ID: 905225175

View in Genome Browser
Species Human (GRCh38)
Location 1:36474011-36474033
Sequence GAGCCACTCTGCCTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 579}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905225175_905225182 -4 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225182 1:36474030-36474052 GCTCTGGAAGGGCAGCCCTGGGG 0: 1
1: 0
2: 2
3: 62
4: 383
905225175_905225183 -3 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225183 1:36474031-36474053 CTCTGGAAGGGCAGCCCTGGGGG 0: 1
1: 0
2: 11
3: 710
4: 6823
905225175_905225189 24 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225189 1:36474058-36474080 TAAGTTGCAGGCATGCACCGGGG 0: 1
1: 0
2: 0
3: 12
4: 127
905225175_905225180 -6 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225180 1:36474028-36474050 TGGCTCTGGAAGGGCAGCCCTGG 0: 1
1: 0
2: 8
3: 40
4: 394
905225175_905225181 -5 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225181 1:36474029-36474051 GGCTCTGGAAGGGCAGCCCTGGG 0: 1
1: 0
2: 4
3: 48
4: 377
905225175_905225186 12 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225186 1:36474046-36474068 CCTGGGGGAAGCTAAGTTGCAGG 0: 1
1: 0
2: 1
3: 13
4: 131
905225175_905225187 22 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225187 1:36474056-36474078 GCTAAGTTGCAGGCATGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 151
905225175_905225188 23 Left 905225175 1:36474011-36474033 CCTGTCTCCAGGCAGAGTGGCTC 0: 1
1: 0
2: 4
3: 61
4: 579
Right 905225188 1:36474057-36474079 CTAAGTTGCAGGCATGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905225175 Original CRISPR GAGCCACTCTGCCTGGAGAC AGG (reversed) Intronic
900114902 1:1024256-1024278 GAGCCAGTCTGGCTGGAGAAGGG + Intronic
900126425 1:1070817-1070839 CAGCCCCTCTGGCTGCAGACAGG - Intergenic
900664892 1:3808558-3808580 GAGCCACCATGCCTGGCCACTGG + Intergenic
900695638 1:4008134-4008156 GAGCCACTGGGGCTGGAAACAGG - Intergenic
900742863 1:4341302-4341324 GAGCCACTGTGCCTGGTCAGAGG + Intergenic
901390363 1:8941733-8941755 GAGCCACTGTGCCTGGCCAGGGG + Intergenic
901876651 1:12170485-12170507 GAGCCACTGTGCCAGGTGCCAGG - Intronic
902219296 1:14954670-14954692 GAGCCACTGGGCCTGGCCACAGG - Intronic
902298717 1:15486194-15486216 GAGCCACTATGCCTGGCCAAAGG - Intronic
902433837 1:16384254-16384276 GAGCCACTGTGCCTGGCCACTGG - Intronic
902917264 1:19646187-19646209 AAGCCACCCTGCCGTGAGACTGG + Intronic
903122987 1:21228347-21228369 GAGCCACTGTGCCTGGGTGCAGG + Intronic
903275284 1:22217754-22217776 GAGCCACTGTGCCTGGCCAGAGG + Intergenic
903672090 1:25042496-25042518 GAGACACTCTGGCTGCAGAAAGG - Intergenic
903744708 1:25578800-25578822 GAGCCACTGTGCCTGGTGTGGGG + Intergenic
904279415 1:29408447-29408469 GAGTCACTCTGACTGGAGACTGG + Intergenic
904334238 1:29786624-29786646 CAGCAACTCTGGCTGGAGGCAGG - Intergenic
904854826 1:33489765-33489787 GATGGAGTCTGCCTGGAGACGGG + Intronic
905225175 1:36474011-36474033 GAGCCACTCTGCCTGGAGACAGG - Intronic
905395480 1:37663830-37663852 GGGTCACACTGCCTGGGGACAGG - Intergenic
905632520 1:39526620-39526642 GAGCCACCGTGCCTGGCCACTGG + Intergenic
906505771 1:46378479-46378501 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
906742749 1:48198337-48198359 GAGCCACTGCGCCTGGCCACAGG + Intergenic
906823664 1:48955665-48955687 GAGCCACTATGCCTGGCCCCTGG + Intronic
907199185 1:52711670-52711692 GAGCCACTGTGCCTGGCCAAGGG - Intergenic
908121618 1:60991285-60991307 GGGCCACACAGCCTGGAAACTGG - Intronic
908262238 1:62348160-62348182 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
909393938 1:75148824-75148846 GAGCCACTGTACCTGGCCACAGG + Intronic
909940144 1:81602173-81602195 GAGCCACTGTGCCTGGCCACTGG - Intronic
910667166 1:89738458-89738480 GAGACACTCTGCCAGGGAACTGG - Intronic
910766634 1:90789030-90789052 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
910820742 1:91342941-91342963 GAGCCACCGTGCCTGGGCACAGG - Intronic
910860773 1:91740647-91740669 GAGCCACTGTGCCCGGTCACAGG + Intronic
911040792 1:93589166-93589188 GCGCCACTCTGCTGGGAGATGGG + Exonic
911082490 1:93947111-93947133 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
912380507 1:109245552-109245574 GAGCCACTGTGCCTGGTGTCTGG - Intergenic
912507264 1:110164955-110164977 CAGCCACTCTGCCTGCAGCAGGG - Intronic
912975534 1:114326671-114326693 TTGCCCCTCTGCCTGGAGAGAGG - Intergenic
913276331 1:117141853-117141875 GAGCCAATCTTCCAGTAGACAGG + Intergenic
914722736 1:150302548-150302570 GAGCCAAGCTGCCTGGAGCGGGG - Intronic
914768336 1:150659746-150659768 GAGCCACTGTGCCTGGCCAGAGG - Intronic
914868416 1:151452579-151452601 GAGCCACTGCGCCTGGTGACAGG - Intronic
914946133 1:152068099-152068121 GAGCCACTCTCTCTGGAGGTGGG - Intergenic
915136573 1:153736014-153736036 GAGCCACTGTGCCTGGCAAGTGG + Intronic
915285240 1:154848099-154848121 CAGCCACTCTGGCTGGGGAGGGG - Intronic
917737634 1:177934986-177935008 GAGCCACTGTGCCCTGAGAGTGG - Intronic
918349577 1:183640119-183640141 GAGCCACTGTGCCTGGCCAAAGG + Intronic
919622405 1:199877519-199877541 GAGCCACTGTGCCTGGCCAGAGG + Intergenic
920191023 1:204193977-204193999 GAGCCGCTCTCCCTGGGGAAGGG + Intronic
920198810 1:204246711-204246733 GAAACAGTCTGCCTGGAGGCAGG - Intronic
920281066 1:204844020-204844042 GAGCCACTGTGCCTGGCCCCAGG + Intronic
920284265 1:204868447-204868469 GAGCCACTCTGCATTGGCACGGG + Intronic
920401848 1:205680845-205680867 GAGCAGCTCTGCCTGGAGATCGG - Intergenic
920506757 1:206520643-206520665 GAGCCAGGCTGCCTTGAGTCAGG + Intronic
920722647 1:208402026-208402048 GAGCCACCATGCCTGGCCACCGG + Intergenic
921016952 1:211200807-211200829 GAGCCACCCTGCCTGGCCCCAGG - Intergenic
921479136 1:215643812-215643834 GAGCCAGTGTGCCTGGCCACAGG + Intronic
922119220 1:222646129-222646151 GAGCCACTGTGCCGGCTGACTGG - Intronic
922720491 1:227897577-227897599 GAGCCATTCAGCCTGGAGGGAGG - Intergenic
924230467 1:241958193-241958215 TACCAACGCTGCCTGGAGACCGG + Intergenic
924628493 1:245715372-245715394 GAGCACAGCTGCCTGGAGACAGG - Intergenic
924718793 1:246604125-246604147 GAGCCACCCTGCCCGGCTACTGG + Intronic
924741292 1:246795493-246795515 CTGCTGCTCTGCCTGGAGACAGG + Intergenic
1063412099 10:5844328-5844350 GAGCCACTGTGCCTGGTTTCAGG - Intergenic
1064006958 10:11706515-11706537 GAGCCACTGTGCCTGGCACCCGG - Intergenic
1064839781 10:19578405-19578427 GAGCCACTGTACCTGGAAGCTGG - Intronic
1064938402 10:20706006-20706028 GAGCCACTGCGCCTGGACTCAGG - Intergenic
1065322283 10:24520905-24520927 GAGCCACCGTGCCTGGTTACAGG - Intronic
1065796376 10:29312013-29312035 GAGCCACTGTGCCTGGCCAGGGG - Intronic
1066006157 10:31147823-31147845 GAGCCACTGTGCCTGGTCCCTGG - Intergenic
1066350422 10:34631995-34632017 GAGCCACTCTGCCTGGCCTCAGG - Intronic
1066417125 10:35231878-35231900 GAGCCACTGTGCCTGGCCTCTGG - Intergenic
1066610807 10:37246934-37246956 GAGCCACTGTGCCTGGGCTCTGG - Intronic
1067688864 10:48487780-48487802 GAGCCACTGTGCCTGGTGCCTGG - Intronic
1068636268 10:59351709-59351731 GAGCCACCACGCCTGGAGATTGG - Intronic
1069076184 10:64041043-64041065 TAGCCACTCTGACTGGAGTGAGG + Intergenic
1069384339 10:67870850-67870872 GAGCCACTGTGCCTGGTCCCAGG - Intergenic
1069669451 10:70189475-70189497 GAGCCACTGTGCCTGGCCATAGG - Intergenic
1070002119 10:72386464-72386486 GAGCCACTGTGCCCGGACAAGGG + Intronic
1070226793 10:74516257-74516279 GATCAGATCTGCCTGGAGACGGG - Intronic
1070306781 10:75244586-75244608 GAGCCACACTGCCTGGGGACTGG - Intergenic
1070311060 10:75274185-75274207 GAGCCACTGTGCCTGGTCAGTGG + Intergenic
1070379078 10:75863485-75863507 GAGCCACACTACCTGGACTCAGG + Intronic
1070597127 10:77840416-77840438 GAGCCACTGTGCCTGGCCTCTGG - Intronic
1070678092 10:78428182-78428204 GATACTATCTGCCTGGAGACAGG - Intergenic
1072073104 10:91939720-91939742 GAGCCACTGTGCCTGGCCACAGG + Intronic
1072164179 10:92796616-92796638 GAGCCACTGTGCCTGGCCAGGGG - Intergenic
1072458233 10:95595718-95595740 GAGCCACTGTGCCTGGCCAGAGG - Intergenic
1073212326 10:101815138-101815160 GAGTCATTCTGCCTAGAGATTGG - Intronic
1073284464 10:102379347-102379369 GAGCAACGCCACCTGGAGACAGG + Exonic
1073939071 10:108673178-108673200 GAGCCACTGTGCCTGGCCAGGGG - Intergenic
1073948221 10:108776936-108776958 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
1074063881 10:109994794-109994816 GAGCCAGTCTCCCTGAAGTCTGG - Intergenic
1074770166 10:116728378-116728400 GAGCATCTGTACCTGGAGACAGG + Intronic
1075019945 10:118944434-118944456 GAGCCACCATGCCTGGCCACTGG - Intergenic
1075102455 10:119515965-119515987 GAGCCACTGTGCCCGGCCACAGG - Intronic
1075209955 10:120482618-120482640 GAGCCACTGCGCCTGGCGACAGG - Intronic
1075626602 10:123968438-123968460 AAGCCAGTCTGGCTGGAGGCTGG - Intergenic
1075917552 10:126182140-126182162 GTGCCCCTCTGCCTGGTGGCTGG + Intronic
1075943592 10:126411816-126411838 GAGCCACTGTGCCTGGCCACAGG + Intergenic
1076821128 10:132940115-132940137 GATCCTCTCTGCATGGGGACAGG - Intronic
1078618854 11:12889445-12889467 GAGACACACAGCCTGGTGACCGG - Intronic
1079070294 11:17339270-17339292 GAGCCACTGTGCCTGGCTAATGG + Intronic
1079097229 11:17518733-17518755 GAGCCACTGTGCCTGGCCCCGGG - Intronic
1080237955 11:30093211-30093233 GAGCCACTGTGCCTGGCCAAAGG + Intergenic
1080301059 11:30785480-30785502 GAGCCACTGTGCCTGGCCAGTGG - Intergenic
1080586046 11:33683519-33683541 CAGACACTGTGCCAGGAGACAGG + Intergenic
1080620297 11:33981675-33981697 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
1080648441 11:34204077-34204099 GAGCCCCTCTGGCTGAAGGCAGG - Intronic
