ID: 905215591

View in Genome Browser
Species Human (GRCh38)
Location 1:36405168-36405190
Sequence CAGTGTAAGACATGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905215591_905215597 19 Left 905215591 1:36405168-36405190 CCATTTTCCCATGTCTTACACTG No data
Right 905215597 1:36405210-36405232 ACTGCTACTCAAAACCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905215591 Original CRISPR CAGTGTAAGACATGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr