ID: 905211627

View in Genome Browser
Species Human (GRCh38)
Location 1:36378309-36378331
Sequence ACAGCCAGTAAGGGCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 4, 2: 19, 3: 103, 4: 507}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905211627 Original CRISPR ACAGCCAGTAAGGGCAGAGC TGG (reversed) Intronic
900101888 1:965480-965502 ACAGCCTGCAAGGTCTGAGCAGG - Exonic
900189184 1:1346113-1346135 ACAGCCAGGGAGGGCGGAGTGGG + Intronic
901448478 1:9322331-9322353 ATAGCCGGTAAGGGCAGAGCTGG + Intronic
901897514 1:12327167-12327189 GCAGCTGGTAAGGGCAGAACAGG + Intronic
902310671 1:15579145-15579167 ACAGCCAAAAAGGGGAGACCTGG + Intronic
902395263 1:16129011-16129033 ACAGCCATGAGGGGGAGAGCAGG - Intronic
902396589 1:16135215-16135237 GCAGGCAGTGAGGGCAGGGCAGG + Intronic
902509680 1:16959424-16959446 ACAGCCGGAAAAGGCAGAGCGGG - Intronic
903163687 1:21506916-21506938 CCAGCAAGCCAGGGCAGAGCTGG + Intergenic
903214254 1:21834581-21834603 ACAGAAAGGAAGAGCAGAGCGGG + Intronic
903372270 1:22844349-22844371 TCAGCCAGGAAGAGCAGGGCTGG + Intronic
903440129 1:23381592-23381614 ACAGCTAATAATGGCAGAGCTGG - Intronic
903494920 1:23759413-23759435 ACAGCCAAGAATAGCAGAGCTGG + Intronic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
904481842 1:30798776-30798798 ACAGCAAGTCAGTGCAGAGATGG + Intergenic
904933826 1:34112312-34112334 AAGGCCATTAAGGGCAGAACTGG - Intronic
905167935 1:36094087-36094109 TCAGCCAGGAAGGGCACAGCAGG + Intergenic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905394528 1:37658338-37658360 ACACCCAGTAAGTGAGGAGCTGG - Intergenic
905561085 1:38927905-38927927 ACAGCTAATAAGGGGAGGGCTGG + Intronic
905627061 1:39496058-39496080 ACGGCTGGCAAGGGCAGAGCAGG - Intronic
905646947 1:39631758-39631780 ACAGCAAGAAAGCGCAGAGCTGG + Intronic
905669874 1:39784713-39784735 ACGGCTGGCAAGGGCAGAGCAGG + Intronic
905883398 1:41478887-41478909 ACAGACAGGAAAAGCAGAGCAGG + Exonic
906345809 1:45013644-45013666 AGAGCCATTAAGAGAAGAGCAGG + Exonic
906516826 1:46443988-46444010 AGAGGCAGGGAGGGCAGAGCAGG + Intergenic
906546531 1:46623228-46623250 ACAGCTTGAAATGGCAGAGCAGG + Intergenic
906793602 1:48679323-48679345 ACAGCCAGTGGTGTCAGAGCTGG - Intronic
907799964 1:57754774-57754796 ACAGCTAGTGAGAGCAGAGCTGG + Intronic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
907837434 1:58123652-58123674 ACAGCTAGTAAGGGCACACCAGG - Intronic
908097913 1:60759516-60759538 ACAGCTGGTAAGGCCACAGCAGG - Intergenic
908400667 1:63770246-63770268 ACAACTATTAAGAGCAGAGCAGG + Intergenic
908402291 1:63782860-63782882 ACAGCCAGTGAGTACAGAGTTGG + Intronic
910738517 1:90489543-90489565 ACAGCCAGTAATGGGATTGCTGG + Intergenic
912163235 1:107011730-107011752 GCATCCTGTAAGGGCAGAGCAGG + Intergenic
912560339 1:110547105-110547127 ACAGCTAGTAATGACATAGCTGG + Intergenic
912972555 1:114297699-114297721 ACAGCCAGTAAAGGCAGGGATGG - Intergenic
913264252 1:117028682-117028704 ACAGACACTAAAGGCAGAGAGGG + Intronic
914343798 1:146781303-146781325 AAAGCCAGAAAGGGCGGACCAGG - Intergenic
914916338 1:151821626-151821648 ACAGCCAGAAGTGGCAGATCTGG + Intronic
915129152 1:153685180-153685202 ACAGCAAGTGAAAGCAGAGCTGG - Intronic
915576565 1:156782857-156782879 ACAACTAGTGTGGGCAGAGCTGG + Intronic
915596723 1:156900472-156900494 ACAGCCAGGAGTGTCAGAGCTGG - Intronic
916492247 1:165312304-165312326 ACAGCAAATAGGGGCAGAGCTGG - Intronic
916594777 1:166233716-166233738 CAAGCCAACAAGGGCAGAGCTGG - Intergenic
917736406 1:177924855-177924877 ACAGCTAGTAAGGATGGAGCTGG - Intronic
919429426 1:197474376-197474398 ACAGCCAGGACTGGCAGAGGTGG + Intronic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
921677879 1:217996846-217996868 ACAAGCTGTAAGGGAAGAGCTGG + Intergenic
924143507 1:241050215-241050237 ACAGCCAGTATGTGTAGATCAGG + Intronic
924323377 1:242871225-242871247 GCAGCTAATAAAGGCAGAGCTGG + Intergenic
924747881 1:246854767-246854789 ACAGCCCTTAAGTGCAGAACTGG + Intronic
924930277 1:248725084-248725106 ACAGCCAGTAATGGGATGGCTGG + Intronic
1063391333 10:5651629-5651651 ACACCTAGTAAGCACAGAGCAGG + Intronic
1064428254 10:15249050-15249072 ACACTCAGTATGGGCTGAGCTGG + Intronic
1065369319 10:24967341-24967363 ACATCCATTAAAGGCAGACCAGG - Intergenic
1065697085 10:28389707-28389729 ACAGCTAGTAATGGCAGATATGG + Intergenic
1066613478 10:37274759-37274781 ACAGCTCATAAGGGCAGTGCGGG + Intronic
1067655459 10:48188317-48188339 GCAGCCAGAAAGGGAAGAACAGG + Intronic
1067945678 10:50686711-50686733 ACAGACCCCAAGGGCAGAGCAGG + Intergenic
1068684181 10:59852684-59852706 ACAGCAAGCCAGGGCTGAGCAGG - Exonic
1069825017 10:71249671-71249693 ACAGCCACAAAGCACAGAGCAGG + Intronic
1069840962 10:71339175-71339197 ACAGCCAGTGAGGGCGAGGCAGG - Intronic
1069944074 10:71973979-71974001 ACAGCCAGTAAGTGGGGAGTTGG - Intronic
1069964070 10:72099375-72099397 ACATCCACTAAGGCAAGAGCAGG + Intronic
1070089239 10:73268641-73268663 AGAGCTAGTTAGGGGAGAGCTGG + Intronic
1070867191 10:79713584-79713606 ACAGACCCCAAGGGCAGAGCAGG + Intronic
1070880983 10:79851708-79851730 ACAGACCCCAAGGGCAGAGCAGG + Intergenic
1070916792 10:80160360-80160382 ACAGCTAGTAACAGCTGAGCTGG - Intronic
1071634106 10:87235808-87235830 ACAGACCCCAAGGGCAGAGCAGG + Intronic
1071647554 10:87368025-87368047 ACAGACCCCAAGGGCAGAGCAGG + Intronic
1071938463 10:90558292-90558314 AAAGCCAGTAAGGACATAGAAGG + Intergenic
1072631367 10:97149115-97149137 TTAGCCAGCAGGGGCAGAGCTGG + Intronic
1072685536 10:97534322-97534344 ACAAGCTGTAAGGGCAGGGCTGG - Intronic
1072894570 10:99355685-99355707 ACAGCCTGTAAGAGCAAAGCTGG - Intronic
1073442358 10:103559589-103559611 ACAGCCAGCAAGAGCAGAACAGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1074627994 10:115215031-115215053 ACAGTAAGTAATGGCAGTGCTGG - Intronic
1075673497 10:124280408-124280430 ACAGCCAGGAAGGGCAGGGCTGG + Intergenic
1075723926 10:124602208-124602230 ACAGCCAGAAGTGGCAGAGCTGG - Intronic
1076119300 10:127922846-127922868 AAAGCCAGAGAGGGCAGAGGGGG - Intronic
1076245381 10:128943389-128943411 ACAGCCTGTAGAGACAGAGCAGG + Intergenic
1077632569 11:3820941-3820963 CCAGCTAATAAAGGCAGAGCTGG + Intronic
1077973089 11:7216392-7216414 ATACCCAGTGAGGGCAGAGAAGG + Intergenic
1077975321 11:7242256-7242278 ATAGCCAATAAGGGCAGCACTGG - Intronic
1077995202 11:7446798-7446820 ACAGACAGAAAGGGCAGGGCAGG - Intronic
1080083119 11:28245181-28245203 ACAGTGAGTAAGGGTAGAGCTGG - Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1080615832 11:33943984-33944006 ACAGCGAGGAGGTGCAGAGCTGG - Intergenic
1080914860 11:36646695-36646717 ACAGCTAAAAACGGCAGAGCTGG - Intronic
1081032436 11:38101436-38101458 CAACCCAGTAAAGGCAGAGCAGG + Intergenic
1081525649 11:43925753-43925775 TCAGCTAGAAAGGGCAGAGCTGG - Intronic
1082898037 11:58213888-58213910 ACAGCCTATCAGGGCAGAGGAGG - Intergenic
1082950856 11:58814454-58814476 ATAGCCAGTAATGGCATTGCTGG + Intergenic
1083172277 11:60930103-60930125 AAAGTAAGAAAGGGCAGAGCAGG + Intronic
1083284722 11:61651067-61651089 ACAGCCAGATATAGCAGAGCTGG - Intergenic
1083713252 11:64561388-64561410 TCACCCAGGAAGGACAGAGCTGG + Intronic
1083828157 11:65214609-65214631 ACTGCAAGGAGGGGCAGAGCAGG - Intergenic
1083998258 11:66282816-66282838 ACAGACAGTGGGGGCAGCGCTGG - Intronic
1084030625 11:66478615-66478637 ACAGCTGGCAAAGGCAGAGCTGG - Intergenic
1084327539 11:68410481-68410503 ATACCCAGTTAGAGCAGAGCTGG + Intronic
1084907870 11:72362570-72362592 ACAGTCAGTAAGTTCAGAGCTGG - Intronic
1085044413 11:73344777-73344799 ACAGCCAGTAAGGGCAGTGCTGG + Intronic
1085200909 11:74701576-74701598 ACAGCCAGTAAGTGGAGGACGGG - Exonic
1085260177 11:75200102-75200124 ACAGCCAGTTGGGGTAGAGCTGG - Intronic
1085321085 11:75574506-75574528 ACAGTCAGTGGGGGCCGAGCTGG + Intergenic
1085417251 11:76327706-76327728 ACAGCAAGTTAGTGAAGAGCTGG + Intergenic
1085475965 11:76789076-76789098 ACAGCAAGGAATGGCAGAGCAGG - Intronic
1085532809 11:77201903-77201925 ACAGGCAGTGGGGGCACAGCTGG + Intronic
1085833875 11:79931583-79931605 ACAGCTAATAAAGGGAGAGCTGG + Intergenic
1086162832 11:83742523-83742545 ACAGCCAGAAAGTGCAGAGGTGG - Intronic
1086818272 11:91400952-91400974 ACATCCAGTAATGGGAGTGCTGG + Intergenic
1088550549 11:111008740-111008762 ACAGCTAGAAGCGGCAGAGCTGG - Intergenic
1088945589 11:114509402-114509424 ACACCCAGTAATGGCACTGCTGG - Intergenic
1089389004 11:118087231-118087253 GAAGTCAGTAAGGGCAGAGCTGG - Intronic
1089781568 11:120876679-120876701 ACAAACAGTAATGACAGAGCTGG + Intronic
1090047898 11:123351806-123351828 ACAGCGAGTAAGAGCAGAGTGGG - Intergenic
1090457414 11:126862006-126862028 ACTGCCAAGAAGGGCAGAGCTGG - Intronic
1091678151 12:2506371-2506393 GTACCCAGCAAGGGCAGAGCTGG - Intronic
1091794464 12:3289798-3289820 AGAGCCAGCTGGGGCAGAGCTGG + Intergenic
1091801507 12:3327540-3327562 CAGACCAGTAAGGGCAGAGCAGG + Intergenic
1091996877 12:5000737-5000759 ACAGCCTCTGAGGGCAGAGGAGG + Intergenic
1092076208 12:5675714-5675736 ATAGCAAGTAATGACAGAGCTGG - Intronic
1092748469 12:11695659-11695681 ACAGCCATGAAGGCGAGAGCTGG - Intronic
1093341680 12:17982766-17982788 AGAGCCAGTTAAGTCAGAGCTGG + Intergenic
1096601514 12:52733096-52733118 AAAGCAAAGAAGGGCAGAGCTGG - Intergenic
1096811426 12:54172888-54172910 ACAGCTAGAAAGGGCCGAGGAGG - Intronic
1097102991 12:56602540-56602562 ACAGCTGGAAATGGCAGAGCAGG + Intronic
1097522953 12:60690838-60690860 ACATCCAGTAATGGCATTGCTGG - Intergenic
1100245868 12:92756449-92756471 ACTGCCAGTAATTGAAGAGCAGG + Intronic
1100245951 12:92757134-92757156 ACAGGCAGAAAAGGCTGAGCAGG - Intronic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1100603755 12:96134026-96134048 ACAGCCAGCAAGGGAGCAGCAGG + Intergenic
1101005709 12:100399141-100399163 ACAGCTAGTGAGGGCCGAACCGG + Intronic
1101806148 12:108065561-108065583 ACAGCTAGAAAGAGCAGAGCTGG - Intergenic
1102289532 12:111687783-111687805 ACAGGTAGTAGTGGCAGAGCTGG + Intronic
1102619723 12:114184339-114184361 ACAGCTAGTCAGGGCAGAGCTGG - Intergenic
1102919483 12:116781124-116781146 ACAGCTAGTCAGTGCAGAGCTGG - Intronic
1103535696 12:121632469-121632491 CCAGCCAGAAAGACCAGAGCTGG - Intronic
1103559061 12:121782785-121782807 ACAGCCAGTGAGGGCAGAGCTGG - Intronic
1103763960 12:123269145-123269167 ACAGCCAGGAGTGGCACAGCTGG - Intronic
1104924751 12:132308416-132308438 GCACCCAGCAAGGGCAGCGCTGG - Intronic
1105205234 13:18217744-18217766 ACAGCGAGAGAGGGCAGAGCAGG - Intergenic
1106753026 13:32794410-32794432 ACAGCCTGTGAGGGGAGAGTAGG - Intergenic
1108635652 13:52332106-52332128 ACAGCCAGTAGTGGCATTGCTGG - Intergenic
1108652155 13:52491142-52491164 ACAGCCAGTAGTGGCATTGCTGG + Intergenic
1109777810 13:67065716-67065738 ACGGTTAGTAGGGGCAGAGCAGG + Intronic
1110693395 13:78458309-78458331 ACAGCCAGTAATGGGATTGCTGG - Intergenic
1113740453 13:112709115-112709137 ACAGCCAGGAGGGGCACAGAGGG - Intronic
1113780691 13:112975396-112975418 ACAGCCACAGATGGCAGAGCTGG - Intronic
1113793221 13:113041596-113041618 ACAGTCAGTATGGGTAGAGGAGG + Intronic
1113895489 13:113761408-113761430 GGAGCCAGGAAGGGGAGAGCAGG + Intronic
1114836317 14:26206750-26206772 ACAGCCAGATTGGGCACAGCTGG - Intergenic
1118738178 14:68717407-68717429 ACAGCAGGTATTGGCAGAGCTGG - Intronic
1119322504 14:73740101-73740123 GGAGCCAGGGAGGGCAGAGCAGG + Exonic
1119456231 14:74758101-74758123 ACTGCCAGTATGGGCAGACATGG + Intergenic
1121089329 14:91170319-91170341 ACAGCTAGAAATGGCTGAGCTGG - Intronic
1121227878 14:92334689-92334711 ACGGCCAGTAAGGGGTGAGCTGG - Intronic
1121255695 14:92528632-92528654 ACAGTAAGCAAGGGCAGACCTGG - Intronic
1121340171 14:93100280-93100302 ACAGCTGGTAGGGGCAGAGCTGG - Intronic
1121446778 14:93983787-93983809 ACAGCCAGGAATGTCAGACCTGG + Intergenic
1121451020 14:94008388-94008410 ACAGCCAGGAGTGACAGAGCTGG - Intergenic
1121554919 14:94829190-94829212 ACAGACTGGAAGGGCACAGCTGG - Intergenic
1121837248 14:97102861-97102883 ACAGCCAGTAGTGGCAGAGCTGG - Intergenic
1121847066 14:97181037-97181059 CCAGCCAGTCATGGAAGAGCGGG + Intergenic
1122115248 14:99524247-99524269 ACAGCCAGGAAGGGTACACCTGG + Intronic
1122287307 14:100659438-100659460 AGAGCCAGTATCAGCAGAGCAGG + Intergenic
1122532815 14:102440638-102440660 AGAGGCAGTGACGGCAGAGCTGG - Intronic
1122689862 14:103527126-103527148 ACAGCCAGTGAGGTCAAAGTGGG - Intergenic
1122938869 14:104972377-104972399 TCAGCCAGGCAGGGCAGGGCTGG + Intronic
1125041738 15:35195766-35195788 TCAACCAGTCAGAGCAGAGCAGG - Intergenic
1125582772 15:40798615-40798637 ACAGGCAGTAAGGGCCGCGTGGG + Intronic
1125989161 15:44088832-44088854 ACAGCCAGTGATGTCAGAGATGG + Intronic
1127101196 15:55566586-55566608 ATATCCAGTAAGGGGATAGCTGG + Intronic
1127263161 15:57340390-57340412 CCAGCCATTAAAGGTAGAGCTGG + Intergenic
1127381505 15:58434475-58434497 ATAGCTGGTCAGGGCAGAGCAGG + Intronic
1127385095 15:58460634-58460656 TCAGCCAGTAAGGGCCAGGCTGG + Intronic
1128239286 15:66090211-66090233 GCAGCCACAAAGGGCAGGGCAGG + Intronic
1128536844 15:68498071-68498093 ACAGCTAGAAAGGGCAGAGCTGG + Intergenic
1128620758 15:69147629-69147651 ACATTTAGTAAGAGCAGAGCTGG + Intergenic
1129108430 15:73323968-73323990 ACAGGCACTCAGGGCAGAGCGGG + Intronic
1129389689 15:75214378-75214400 ACAGCCAGTCAGGTCAGAGTCGG - Intergenic
1129451459 15:75653416-75653438 ACAGCCAGCAAGAGCGGGGCTGG + Intronic
1129555315 15:76502235-76502257 ACAGCCAGTAATGGGATGGCTGG + Intronic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1130286137 15:82556082-82556104 AGAGACAGGAAGGGCAGAGGTGG + Exonic
1130303783 15:82699578-82699600 ACAGCCAGGAAGGCCAGGGATGG - Intronic
1130881219 15:88057688-88057710 ACAGCCCCCAGGGGCAGAGCAGG - Intronic
1131352165 15:91711061-91711083 ACAGTTAGTAACGGCAGAGATGG + Intergenic
1132179129 15:99738506-99738528 ACAGCCACTGAATGCAGAGCTGG - Intergenic
1132621837 16:871445-871467 AGGGACAGCAAGGGCAGAGCTGG - Intronic
1132754865 16:1478625-1478647 ACACCCAGTAAGGGGATTGCTGG - Intergenic
1132855142 16:2041391-2041413 CCAGCCAGGAGGTGCAGAGCTGG + Intronic
1132867685 16:2102012-2102034 ACAGCCAGTGAGAGCAGGGGAGG + Intronic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1134524093 16:14931102-14931124 ACAGCCAGTGAGAGCAGGGGAGG - Intronic
1134548809 16:15129833-15129855 ACAGCCAGTGAGAGCAGGGGAGG + Intronic
1134625254 16:15718590-15718612 ACAGCCAGGAAGTGGACAGCCGG + Intronic
1134684115 16:16146821-16146843 CCAGTCAGTAAGGACAGAGTGGG - Intergenic
1134693347 16:16205319-16205341 TCACACAGCAAGGGCAGAGCAGG + Intronic
1134711684 16:16329587-16329609 ACAGCCAGTGAGAGCAGGGGAGG - Intergenic
1134719536 16:16372886-16372908 ACAGCCAGTGAGAGCAGGGGAGG - Intergenic
1134782970 16:16915641-16915663 ACAGCTGGTAAGAGCAGAGCCGG + Intergenic
1134947890 16:18338999-18339021 ACAGCCAGTGAGAGCAGGGGAGG + Intergenic
1134955144 16:18379106-18379128 ACAGCCAGTGAGAGCAGGGGAGG + Intergenic
1134978505 16:18589382-18589404 TCACACAGCAAGGGCAGAGCAGG - Intergenic
1135877070 16:26212597-26212619 GAAGCCAGGAAGGGCAGAGGTGG + Intergenic
1137494192 16:48956987-48957009 ACAGCAAGTAGTGGCAGAGAAGG - Intergenic
1137529075 16:49265458-49265480 ACAGCTGATCAGGGCAGAGCTGG + Intergenic
1137529095 16:49265628-49265650 ACAGCTGATCAGGGCAGAGCTGG - Intergenic
1137587888 16:49675007-49675029 ACAGCCGCCCAGGGCAGAGCGGG + Intronic
1137693602 16:50446668-50446690 ACAGCAAGTTATGGCAGAGCTGG + Intergenic
1138387470 16:56645687-56645709 ACAGCCAGTAAGGGATGAAGTGG - Intronic
1138434155 16:56987962-56987984 ACAGCAATGAGGGGCAGAGCTGG - Intergenic
1138581676 16:57945684-57945706 CCTGCCAGTAAGCGTAGAGCTGG - Intronic
1138647012 16:58432879-58432901 ACAGCCGATATGTGCAGAGCTGG + Intergenic
1139549778 16:67666859-67666881 CCAGCAAGCGAGGGCAGAGCTGG - Exonic
1139656308 16:68389169-68389191 ATAGGCAGTAGGAGCAGAGCAGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1139965803 16:70744711-70744733 AGAGCCACTAAGGCCACAGCTGG + Intronic
1139990195 16:70934032-70934054 AAAGCCAGAAAGGGCGGACCAGG + Intronic
1140041630 16:71412159-71412181 ACAGCCAGGCAGGGCACAGTAGG + Intergenic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140631183 16:76854456-76854478 ATAGCCTGCTAGGGCAGAGCGGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141678206 16:85528856-85528878 ACAGGCAAAAAGGGAAGAGCTGG + Intergenic
1141921764 16:87140285-87140307 ACCGCTAATGAGGGCAGAGCTGG + Intronic
1142097328 16:88248788-88248810 TCAGCCAGTAGTAGCAGAGCGGG + Intergenic
1142233104 16:88909025-88909047 AGCTCCAGGAAGGGCAGAGCCGG - Intronic
1142720649 17:1773568-1773590 TCAGCTAGTACAGGCAGAGCTGG - Intronic
1143377601 17:6476564-6476586 GCAGCCAGTGACGGAAGAGCTGG - Intronic
1143421187 17:6793863-6793885 ACAGCCACTTTGTGCAGAGCAGG + Intronic
1143699606 17:8648411-8648433 ACAGCAAGTCAAGGCAGAGCTGG + Intergenic
1143706131 17:8698815-8698837 TCAGCCAGGAAGGGGAGAGGAGG + Intergenic
1143803220 17:9402706-9402728 TCAGCCAGTTAGTGCAGAGTAGG - Intronic
1144025425 17:11272479-11272501 CCAGCTAGTGAAGGCAGAGCGGG - Intronic
1144115854 17:12089655-12089677 AAAGACAGTAAGAGCAGAGTAGG - Intronic
1144577678 17:16439253-16439275 ACAGCCTGGCAGGGCAGCGCGGG + Intergenic
1144623647 17:16833553-16833575 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1144648633 17:16991844-16991866 ACAGCCAGTCAGGACAGTGTTGG - Intergenic
1144882782 17:18439163-18439185 ACAGCTGGTAAGGGCAGAGCAGG + Intergenic
1144957549 17:19026752-19026774 ACAGCAAGAAAGGTCAGAGCTGG + Intronic
1144977607 17:19147764-19147786 ACAGCAAGAAAGGTCAGAGCTGG - Intronic
1145016948 17:19405276-19405298 ACAGCTATTAATGGCAGAGCTGG - Intergenic
1145149449 17:20505223-20505245 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1145746900 17:27326807-27326829 ACAGCAAGTTAGTGCAGAGCTGG + Intergenic
1145781763 17:27568250-27568272 ACAGCAAGTGAGCCCAGAGCTGG - Intronic
1145919363 17:28599023-28599045 CCAACCAGGAAGCGCAGAGCAGG - Exonic
1146094722 17:29918299-29918321 CCAGCTAGAAATGGCAGAGCTGG - Intronic
1146219007 17:31002254-31002276 TCAGCCAGTCATGGCAGAGCTGG + Intergenic
1146269625 17:31476547-31476569 ACAGGTAGTAATAGCAGAGCTGG + Intronic
1146448649 17:32953984-32954006 GCAGCCAGTAAGGGAAGAACTGG + Intergenic
1146634457 17:34493782-34493804 ATAGCTAGAAAAGGCAGAGCTGG - Intergenic
1146655124 17:34630471-34630493 ACAGACAGTCAGGCCAGAGGGGG + Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147497648 17:40932883-40932905 CCAGCCAGTAAGCGCGGAGCAGG - Intronic
1147577978 17:41613485-41613507 ACAGTTGGTAAGGGCAGAGCAGG - Intronic
1147951371 17:44109824-44109846 ACTGCCAGGAGGGGCTGAGCAGG + Intronic
1148124180 17:45228477-45228499 GAAGCCAGTAAGAGGAGAGCTGG - Intronic
1148142801 17:45340244-45340266 ACAGCTAGAAAGGGCAAAGTTGG + Intergenic
1148441215 17:47712524-47712546 ACAGCCTGAAAAGTCAGAGCTGG + Intergenic
1148867307 17:50635190-50635212 GCAGCCGGGAAGGGCAGAGCAGG - Intronic
1149051678 17:52312167-52312189 ACAACCAGTCATGTCAGAGCTGG - Intergenic
1149358182 17:55866003-55866025 ACAGGTAGTGAGGGCAGGGCTGG - Intergenic
1150158324 17:62872532-62872554 ACAGCCAGTAAATGGGGAGCTGG - Intergenic
1150303186 17:64063183-64063205 AGCCCCAGTAGGGGCAGAGCAGG - Intronic
1150459764 17:65339740-65339762 ACAGGTAGAAATGGCAGAGCAGG - Intergenic
1151556431 17:74849190-74849212 ACAGCAGGACAGGGCAGAGCCGG + Intronic
1151651986 17:75475795-75475817 ACAGCCATGCAGGGAAGAGCCGG - Intronic
1151781485 17:76249357-76249379 ACAGCCAATAATGGAAGACCTGG - Intergenic
1152233618 17:79127034-79127056 GCAGCCAGGATGGGCAAAGCTGG - Intronic
1152369404 17:79877193-79877215 ACAGCCAGTAACAGTAGGGCAGG - Intergenic
1152879096 17:82805266-82805288 ACAGCAAGTAGGCGTAGAGCAGG + Intronic
1153256644 18:3178356-3178378 ACAGCCAGGAACAGCAGAGGAGG + Intronic
1153811215 18:8753554-8753576 CCAGGGAGTCAGGGCAGAGCTGG - Intronic
1153811359 18:8754900-8754922 CCAGGGAGTCAGGGCAGAGCTGG - Intronic
1154123525 18:11670547-11670569 GCAGCCATCCAGGGCAGAGCTGG - Intergenic
1155587541 18:27384753-27384775 ACAGCAAGTAAGGTCTGAGCAGG + Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1157113774 18:44844551-44844573 ACAGTTAATAAGGCCAGAGCTGG + Intronic
1157271917 18:46282819-46282841 ACAGCTGGTAAGGGCGGAGCAGG - Intergenic
1160337987 18:78059836-78059858 CCAGCCTGTGAGGGGAGAGCAGG + Intergenic
1160701702 19:510666-510688 ACGGCCACCGAGGGCAGAGCTGG + Intronic
1160710753 19:549941-549963 ACAGCCAGCATGGACAGAGGTGG - Intergenic
1160877599 19:1304453-1304475 GCAGCCGCTAAGGGCAGGGCTGG + Intergenic
1160918985 19:1510975-1510997 ACAGCCAGTCAGGGCAGAGCCGG - Exonic
1161457802 19:4378322-4378344 ACAGCCCCGAACGGCAGAGCTGG - Intronic
1161658481 19:5530718-5530740 ACAGCCAAGAAGTGCAGAGAGGG - Intergenic
1162324297 19:9989653-9989675 ACAGCAAGTTTGGGCAGAGCTGG - Intronic
1162791201 19:13063992-13064014 AGGGCCAGAAAGGGCAGTGCTGG + Intronic
1164738022 19:30556275-30556297 GCAGCCAGCAGGGGCAGAACAGG - Intronic
1164739311 19:30564799-30564821 GCACCCAGTGAAGGCAGAGCAGG - Intronic
1165041043 19:33067769-33067791 TCAGCCAGCAAGGGGAGTGCTGG - Intergenic
1165075217 19:33276587-33276609 ACAGCCAGTGAGACCAGAGCTGG - Intergenic
1165305139 19:34999089-34999111 ACAGACAGTAGGGGCAGGGATGG + Intronic
1166068093 19:40371853-40371875 ACCGCCAGGTAGGCCAGAGCAGG - Exonic
1166367818 19:42286154-42286176 CCAGCCAGGAAGGGCAGGTCTGG + Intronic
1166710174 19:44931752-44931774 ACAGCCAGGAAGTGGAGAACTGG + Intergenic
1167031883 19:46967797-46967819 ACAGCAAGGAAAGGCAGTGCGGG - Intronic
1167388161 19:49176878-49176900 ACAGCAAGAAAGGGCCAAGCTGG - Intronic
1167621257 19:50562267-50562289 ACACCTAGAAATGGCAGAGCCGG - Intronic
1167698296 19:51027441-51027463 GCAGCCAGTAAGTGAACAGCTGG - Exonic
925219129 2:2123578-2123600 ACATCTTGTAAGGCCAGAGCAGG - Intronic
925664050 2:6234181-6234203 GCAGGCAGTAAGTGCAGAGCCGG + Intergenic
925720776 2:6824537-6824559 ATACCCAGTAAGGGCATTGCTGG - Intergenic
925952423 2:8927639-8927661 ACAGGCAGGAGGGGTAGAGCTGG + Intronic
926051873 2:9750299-9750321 ACAGCAAGTACCTGCAGAGCTGG - Intergenic
926694135 2:15758841-15758863 ACAGCCAGCAAGAGCAGAGCTGG - Intergenic
926780568 2:16467372-16467394 AAAGCCAGTCATGGCAAAGCTGG - Intergenic
927706646 2:25300258-25300280 ACAGCCTGTGAGGCCAGAGGTGG + Intronic
927712699 2:25335684-25335706 ATAGCCAGTAACCGGAGAGCTGG - Intronic
927845922 2:26472934-26472956 ACAGCCAGAGAGGGCAGAACTGG - Intronic
928116452 2:28548499-28548521 CCAGCCAGCCAGGACAGAGCTGG - Intronic
928167378 2:28981078-28981100 GCAGCCAGGAAGTGCATAGCTGG - Intronic
928179674 2:29059541-29059563 ATTGCCAGTGAGGGCAGAGCAGG - Exonic
928406596 2:31019721-31019743 ACAGTGAGTGAGTGCAGAGCTGG - Intronic
928408119 2:31030789-31030811 ACAGCCAAGAAGGGCAGAGACGG + Intronic
928909537 2:36405392-36405414 ACAGCGGGTAGGGGCAGAGCTGG - Intronic
929279999 2:40067147-40067169 ATAGCCAGTAATGGGATAGCTGG + Intergenic
930204091 2:48571353-48571375 AAATCCAGTTAGTGCAGAGCTGG - Intronic
930293182 2:49521138-49521160 ACAGAAAGTAAGAGCAGACCAGG + Intergenic
930879091 2:56251647-56251669 ACAGCAAGAAGAGGCAGAGCAGG - Intronic
931436303 2:62250292-62250314 AGAGACAGGAAGGGCAGGGCAGG - Intergenic
931462613 2:62461831-62461853 ACTGCCTGTAATGGCCGAGCTGG + Intergenic
931922319 2:67034223-67034245 TCAGCTAGCAAGAGCAGAGCTGG + Intergenic
932298322 2:70645023-70645045 ACAGCTAGCAGTGGCAGAGCTGG + Intronic
933189588 2:79319515-79319537 ACAGTAAGTAAGGGGAGAGGAGG - Intronic
933805424 2:85995576-85995598 ACAGGCAGGAAGGTCAGAGGTGG + Intergenic
934469056 2:94498644-94498666 ACACCCAGTAATGGCATGGCTGG - Intergenic
934551245 2:95263588-95263610 GCAGGCAGCAAGGGCAGGGCAGG - Intergenic
934839408 2:97615867-97615889 GCAGCCAGAAAGGACAGGGCAGG + Intergenic
935096429 2:99948672-99948694 AGAGCCCGCAAGGCCAGAGCAGG + Intronic
935211214 2:100940719-100940741 ACAGCCAGACAGTGAAGAGCTGG + Intronic
935629859 2:105204480-105204502 ACAACTAGTAAGGGCTGAGCTGG - Intergenic
936005477 2:108883470-108883492 ATAACCAGCAAGGGCAGGGCTGG + Intronic
936095479 2:109527898-109527920 GGAGCCAGGGAGGGCAGAGCAGG + Intergenic
936144533 2:109971076-109971098 ACAGCTATCCAGGGCAGAGCTGG - Intergenic
936181217 2:110269039-110269061 ACAGCTATCCAGGGCAGAGCTGG - Intergenic
936200154 2:110400393-110400415 ACAGCTATCCAGGGCAGAGCTGG + Intergenic
937064268 2:119005481-119005503 ACAGCTAGGAAGGGCAGAGCTGG + Intergenic
937102629 2:119283370-119283392 GGAGGCAGGAAGGGCAGAGCTGG - Intergenic
937234720 2:120423722-120423744 AGGACCAGTAAGGGCAGAGCAGG - Intergenic
937622489 2:124004709-124004731 ACGGCCAGTGAGGGAAGACCAGG - Intergenic
937909470 2:127068552-127068574 CGAGCCAGTAGGTGCAGAGCTGG - Intronic
937928712 2:127188208-127188230 ACAGAGAGGAAGGGCAGGGCGGG - Intronic
938262413 2:129905367-129905389 ACCCCCAGGAAGGGCAAAGCTGG + Intergenic
938770134 2:134494770-134494792 ACAGCCAGTTAGAGCATGGCAGG + Intronic
941454694 2:165701445-165701467 ACAGCCAGTTAGGGCAGGCCAGG - Intergenic
943033009 2:182708196-182708218 AAAGCTAGTAGGGGCAGAACTGG - Intergenic
943942211 2:194012924-194012946 ACAGCCAGTAATGGGATTGCTGG - Intergenic
944984456 2:205159519-205159541 ACAGCTAGCAAGGACTGAGCTGG - Intronic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
946030520 2:216700217-216700239 CCAGACAGATAGGGCAGAGCAGG + Intergenic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
946155652 2:217804954-217804976 ACAGTCAGTAGGGGTAGGGCTGG - Intronic
946178726 2:217937509-217937531 ACTCCCAGAAATGGCAGAGCTGG - Intronic
946201274 2:218072225-218072247 ACAGCCAGTAAGGACAGGGCTGG + Intronic
946229068 2:218280451-218280473 GCAGCCAGCCAGGGCAGAACAGG + Intronic
946324024 2:218973904-218973926 ACAGTGAGAAAGGGCAGTGCAGG - Intergenic
946336205 2:219038344-219038366 ACAGCCAGGGCAGGCAGAGCAGG - Intronic
946487026 2:220110608-220110630 ACAGATAGTAATGACAGAGCTGG + Intergenic
947310637 2:228798053-228798075 ACAGATAGAAAGGACAGAGCAGG - Intergenic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
948473347 2:238200967-238200989 ACAGTTAGTAAGCGAAGAGCTGG + Intronic
948726120 2:239935097-239935119 ACAGCCAGGAAGGACATGGCAGG - Intronic
948759871 2:240183867-240183889 GCAGCCAGGAAGGGCGGGGCAGG + Intergenic
1169257626 20:4111052-4111074 AGAGGCAGAAAGGGCTGAGCGGG - Intergenic
1169521069 20:6373266-6373288 TCAGCAAGAAAGGGCAGAGAAGG + Intergenic
1170550149 20:17469568-17469590 AGAGTCACAAAGGGCAGAGCAGG + Intronic
1171181532 20:23094431-23094453 AGAGCCAGTCCGGGCAGAGAAGG + Intergenic
1172065376 20:32216188-32216210 ACAGCCAGTAAGGGCACTGTTGG - Intronic
1172122140 20:32604692-32604714 ACAGCAAATTAGGGCAGAGCAGG + Intronic
1172627773 20:36358051-36358073 ACAGCCAGTGACAGCAGAGCTGG - Intronic
1172772667 20:37390800-37390822 ACAGCCAGCAAGTGGTGAGCTGG + Intronic
1172788800 20:37488089-37488111 AGAGACAGACAGGGCAGAGCAGG - Intergenic
1172996320 20:39072596-39072618 ACAGCCTCTCAGGGCCGAGCTGG - Intergenic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173058279 20:39637100-39637122 ACTGGCAGAAAGGTCAGAGCTGG - Intergenic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1173955935 20:47032696-47032718 ACAGCCAGTGAGTGCAGAGGCGG - Intronic
1174096791 20:48096264-48096286 ACAGCCAGAAGGGGCTGACCAGG + Intergenic
1174339597 20:49887533-49887555 ACAGCCAATATGGGCATAACTGG + Intronic
1175136088 20:56825298-56825320 CCAGCCAGTAAGGGAAGGTCTGG + Intergenic
1175466296 20:59192805-59192827 ATGGCCGGCAAGGGCAGAGCGGG + Exonic
1175744031 20:61441360-61441382 ACAGCTAGTTGGGGCAGAGCTGG + Intronic
1175774622 20:61645254-61645276 ACAGCCATGCAGGGCAAAGCTGG - Intronic
1176064458 20:63187478-63187500 ACATCAAGTCAGGGCAGGGCAGG - Intergenic
1176083837 20:63286914-63286936 CCAAGCACTAAGGGCAGAGCTGG - Intronic
1176171596 20:63698837-63698859 ACAGCCACTGGGGGCAGAGGTGG - Exonic
1176232608 20:64039851-64039873 ACAGCCAGCAATGTAAGAGCTGG + Intronic
1177949782 21:27520494-27520516 ACAGCCAATAAAAACAGAGCTGG - Intergenic
1178105805 21:29317923-29317945 ATAGCTAGTAGTGGCAGAGCTGG + Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1178751518 21:35308625-35308647 AAAGCCGGTAATGGCAGATCAGG + Intronic
1178905163 21:36630707-36630729 AGAGCTACTAAGGGCGGAGCAGG - Intergenic
1178976970 21:37228289-37228311 GCAGCCACTAACGGGAGAGCTGG - Exonic
1179253299 21:39692486-39692508 ATAGCCAGTAATGGCATTGCTGG + Intergenic
1179469689 21:41602246-41602268 ACAGCCAGTGGCGACAGAGCTGG - Intergenic
1180065116 21:45408570-45408592 ACAGACAGTAGGGGCTGGGCTGG + Intronic
1180197036 21:46203127-46203149 ACAGCCAGAAGGGGCAGGGATGG + Intronic
1180829001 22:18888237-18888259 ACAGCCAGAGAGGGCAGAGCGGG + Intergenic
1181046702 22:20218051-20218073 ACAGGCAGTAAGGGTTGAGGGGG - Intergenic
1181525684 22:23484390-23484412 ACAGGGAGAGAGGGCAGAGCGGG + Intergenic
1181609230 22:24001481-24001503 ACAGTCAGTAAGGGCTGGGAAGG + Intergenic
1181878634 22:25959791-25959813 AGGGTCAGAAAGGGCAGAGCTGG + Intronic
1182309665 22:29395575-29395597 ACAGCTAGGAGGGGCTGAGCAGG - Intronic
1182353449 22:29711382-29711404 ACAGCCAGGAAGGTCTGAGGTGG + Intergenic
1182361992 22:29752143-29752165 ACACATAGGAAGGGCAGAGCAGG + Intronic
1183009370 22:34932246-34932268 GCAGCCTGTAAGTGCAGAGCTGG - Intergenic
1183061011 22:35336410-35336432 CCTGCCAGCCAGGGCAGAGCTGG - Intronic
1183316652 22:37140849-37140871 ACAGCCAGGAAGTACACAGCTGG - Intronic
1183349903 22:37329324-37329346 GCAGGCAGGCAGGGCAGAGCAGG + Intergenic
1183355509 22:37356781-37356803 ACAGCTGGTAAGTCCAGAGCAGG + Intergenic
1183491717 22:38120472-38120494 AGAGCCAGGCAGGGCAGAGCCGG + Intronic
1183743681 22:39681569-39681591 ACAGCCAGGAATGACAGAGCAGG + Intronic
1183931112 22:41236767-41236789 CCAGCCAGGAAGTGCAGCGCTGG + Intronic
1183952692 22:41360491-41360513 ACCTCCAGAAAGGGCAGAGGTGG - Intergenic
1184160579 22:42695006-42695028 ACAGCCAGCAATGACAGTGCAGG + Intronic
1184693323 22:46127250-46127272 ACAGACTGCAAGGCCAGAGCAGG - Intergenic
1185360262 22:50402464-50402486 GCGGCCAGTAAGGGCAGGGTGGG - Intronic
1203279092 22_KI270734v1_random:114225-114247 ACAGCCAGAGAGGGCAGAGCGGG + Intergenic
950222890 3:11210042-11210064 CCAGCCAGTAAGGGAAGAGGCGG - Intronic
950670153 3:14521115-14521137 AAAGGAGGTAAGGGCAGAGCAGG - Intronic
950744082 3:15073221-15073243 ACAGACAGGAAGTGCAGAGCAGG + Exonic
952142780 3:30498462-30498484 ACAGCTGGCAGGGGCAGAGCTGG - Intergenic
952314068 3:32217439-32217461 ATAGCTAGAAATGGCAGAGCTGG + Intergenic
953136242 3:40184498-40184520 ACAGCCAATGTAGGCAGAGCTGG + Intronic
954193996 3:48985314-48985336 ACAGCCACTGAGGGCACAGGAGG - Exonic
954235921 3:49257066-49257088 TAAGACAGTAAGGGCAGTGCAGG + Exonic
954629083 3:52038584-52038606 ACAGCCACTGAGGGCAGACATGG - Intergenic
954749289 3:52804585-52804607 ACACCCAGTGGGGGAAGAGCTGG + Intronic
955316698 3:57945238-57945260 ACAGGCAGCAAGGGCTGAGATGG - Intergenic
955823862 3:62924473-62924495 ACAGCCATCAGGGGCAGAGGTGG - Intergenic
955939240 3:64132294-64132316 AGAGCCATTCAGGGCAGAGTAGG - Intronic
955975402 3:64475225-64475247 TCAGCCACTAGGGGCAGAGGAGG + Intergenic
956776667 3:72570932-72570954 AGAGCCAGTAAGGGGTCAGCTGG - Intergenic
956785646 3:72640092-72640114 ACAGCTAGTAGTGGCAGAGCTGG + Intergenic
958708062 3:97681517-97681539 GCAGCCATTAAGGACAGTGCAGG + Intronic
960793476 3:121458650-121458672 ACAGACAGAGAGGACAGAGCTGG + Intronic
962458012 3:135583030-135583052 GGAGCCAGTCAGGGAAGAGCTGG - Intergenic
962843159 3:139253278-139253300 ACAGCAAGTGAGAGCAGAGCTGG + Intronic
962911054 3:139850045-139850067 ATACCCAGTAAGGGCATTGCTGG + Intergenic
964019179 3:151986451-151986473 ATAACTAGTAAGTGCAGAGCTGG + Intergenic
964207828 3:154194375-154194397 ATAACTAGTAAGGGCAGACCTGG + Intronic
964408495 3:156374723-156374745 ACAGCCATAAGTGGCAGAGCTGG - Intronic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
965904651 3:173689048-173689070 GCAGCCAGTAAGAGCAGATCTGG - Intronic
966560855 3:181318785-181318807 ACAGCAAGGAAGGGAAGAGAAGG - Intergenic
967275347 3:187768722-187768744 GCAGTGAGAAAGGGCAGAGCAGG + Intergenic
967420972 3:189272337-189272359 ACAGCCAGTCCTGGCAGAGTTGG - Intronic
968943212 4:3650094-3650116 ACAGACAGAATGGGCAGAGTGGG - Intergenic
969288474 4:6222932-6222954 ACAGCTAGTGAGAGAAGAGCTGG + Intergenic
969459818 4:7323010-7323032 ACACCCATTGAGGGCAGAACTGG - Intronic
970467851 4:16345432-16345454 ACTGCCAGTGAGGGCACAGATGG - Intergenic
971960844 4:33485259-33485281 ACAGCCAGGAAGGGCAAAGCTGG + Intergenic
973012771 4:45096863-45096885 ACAGCCAAAAAGGGAAGAGAAGG + Intergenic
973611881 4:52643825-52643847 TCAGCCAATAAGAGCAGATCTGG + Intronic
974911812 4:68132311-68132333 CTAGCCAGCAATGGCAGAGCAGG - Intergenic
975438364 4:74380737-74380759 ACAACCTGTAAGGGTAGAGAAGG - Intronic
976196873 4:82540958-82540980 ACAGCTAGTAGAGACAGAGCTGG - Intronic
976628824 4:87216993-87217015 ACAGCCAATAAGTGGAGATCTGG + Intronic
977835548 4:101641744-101641766 ACAGTCACTAAGGAGAGAGCAGG - Intronic
979980258 4:127246568-127246590 ACAGCTAGTAAGGACAGACGTGG + Intergenic
980755543 4:137154650-137154672 ATACCCAGTAATGGCAGTGCTGG + Intergenic
981811657 4:148782436-148782458 AGAGAGAGTAAGGGCAGAGCAGG - Intergenic
982127805 4:152199527-152199549 ACTGCTAGTAAGGGTGGAGCTGG - Intergenic
982860179 4:160438480-160438502 ATACCCAGTAATGGCATAGCCGG - Intergenic
984331440 4:178325418-178325440 ACAGCCAGTAATGGGATTGCTGG + Intergenic
985671456 5:1208985-1209007 ACAGACAGGGAAGGCAGAGCAGG - Intronic
989812685 5:45696289-45696311 GCAGCCACTAAGGGCAGCGGCGG - Intergenic
991771245 5:70042992-70043014 ACAGGCATTAAGGGCACACCAGG - Exonic
991850537 5:70918409-70918431 ACAGGCATTAAGGGCACACCAGG - Exonic
993089397 5:83405867-83405889 AGAGCCAGCAAGGGTAGAGAGGG - Intergenic
993105135 5:83592103-83592125 ACAGCCAACAAAGGCAGAGCAGG + Intergenic
