG + Exonic
1078644549 11:13128284-13128306 TTACCATGAATGTGGCTTGCAGG - Intergenic
1079732761 11:23956316-23956338 TCACCTGCAGGGTAGCCTGCAGG + Intergenic
1080896493 11:36452645-36452667 CCAGCAGGAAGGTGGACTCCAGG - Intronic
1081061331 11:38481607-38481629 TCTGCCGGTAGGTGGCCTGCTGG - Intergenic
1082768661 11:57188359-57188381 TCACCAGGAAAGTGCACTGTGGG + Exonic
1083882170 11:65554081-65554103 GCACCAGGAAGGCTGCGTGCTGG + Exonic
1085251794 11:75148826-75148848 TCACCAGGGAGCTGGTCTGAAGG + Intronic
1085479662 11:76810692-76810714 ACACCAGGAAGGAGGCCAGGAGG + Intergenic
1087125325 11:94620011-94620033 TGATCAGCCAGGTGGCCTGCCGG + Exonic
1088269673 11:108020915-108020937 TCACCATGAATGGAGCCTGCAGG - Intronic
1088706936 11:112472207-112472229 ACCCCAGGAAGGTTGACTGCAGG - Intergenic
1089194840 11:116688181-116688203 TTACAAAGCAGGTGGCCTGCTGG - Intergenic
1089298681 11:117484811-117484833 TCCCCAGGAAGGAGGCCTCAGGG - Intronic
1089443190 11:118532519-118532541 CCACCAGGCAGGTGGTCCGCAGG + Intronic
1089500596 11:118929393-118929415 TCCCCAGGAGGGTGGGCTGCAGG - Intronic
1090398424 11:126434010-126434032 TCACCAGGGAGGTGGGCAGGGGG + Intronic
1091337903 11:134786225-134786247 GCTGCAGGAAGGTGGCTTGCAGG + Intergenic
1091495428 12:968334-968356 TCACCAGGATTGTGGACTGTTGG - Intronic
1091651473 12:2313450-2313472 TCAGCAGGAAACTGGCTTGCAGG + Intronic
1092260733 12:6952091-6952113 TCAGCAGCAGGGTGTCCTGCAGG + Exonic
1092863699 12:12741932-12741954 TCAACAGGAAGAAGGCCAGCAGG + Intronic
1096479155 12:51926444-51926466 TCTCCAGGAATTTGGCCTGAAGG + Intergenic
1096570958 12:52522869-52522891 TCACCAGGGAGCTTTCCTGCTGG + Intergenic
1096801857 12:54115672-54115694 TCACAAGGAAGGTGGGATCCAGG + Intergenic
1097049717 12:56215011-56215033 TCACCAGAAACGTGTCCTGTAGG + Intronic
1100237291 12:92673483-92673505 TTACAAGGAAGGCAGCCTGCTGG - Intergenic
1101452494 12:104792634-104792656 TCACAGGGAAGGTGACCTGAAGG - Intergenic
1101843475 12:108343686-108343708 TGCTCAGGAAGCTGGCCTGCTGG + Intergenic
1101875100 12:108592275-108592297 CCTCCAGGAACGTGGCCTTCAGG + Exonic
1102192437 12:110998890-110998912 TCACCAAGAAGGTAGCAGGCAGG - Intergenic
1102362839 12:112303210-112303232 TGAACAGGAAGGGGGCCTGCAGG + Intronic
1102751809 12:115301166-115301188 TCACCAGGAATGCGGTCTTCTGG - Intergenic
1103557795 12:121776412-121776434 ACTGCAGGAAGGTGGGCTGCAGG - Exonic
1104097280 12:125569265-125569287 TCCCCAGGAAGCTGGTATGCTGG + Intronic
1104433139 12:128732943-128732965 TCAGCAGGCAGGTGGCCTTTGGG + Intergenic
1104518339 12:129449049-129449071 CAAACAAGAAGGTGGCCTGCAGG - Intronic
1104980439 12:132570991-132571013 GGACCAGGATGCTGGCCTGCGGG + Intronic
1106826897 13:33532902-33532924 TCACCTGGAAGGTGCCCATCTGG - Intergenic
1107417595 13:40215926-40215948 CCATCAGGAAGCTGGGCTGCAGG + Intergenic
1112622568 13:101066918-101066940 TGACCATGAAGGAGGCCTGAGGG - Intronic
1113849122 13:113407967-113407989 TGCCCAGGAACTTGGCCTGCAGG + Intergenic
1114427321 14:22634703-22634725 TCAGCAGGAACGTGGGCAGCAGG + Exonic
1114525288 14:23364325-23364347 TCACCAGTCAGCTGGGCTGCTGG - Intronic
1115348243 14:32365665-32365687 TGACCAGGAGGATGGCCTGGTGG - Intronic
1115633288 14:35266637-35266659 TCACCATTGAGGTGGCCTGCTGG + Intronic
1118761690 14:68884188-68884210 GCACAATGAAGGTGTCCTGCAGG + Exonic
1119779544 14:77269156-77269178 CCACCAGGGAGGTGCTCTGCTGG + Intronic
1119881637 14:78104432-78104454 TCAGCAGTGAGGTGGCCAGCAGG + Intergenic
1122262297 14:100530524-100530546 TCCCCAGGACTGTGGCCAGCTGG + Intergenic
1123937653 15:25201817-25201839 TCACAAGGAAGCTGCCCTCCTGG - Intergenic
1124962234 15:34407575-34407597 TCTCCAGGAAGCAGGCCAGCAGG - Intronic
1124978857 15:34553796-34553818 TCTCCAGGAAGCAGGCCAGCAGG - Intronic
1128106690 15:65050576-65050598 TCATCAGGAAGGTGACTTGCAGG + Intronic
1128786452 15:70400969-70400991 TCACCAGGAAGCTTCCCTGGTGG - Intergenic
1129112350 15:73344780-73344802 TCACCAAGCAGGGGGCCTTCTGG + Intronic
1129288138 15:74541706-74541728 TGACCGGGAAGGTGGGCTGTGGG + Intronic
1129845903 15:78767624-78767646 GCATCAGACAGGTGGCCTGCAGG + Intronic
1134189896 16:12112936-12112958 GCACCTGGAAGGAGGCCTGATGG + Intronic
1134463121 16:14447014-14447036 TCAAGAGGAAGCTGGCCTGGAGG - Exonic
1138406554 16:56799565-56799587 TCCCCAGGAAGGAGGCTGGCAGG + Intronic
1138620955 16:58211020-58211042 TCACCAGCCAGGAGACCTGCAGG + Intergenic
1139528499 16:67530295-67530317 TGACCAGGGAGGGGGCCGGCAGG + Intronic
1139648148 16:68346938-68346960 TGGACTGGAAGGTGGCCTGCAGG + Intronic
1140412515 16:74749401-74749423 ATACCAGGACGGTGGCCTGCAGG - Intronic
1141336336 16:83158713-83158735 TGGCCAGGAAGGTGCCCAGCTGG + Intronic
1141520672 16:84576805-84576827 TCACAATGAAGGCTGCCTGCTGG + Intronic
1141762685 16:86039010-86039032 GCACAAGGAAGGAGGCCTGGAGG + Intergenic
1142176098 16:88646154-88646176 TCCCAAGGATGGTGGCCAGCAGG + Exonic
1143960402 17:10712752-10712774 TCACCAGAAAGGTGCCGGGCTGG + Intronic
1146621406 17:34401342-34401364 TGACCAAGAGGGTGGCCTCCAGG - Intergenic
1147645210 17:42029136-42029158 TGACCATGGAGGTGGCCTGGAGG + Intronic
1148277129 17:46314943-46314965 TCACCAGTGAGGCTGCCTGCTGG + Intronic
1148299245 17:46532519-46532541 TCACCAGTGAGGCTGCCTGCTGG + Intronic
1148363864 17:47037725-47037747 TCACCAGTGAGGCTGCCTGCTGG + Intronic
1148648803 17:49234925-49234947 CCACCAGGAAGGAGGCCAGCTGG - Intergenic
1149276023 17:55038278-55038300 TGACTGGGAAGGTGGCCTGAGGG - Intronic
1149400333 17:56289490-56289512 TCAGCAGGAAGCTAGCCTACAGG + Intronic
1149895700 17:60426799-60426821 TCACCAGGAACTTGGCCGGCTGG - Exonic
1150299873 17:64038881-64038903 ATTCCAGGAAGGTGGCCAGCTGG - Intergenic
1150347058 17:64412311-64412333 TCACGAGGAAGGGAGCCTGGAGG + Intronic
1150403268 17:64876762-64876784 TCACCAGTGAGGCTGCCTGCTGG - Intronic
1151872300 17:76844628-76844650 TCACCAGGAAGACCCCCTGCGGG + Intergenic
1157818703 18:50749967-50749989 CCACCAGGAAGGTGGGGGGCGGG + Intergenic
1157824302 18:50798817-50798839 ATACCAAGAAGGTGGCTTGCAGG - Intronic
1158626898 18:59079401-59079423 TTATCAGCAAGGTGGCATGCTGG + Intergenic
1160344838 18:78124142-78124164 ACGCCAGGGCGGTGGCCTGCTGG - Intergenic
1160738977 19:677263-677285 TCCCCAGGGACGTGGCCTTCGGG - Intronic
1160765744 19:806859-806881 TGACCAGCAGGGCGGCCTGCTGG - Intronic
1160967847 19:1754350-1754372 TCCCCAGCCAGGTGGCCTGGCGG - Exonic
1161684882 19:5697803-5697825 TCACCAGGTAGCGGGGCTGCGGG - Intronic
1162822083 19:13229235-13229257 TCACGAGGAAGGTGGGCAGGAGG - Intronic
1162937977 19:13991217-13991239 TCCCCAGTAAGGTTGCCTGCAGG + Intronic
1166107117 19:40602800-40602822 CCCCCAGGGAGCTGGCCTGCGGG + Intronic
1166742209 19:45121439-45121461 TCACCAGGCAGGAGGACAGCTGG + Intronic
1168267695 19:55231438-55231460 TCCCGTGGAAGGTGGCCTGAAGG + Exonic
927520047 2:23693116-23693138 CACCCAGGAAGGGGGCCTGCAGG + Intronic
927559888 2:24062623-24062645 TCACCAGCAAGGTGGCAAGGGGG - Intronic
927716456 2:25356250-25356272 GCACCAGGAAGGTGGGCACCAGG + Intergenic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
932500581 2:72179616-72179638 TCATCAGGAAGCTGGCATTCTGG + Intronic
932830616 2:74986185-74986207 TCAGCAGTAAGCTGCCCTGCTGG - Intergenic
933678187 2:85076536-85076558 TGACCAGGGAGGGGGACTGCGGG - Intergenic
935204243 2:100883829-100883851 TGACCAGGTAGGTGGCCTCGGGG - Intronic
936921731 2:117696077-117696099 TCCCCAGGAAGGAGGCAGGCAGG + Intergenic
936954755 2:118013368-118013390 GCACCAGGGAGGTGTCCCGCTGG - Intronic
937134049 2:119537039-119537061 ACACCAGGATGGTGGCCAGGTGG + Intergenic
937973071 2:127565130-127565152 TCAGCAGCAAGGTGACCTTCCGG - Intronic
938902026 2:135806530-135806552 TCACCATGAATGGAGCCTGCTGG - Intronic
939882782 2:147649299-147649321 TCACCAGTAATCTGACCTGCAGG - Intergenic
941583856 2:167332190-167332212 ACAGCAGGAATGTGGACTGCTGG + Intergenic
944667477 2:201969515-201969537 TCAGCAGGATTGTGGCCTCCCGG - Intergenic
947668641 2:231923087-231923109 GCCCAAGGAAGGTGGCCTTCAGG + Intronic
947792524 2:232876290-232876312 GCACCACGCAGGTGGCCAGCAGG - Exonic
948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG + Intergenic
948804465 2:240447510-240447532 TTCCCAGGGAGGCGGCCTGCCGG + Intronic
1168831283 20:846544-846566 GCACCAGAAAGGGAGCCTGCAGG + Intronic
1169261050 20:4138265-4138287 TCTCCAGGAATCTGGCCTCCTGG + Intronic
1170641078 20:18153230-18153252 TCAGAAGGAGGGTGACCTGCAGG + Intronic
1171794854 20:29558794-29558816 TCACAAGGAAGGTGGGATCCAGG - Intergenic
1171853602 20:30325471-30325493 TCACAAGGAAGGTGGGATCCAGG + Intergenic
1173316601 20:41950412-41950434 CCTCCTGGAAGGTGGGCTGCAGG - Intergenic
1176142028 20:63549047-63549069 GCACCAGAGAGGTGCCCTGCTGG + Intronic
1178160375 21:29905319-29905341 TCACCAGGAAGGAGGAAGGCTGG + Intronic
1178773186 21:35524811-35524833 TTACCAGGAAGATGGCATGAAGG - Intronic
1178978180 21:37238704-37238726 ACAGCAGGATGGTGGCCTCCAGG - Intronic
1179124227 21:38577362-38577384 TCACCAAGAAGATGACATGCTGG + Intronic
1179886245 21:44315407-44315429 ACACCCGGAAGATGGGCTGCAGG - Intronic
1179939602 21:44629025-44629047 ACAGCAGGAAGGAGGCCTCCTGG + Intronic
1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG + Exonic
1184404336 22:44291687-44291709 TCACCAGGCAGATGGGCTGCAGG - Intronic
1184490264 22:44804274-44804296 TCACCAGGAAGGAGGCTCGGTGG - Intronic
1184686403 22:46098313-46098335 TCACCATCCAGGTGGCCTGGGGG + Intronic
1185336316 22:50272209-50272231 TCTCCTGGAAGATGGCCTCCAGG - Intergenic
950240789 3:11368392-11368414 TCTCCAGGAAGTTGGTTTGCCGG + Intronic
951139746 3:19147048-19147070 TCACGAGAAAGGGGGCCTGGGGG + Intergenic
953461934 3:43088503-43088525 TCAGCAGGAGGGTGGCTTTCTGG - Intronic
953981323 3:47414556-47414578 TGACCAGGTAAGCGGCCTGCAGG - Exonic
955913137 3:63878936-63878958 TCACCTGGAAGCTGGCCAGCAGG + Intronic
963906751 3:150779325-150779347 TCACCAGCAGGCTGGCCAGCAGG + Intergenic
964939311 3:162135778-162135800 TCACCGGGAAGGTGACCAGATGG - Intergenic
966346694 3:178988807-178988829 TCCCCAGGAAGGTGGTTTGTGGG - Intergenic
967300030 3:188003850-188003872 TCACCAGGAGGGAGCCCGGCAGG - Intergenic
967317532 3:188163363-188163385 TCAGCAGGAAGGGTGCATGCTGG - Intronic
967930653 3:194687939-194687961 TCACCCGCAAGTCGGCCTGCAGG - Exonic
969556957 4:7918367-7918389 TCACCAGGAAACAGGGCTGCCGG + Intronic
969557014 4:7918619-7918641 TCACCAGGAAACAGGGCTGCCGG + Intronic
969557066 4:7918862-7918884 TCACCAGGAAACAGGGCTGCCGG + Intronic
969557076 4:7918904-7918926 TCACCAGGAAACAGGGCTGCCGG + Intronic
969557104 4:7919029-7919051 TCACCAGGAAACAGGGCTGCCGG + Intronic
969690022 4:8699119-8699141 TCAGCAGGAAGGGGCCCTGCTGG - Intergenic
969694248 4:8725765-8725787 TCACCGTGGAGGAGGCCTGCTGG - Intergenic
969756478 4:9153381-9153403 TCCCCTGGCAGGTGGCCGGCGGG + Intergenic
969790211 4:9488991-9489013 ACACTAGAAAGGTGGCCCGCAGG + Intergenic
973641442 4:52906577-52906599 ACAGCAGGAAGGAGACCTGCAGG + Intronic
974660638 4:64883803-64883825 TCACCATGAAGGGGACCTGCAGG - Intergenic
975663759 4:76713034-76713056 TCACCATGAAGGGAGCCTGCAGG + Intronic
979555962 4:122047863-122047885 GCACCAAGAAGGTCGGCTGCAGG + Intergenic
983850327 4:172571929-172571951 GGATCAGGAAGGTTGCCTGCAGG - Intronic
985524865 5:396703-396725 TCACCAGGGAGGAAGCATGCCGG + Intronic
985776463 5:1846629-1846651 CCAACATGAAGGTAGCCTGCTGG - Intergenic
985962456 5:3312845-3312867 TGACCAAGAAGATGGCATGCGGG + Intergenic
986004847 5:3659102-3659124 TGAGCAGAAGGGTGGCCTGCAGG + Intergenic
986413104 5:7501795-7501817 CCACCAGGCAGGGAGCCTGCAGG + Intronic
989367636 5:40674708-40674730 TCAACAGGAAGGCTGCCAGCAGG + Intergenic
993556217 5:89342725-89342747 TCACCAGGAAGCAGGACTGTGGG + Intergenic
996411202 5:123161502-123161524 TCACTGGGAAGGTGGCCTTTGGG + Intronic
998985055 5:147747607-147747629 GCACCTGGAAGATGGTCTGCGGG - Intronic
999275995 5:150330565-150330587 GCACCCAGAAGGTGGGCTGCGGG + Intronic
999711187 5:154319970-154319992 TCAACTGGAAGGTGGCTTGTGGG + Intronic
1000139042 5:158383409-158383431 TCACATGTAAGGTGGCCAGCAGG + Intergenic
1001104624 5:168842718-168842740 TCACCAGGAAGGCAGTCTGAGGG - Intronic
1001644453 5:173269760-173269782 TGCCTAGGAAGGTTGCCTGCAGG + Intergenic
1002792548 6:446723-446745 TCACTGGGAATGTGGACTGCAGG + Intergenic
1003029511 6:2589676-2589698 CCAGCAGGAAGGTGGCCTGAGGG - Intergenic
1003536441 6:6979717-6979739 TCACCAGGAACCAGCCCTGCTGG - Intergenic
1005648781 6:27867179-27867201 TCAACAAGAAGGCGGCCTCCGGG - Exonic
1006303340 6:33205440-33205462 TGACTAGGAAGGTGCCCTGGCGG - Exonic
1006389931 6:33752268-33752290 GCAGGAGGAAGGTGGCCAGCTGG + Intergenic
1007750281 6:44067054-44067076 TCCTCAGGAGGGTGGCCTGGTGG - Intergenic
1009850435 6:69190736-69190758 TCACCATGAAGGGAGCTTGCAGG - Intronic
1010200235 6:73275668-73275690 TCACTGGGATGCTGGCCTGCAGG - Intronic
1012956619 6:105577360-105577382 TCACCAGGAAGGTTGACAGAAGG - Intergenic
1018862290 6:167719978-167720000 TCCCCAGGAAGGCGGCCAGACGG - Intergenic
1021007794 7:15421646-15421668 TCACCAAGAAGGTGGACAGGAGG + Intronic
1023745575 7:43319536-43319558 TGACAAGGAAGGAGGCCGGCGGG - Intronic
1027177600 7:75914829-75914851 TCCCCGGGAAGGTGGGCAGCCGG + Intronic
1028881171 7:95881638-95881660 TCACCATGAGGGTGGCATACTGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1030187906 7:106781140-106781162 TTACCAGCTAGGTAGCCTGCTGG + Intergenic
1031513048 7:122672375-122672397 ACACCAGCATGGTGCCCTGCTGG - Intronic
1031568566 7:123330062-123330084 TCAGCAGGAATGTGGACTGTTGG - Intergenic
1033418523 7:141185470-141185492 TCAGCAGGTCAGTGGCCTGCTGG + Intronic
1034221615 7:149450871-149450893 TTAGCAGGAAGGAGGCCCGCAGG - Intronic
1035361312 7:158315599-158315621 TCACCAGCCAGGTGCACTGCTGG - Intronic
1035833574 8:2725085-2725107 CCAGCAGGAACGTGGCCTGCAGG - Intergenic
1037714412 8:21384895-21384917 TCATCAGGCAGGTGGGCTCCTGG + Intergenic
1038419057 8:27420449-27420471 TCAACAGGGAGGTGGCTGGCAGG - Intronic
1038697033 8:29815700-29815722 GCACATGGAAGATGGCCTGCTGG + Intergenic
1039531843 8:38269309-38269331 TCCCCAGGAAGACGGCCTGGCGG + Intronic
1039885212 8:41650459-41650481 TCAGCAGGAACGTCCCCTGCAGG + Intronic
1039899824 8:41743551-41743573 TGAACAGGGAGGTGCCCTGCAGG + Intronic
1040286084 8:46101108-46101130 TCTCCTGGAAGGAGGCCTTCCGG + Intergenic
1040750814 8:50704593-50704615 TCACCAGGACAGTGACCTGCTGG + Exonic
1041194596 8:55388078-55388100 TCACTAGGGAGGGGGTCTGCTGG + Intronic
1042061856 8:64826917-64826939 TCACCAGGACTGTGGGCAGCAGG - Intergenic
1043737782 8:83768941-83768963 TCACGTGGAAGGCTGCCTGCAGG + Intergenic
1045352246 8:101352553-101352575 TCATCAGGAAGCTGGTCTCCAGG + Intergenic
1047640922 8:126820972-126820994 TCTGCCGGTAGGTGGCCTGCTGG + Intergenic
1049089088 8:140500612-140500634 TCCCCAGATAGGTGGCCTGTAGG - Intergenic
1049179186 8:141212355-141212377 TCACCAGGAATGTGGCCGTCAGG + Exonic
1049382557 8:142324767-142324789 TCACCTGGAAGCTGGCATGGAGG - Intronic
1049410451 8:142471687-142471709 TCACCTGGGAAGTGGCCTGCCGG + Intronic
1049414029 8:142487320-142487342 TCAAAGGGCAGGTGGCCTGCAGG - Intronic
1049542273 8:143214026-143214048 ACAGCAGGACTGTGGCCTGCTGG - Intergenic
1049552795 8:143268149-143268171 TCACCAGGTAGGTGGCCACTGGG - Intronic
1049989627 9:978448-978470 TCTCCCGGAAGGGGGCATGCTGG + Intronic
1053791408 9:41688768-41688790 TCACAAGGAAGGTGGGATCCAGG + Intergenic
1054179757 9:61900461-61900483 TCACAAGGAAGGTGGGATCCAGG + Intergenic
1054473533 9:65557122-65557144 TCACAAGGAAGGTGGGATCCAGG - Intergenic
1054657784 9:67680359-67680381 TCACAAGGAAGGTGGGATCCAGG - Intergenic
1056286260 9:85090747-85090769 TCACCAGGATGGTGGCAGGAGGG + Intergenic
1057075908 9:92138047-92138069 TGGCCAGGAAGGTGCCCAGCTGG - Intergenic
1057242119 9:93420320-93420342 TCTCTTGGAAGGTGGGCTGCAGG + Intergenic
1060110839 9:120905223-120905245 GCAGCATGAAGGTGACCTGCAGG + Exonic
1060551679 9:124488407-124488429 TCACCAGGTTCCTGGCCTGCTGG + Intronic
1060936991 9:127521716-127521738 GTGCCAGGAAGGTGTCCTGCCGG - Intronic
1061962569 9:133995576-133995598 AGAACAGGAAGGTGGACTGCTGG - Intergenic
1062409987 9:136418734-136418756 TCACCTGGAAGGTGGCCTCATGG - Intronic
1185668696 X:1788427-1788449 TAACCAGGAATGTGACCTGAGGG - Intergenic
1186328624 X:8508217-8508239 TCACCAGGACGGATGCCTGAAGG - Intergenic
1187280189 X:17852608-17852630 ACACAAGGAAGGTGTCATGCGGG - Intronic
1187945958 X:24426735-24426757 TCCCAAGGATGGTGGCTTGCCGG + Intergenic
1192316350 X:70054695-70054717 TCTGAAGGGAGGTGGCCTGCTGG + Intergenic
1192491147 X:71578516-71578538 ACACCAGGTAGGTGACCGGCTGG + Intronic
1201433683 Y:13932728-13932750 TCACCAGGATGGATGCCTGAAGG + Intergenic
1201673777 Y:16556365-16556387 TCACCAGAAATGTACCCTGCTGG + Intergenic