994147824 5:96414158-96414180 ACAGCTGGTAAGAGCAGAACTGG - Intronic
995070193 5:107912306-107912328 ATAGCTAGTAAGTCCAGAGCTGG + Intronic
995347483 5:111137165-111137187 AGAGCCAGTGAGGTCAGGGCTGG + Intergenic
997302683 5:132817929-132817951 ACAGCTAGTAAATGCAGAGCTGG + Intergenic
997474096 5:134132841-134132863 ACAGCCAGGCAGGGCCAAGCAGG - Intronic
997778160 5:136629839-136629861 TCAGCCATAAAGGGCAGAGCTGG - Intergenic
998978746 5:147677068-147677090 ACAGCTACTAAAGGCAGAGGTGG - Intronic
999131478 5:149286845-149286867 ACAACCAGTAAGTGTGGAGCTGG + Intronic
999257944 5:150220235-150220257 ACAGCAAGTCTGGTCAGAGCTGG + Intronic
999273214 5:150310334-150310356 ACAGCTAGGAAGGGTGGAGCTGG - Intronic
999811117 5:155128174-155128196 CCAGCTAGCAAGTGCAGAGCTGG + Intergenic
1000105514 5:158055317-158055339 ACAGCTGGGAAGGGCAGGGCTGG - Intergenic
1000925887 5:167193487-167193509 ACAGACAGAAAGGGCAGGGTGGG + Intergenic
1001003846 5:168032101-168032123 TCTGCCAGTAGTGGCAGAGCTGG - Intronic
1001546410 5:172573164-172573186 ACAGCCAGCAATGCCAGAGCAGG - Intergenic
1001808802 5:174611139-174611161 GCAACCAGTAGTGGCAGAGCTGG + Intergenic
1001892642 5:175352008-175352030 GCAGCCAGTGAGGGCAGAGCTGG + Intergenic
1001945401 5:175773717-175773739 ACAGCCAGAACTGGCAGACCTGG - Intergenic
1002436529 5:179235040-179235062 TCTGCCAGAAAGGGCAGGGCAGG - Intronic
1002791485 6:440838-440860 ATAGACAGTAAGGGAAGAGATGG - Intergenic
1003078983 6:3005876-3005898 ACAGCTACAATGGGCAGAGCTGG + Intronic
1003638378 6:7855486-7855508 ACAGCCAGCAAGGGCAGAGCTGG - Intronic
1003804378 6:9710032-9710054 ACAGCAAGTCAGAGCAGTGCTGG + Intronic
1004263094 6:14125348-14125370 ACAGCCAGTAACTACAGAGTTGG + Intronic
1004396445 6:15249357-15249379 ACAGTCAGTAGGTACAGAGCCGG - Intronic
1006034988 6:31204362-31204384 ATAGCCAGTAAGTACAGATCAGG - Intergenic
1006446207 6:34081183-34081205 CCAGCTTGTCAGGGCAGAGCTGG - Intronic
1006473130 6:34239034-34239056 ACTGCCTGTAATTGCAGAGCAGG + Intronic
1006717230 6:36128342-36128364 ACAGCTGGTAAGGGCAGAGCTGG - Intronic
1006852583 6:37109722-37109744 ACAGCTAGTTAGGGCAGAGGTGG + Intergenic
1007828511 6:44620035-44620057 AGAGCCAGTAAGTGCAGGGCTGG - Intergenic
1008051149 6:46901630-46901652 ACAGACTTTAAAGGCAGAGCAGG + Intronic
1008208057 6:48687068-48687090 ACTGCCAGAAGGGGCAGGGCAGG - Intergenic
1008952694 6:57177739-57177761 ACAGCTAGTAGTGGCAGTGCTGG + Intronic
1010119015 6:72351991-72352013 TCACATAGTAAGGGCAGAGCTGG + Intronic
1010395498 6:75387400-75387422 ACACCCAGTAATGGCATTGCTGG + Intronic
1014035976 6:116766701-116766723 ACAGGCAGTAATAGCAGAGGAGG - Intergenic
1015855045 6:137615336-137615358 ACAGCTAGTAAAGGCAGAAAGGG - Intergenic
1016140123 6:140598170-140598192 ACAGCCAGTAATGGGATGGCTGG - Intergenic
1016716132 6:147232155-147232177 ACAGCATCTAATGGCAGAGCTGG + Intronic
1016996596 6:149965630-149965652 ACAGCAGGTCAGAGCAGAGCAGG - Intronic
1017177955 6:151522492-151522514 GGCGCCAGTCAGGGCAGAGCAGG - Intronic
1018012651 6:159685693-159685715 ACAGACACTGAGGACAGAGCAGG - Intronic
1019024757 6:168949850-168949872 ACAGCCAGTAATGTCAGGGCAGG + Intergenic
1019856048 7:3609369-3609391 AGAGCTAGTCAGGGGAGAGCTGG + Intronic
1021384761 7:20015693-20015715 ACAGCAAGAAATGGCACAGCAGG - Intergenic
1023110913 7:36809612-36809634 GTAGCCAGTAAGGGCGGAGCTGG + Intergenic
1023418138 7:39950807-39950829 GCAGCCAGGAAGAGCAGAGGCGG - Exonic
1026270026 7:68828507-68828529 ACAGCTTGTAACGGCAGAGTGGG + Intergenic
1026735251 7:72945130-72945152 AGAGCCAGTCAGGGCAAGGCCGG + Intronic
1026766524 7:73163455-73163477 ACAGCCAGGATGAGCAGTGCTGG - Intergenic
1026785593 7:73300059-73300081 AGAGCCAGTCAGGGCAAGGCCGG + Intergenic
1027042999 7:74973150-74973172 ACAGCCAGGATGAGCAGTGCTGG - Intronic
1027045052 7:74985653-74985675 ACAGTTAGTGAGGGCAGAGCTGG - Intronic
1027080644 7:75229206-75229228 ACAGCCAGGATGAGCAGTGCTGG + Intergenic
1027108474 7:75419877-75419899 AGAGCCAGTCAGGGCAAGGCCGG - Intronic
1027976210 7:85159195-85159217 ACTGTCAGTAAGGGTAGAGGAGG + Intronic
1028537009 7:91900995-91901017 ACAGTTAGTAGAGGCAGAGCTGG + Intergenic
1028561813 7:92184264-92184286 ACAGCCAGTAATGGGATGGCTGG + Intergenic
1029263727 7:99322708-99322730 ATAACCAGTAAGGCCAGAGCAGG + Intergenic
1029387803 7:100255257-100255279 ACAGTTAGCAAGGGCAGAGCTGG + Intronic
1029389846 7:100267813-100267835 ACAGCCAGGATGAGCAGTGCTGG + Intronic
1029621174 7:101690631-101690653 ACACCGAGGTAGGGCAGAGCAGG - Intergenic
1030044428 7:105482175-105482197 GCAGCAAGGGAGGGCAGAGCAGG - Intronic
1031325477 7:120391426-120391448 ATACCCAGTAAGGGGAGTGCTGG + Intronic
1032191890 7:129770353-129770375 ACAGCCAGCGAGGGAAGGGCCGG - Intergenic
1033001767 7:137513231-137513253 ACAGCCAGAGAAGGCAGAGGAGG - Intronic
1033020448 7:137719215-137719237 ACAGCCACAAAGGGCAGTGAGGG + Intronic
1033236544 7:139642427-139642449 ACAGCCAGAAAGGCAAGGGCTGG + Intronic
1033877971 7:145845437-145845459 ACAGCCAGTATGCCCAGAGGAGG + Intergenic
1033972906 7:147065122-147065144 ATAGCTAATAAGGGAAGAGCTGG - Intronic
1034472537 7:151263127-151263149 AGAGCTAGTAGGGGTAGAGCTGG + Intronic
1034814959 7:154164192-154164214 ACAGCAGGTCAGGGCAGGGCAGG - Intronic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1036189428 8:6656775-6656797 GCTGCCAGGTAGGGCAGAGCAGG + Intergenic
1036612448 8:10362077-10362099 ACAGCAAGTGAGGGCAAAGTTGG - Intronic
1036750099 8:11438263-11438285 ACAGCCAGGAAAGGGAGAGCAGG + Intronic
1038052635 8:23827913-23827935 TCAGCCACTCAGGGTAGAGCTGG - Intergenic
1038416459 8:27399832-27399854 ACAACCAGTAAGGATGGAGCAGG - Intronic
1038524057 8:28258140-28258162 GCAGCCAGTAAGGGCGCAGCAGG - Intergenic
1039412480 8:37366409-37366431 ACAGCCACTTAGAGAAGAGCTGG + Intergenic
1039427877 8:37501686-37501708 CCAGCGAGTGAGGGCAGAGAGGG + Intergenic
1039599120 8:38819354-38819376 ACAGCCTGAAAGAGAAGAGCTGG - Intronic
1039776277 8:40740154-40740176 ACACCCAGTAATGGCATTGCTGG + Intronic
1039921269 8:41896137-41896159 GCAGGCTGGAAGGGCAGAGCGGG - Intronic
1040575725 8:48649550-48649572 GCGGCCTGTAAGGGGAGAGCCGG + Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1042048157 8:64678056-64678078 ACAGCCCGTTTAGGCAGAGCGGG - Intronic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1043500063 8:80844571-80844593 ACAACCAGATAGGGCGGAGCAGG + Intronic
1044343613 8:91076631-91076653 ACAGCTGGTAAGAGCAGAGCAGG - Intronic
1044384621 8:91572885-91572907 ACACCTAGTAAGGGAATAGCTGG - Intergenic
1045922420 8:107547015-107547037 ACACCCAGTAATGGGAGTGCTGG - Intergenic
1047781121 8:128111891-128111913 ACAGCTGGTCAGGGCAGGGCTGG + Intergenic
1048174348 8:132138389-132138411 ATAGCTAATAAGGGCTGAGCTGG + Intronic
1048258520 8:132924695-132924717 ACAGCCAGTAAAGGCACCACTGG - Intronic
1048329515 8:133462511-133462533 ACAGCCAGCAGTGGCTGAGCTGG + Intronic
1048497638 8:134948307-134948329 ACAACCAGGGAGGGCAGAGCAGG - Intergenic
1048743956 8:137592408-137592430 ACAGCTTGAAAGGGCAGAGCTGG - Intergenic
1049312728 8:141942048-141942070 ACAGCCAGCATGGGCACAACGGG - Intergenic
1049414767 8:142490128-142490150 ACAGCTAGAAAGGACAGGGCTGG - Intronic
1049607327 8:143535830-143535852 ACACTCAGAAAGGGCAGGGCAGG + Intronic
1049906111 9:217865-217887 ACAACCAGCAATGGCAGAGCTGG + Intronic
1049992378 9:1002145-1002167 AAAGCCAGTAAGGGCTGGGTGGG + Intergenic
1049994682 9:1023902-1023924 ATAACCAATAATGGCAGAGCTGG + Intergenic
1050233868 9:3557381-3557403 ACAGCCAGTAATGGGATTGCTGG + Intergenic
1051681933 9:19616415-19616437 ACAGCTAGTAAATGCAGAACTGG + Intronic
1051960194 9:22751007-22751029 ACAGTCAGGAAGGGCAGGCCAGG + Intergenic
1052319903 9:27156618-27156640 ACAGCTATTGAAGGCAGAGCTGG - Intronic
1053304169 9:36972332-36972354 ACAGCAAGTAACAGCAGAGCTGG - Intronic
1053483426 9:38433428-38433450 ACAGCTCTTCAGGGCAGAGCTGG + Intergenic
1056309140 9:85321867-85321889 AGAGACAGAAAGGCCAGAGCAGG + Intergenic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1056906029 9:90648571-90648593 GCAGCCAGGATGAGCAGAGCAGG + Intergenic
1057353255 9:94317353-94317375 ACAGACCCCAAGGGCAGAGCAGG - Intergenic
1057631384 9:96721464-96721486 ACACCCAGTTTGTGCAGAGCCGG + Intergenic
1057654496 9:96940239-96940261 ACAGACCCCAAGGGCAGAGCAGG + Intronic
1057804290 9:98209525-98209547 ACAGCCAGTAAGCGCAGGGGTGG + Intronic
1058740814 9:107940398-107940420 ACAGCTAGCAATAGCAGAGCTGG + Intergenic
1059410121 9:114126688-114126710 TCAGCCAGTCAGGAAAGAGCAGG - Intergenic
1059437331 9:114284603-114284625 ACAGCCAGCTGGGGCAGAGCTGG + Intronic
1059473420 9:114524705-114524727 CCAGCCAGCAGGGCCAGAGCTGG + Intergenic
1059517799 9:114912092-114912114 ACAGCTAGTAATGGCAGACGTGG - Intronic
1060013905 9:120069669-120069691 ACAACTGGTAAGTGCAGAGCTGG + Intergenic
1060031347 9:120217493-120217515 CCAGGCACTAGGGGCAGAGCAGG - Intergenic
1060210947 9:121710057-121710079 ATGGCCAGAAATGGCAGAGCTGG + Intronic
1060297706 9:122354620-122354642 ACAGCTAGTAAGGGCCGAGGCGG + Intergenic
1060767542 9:126306400-126306422 ACAGCCAGCAAAAGCTGAGCTGG - Intergenic
1061002671 9:127911113-127911135 ACGGCCAGTATGGGTAGAACAGG + Intronic
1061218697 9:129236621-129236643 GCAGCCAGCAGTGGCAGAGCTGG + Intergenic
1061890339 9:133615898-133615920 ACAGCCAGTCTGGGTATAGCTGG - Intergenic
1061991108 9:134159244-134159266 ACACACAGTGAGGGCGGAGCAGG + Exonic
1062392464 9:136339411-136339433 ACTGCCCGCAAAGGCAGAGCCGG + Intronic
1185809578 X:3093748-3093770 ACACCCAGTAATGGCATTGCTGG + Intronic
1186519114 X:10189703-10189725 ACAGCCACTGAGGGGACAGCCGG - Intronic
1186839426 X:13470190-13470212 ACAGCCACTCAGGGAAGAGCAGG - Intergenic
1187340752 X:18419497-18419519 ACAGCCATTAAGGGCTTAACTGG + Intergenic
1188415158 X:29924004-29924026 ACAGCTAGTAAGAACAGAGTTGG - Intronic
1189785447 X:44555196-44555218 AAAGCTAGGAAGGACAGAGCTGG - Intergenic
1189785912 X:44558677-44558699 AAAGCTAGGAAGGACAGAGCTGG + Intergenic
1190024487 X:46911631-46911653 ACAGTCAGGAAGGGAAGATCAGG + Intergenic
1190522197 X:51291882-51291904 ACAGCTGGGAAGTGCAGAGCTGG - Intergenic
1190725648 X:53188984-53189006 ACAGCCAGCAAGGTGTGAGCTGG - Intergenic
1191786722 X:64924143-64924165 ACAACCAGTTAGGGCAGTGCTGG + Intronic
1191893319 X:65967148-65967170 ATAGCCAGTAATGGGATAGCTGG - Intergenic
1192232605 X:69276373-69276395 ACAGCTAGTAATGGCAGAGCTGG + Intergenic
1192320995 X:70090747-70090769 ATGGCCACTGAGGGCAGAGCTGG + Intergenic
1192636629 X:72825730-72825752 ACACCCAGTAATGGCATTGCTGG + Intronic
1192645085 X:72895084-72895106 ACACCCAGTAATGGCATTGCTGG - Intronic
1192878025 X:75252673-75252695 ATACCCAGTAATGGGAGAGCTGG - Intergenic
1195594565 X:106673473-106673495 ACAGCAAGATAGGGCATAGCAGG - Intronic
1196991962 X:121339713-121339735 ACAGCTATTAAGTGCAGAGTTGG + Intergenic
1197468400 X:126835936-126835958 ACAGCAGTTAGGGGCAGAGCTGG + Intergenic
1198076152 X:133194981-133195003 TCAGCCTCTTAGGGCAGAGCAGG + Intergenic
1198581097 X:138065437-138065459 ACAGCTAGTAAGAACAGAGCTGG + Intergenic
1198649924 X:138851249-138851271 ACACCCAGTAATGGGATAGCTGG + Intronic
1200711225 Y:6486537-6486559 AAAGCCAATCAAGGCAGAGCTGG + Intergenic
1201022711 Y:9675449-9675471 AAAGCCAATCAAGGCAGAGCTGG - Intergenic
1201620586 Y:15952689-15952711 ACAGCCACTAAGGCCAGATGTGG - Intergenic