1081527963 11:43939889-43939911 GAGCCACCGTGCCTGGACAGAGG + Intronic
1081566331 11:44263404-44263426 GAGCCCCGCTTCCTGGAGGCAGG + Exonic
1082040448 11:47680492-47680514 GAGCCACTGTGCCTGGCCAGTGG - Intronic
1083364330 11:62132405-62132427 GAGTCACACTGCCTGGGGACGGG + Intronic
1083450057 11:62737746-62737768 GAGCCACCATGCCTGGACACTGG - Intronic
1083768778 11:64854904-64854926 GAACCACTTGGCCTGGAGTCTGG - Intronic
1084004596 11:66316327-66316349 GGGCCCCTGTGCCTGGGGACTGG - Exonic
1084536682 11:69761423-69761445 GAGCCACTGTGCCTGGCCATGGG - Intergenic
1085142258 11:74156683-74156705 GAGCCACTGTGCCCGGCCACAGG - Intronic
1085238195 11:75031400-75031422 GAGTCACTCTGACTGGAGTATGG - Intergenic
1087999180 11:104853933-104853955 GAGAAACTGTGCCTGGAGAGGGG + Intergenic
1089425449 11:118370339-118370361 GAGCCACTGTGCCTAGTCACAGG - Intronic
1090085993 11:123651646-123651668 GAGCCACTGCGCCTGGCGAAGGG + Intronic
1090560474 11:127926883-127926905 GTGCCACTCTGCTTGGACGCTGG - Intergenic
1090643449 11:128748357-128748379 GAGCCACCGTGCCTGGACCCCGG - Intronic
1090669403 11:128935654-128935676 GAGCCACAGTGCTTAGAGACAGG - Exonic
1092948243 12:13476335-13476357 CACCCACTCTGCCTGGAGGAGGG + Intergenic
1094203137 12:27813469-27813491 GAGCCACTGTGCCTGGCCCCTGG + Intergenic
1094718828 12:33040710-33040732 GAGCCACCGTGCCTGGTGCCTGG + Intergenic
1095589101 12:43883850-43883872 GAGCCACTATGCCTGGCTACAGG - Intronic
1095620892 12:44252219-44252241 GAGCCACTGGGCCTGGCCACAGG - Intronic
1096099670 12:48962301-48962323 GAGCCACTGTGCCTGGCCATAGG - Intergenic
1096149474 12:49299583-49299605 GAGCCACCGTGCCTGGCCACCGG - Intergenic
1096197474 12:49657898-49657920 GAGCCGCCCTGCCTGGAGGTAGG - Intronic
1096461906 12:51826342-51826364 GAGCCACTGTGCCTGGCCCCTGG - Intergenic
1099722626 12:86383265-86383287 GAGCCACTGTGCCTGGCCAAGGG - Intronic
1101137732 12:101762934-101762956 GAGCCACTGTGCCTGGCCTCTGG - Intronic
1101171823 12:102105577-102105599 GAGCCACTGTGCCTGGCGTGAGG - Intronic
1101975462 12:109354316-109354338 GAGCCACTGTGCCTGGCTTCAGG - Intronic
1102377937 12:112438765-112438787 GAGCCACTGTGCCTGGTCCCTGG + Intronic
1102520727 12:113476370-113476392 GAGCCCCGCTGTCTGGAGGCCGG + Intergenic
1102706573 12:114885959-114885981 GAGCCACCATGCCTGGCCACAGG + Intergenic
1103277265 12:119722903-119722925 GAGCCACTGTGCCTGGCCCCAGG - Intronic
1103354592 12:120310500-120310522 GAGCCACCATGCCTGGCCACAGG + Intronic
1103371629 12:120423696-120423718 GAGCCACTCTGCCTGGCCCATGG + Intergenic
1103442767 12:120975781-120975803 GAGCCACTGTGCCTGGCCACAGG + Intergenic
1103527371 12:121577833-121577855 GAGCCACACTGGCTGCAGGCTGG + Intronic
1103617123 12:122161364-122161386 GAGCCACTGTGCCTGGCCCCAGG + Intergenic
1103866920 12:124060097-124060119 GAGCCACTGTGCCTGGCCAGAGG - Intronic
1104994290 12:132644435-132644457 GAGCCACTATGCCTGGCCTCTGG + Intronic
1105405008 13:20126611-20126633 GAGCCACTGTGCCTGGCCCCAGG + Intergenic
1105407820 13:20146031-20146053 CAGCTACTCTGCCGGTAGACAGG - Intronic
1105501533 13:20977109-20977131 GAGCCACTGTGCCTGGCCTCGGG - Intronic
1105503449 13:20991149-20991171 GAGGCAATGTGCCAGGAGACTGG + Intronic
1105813702 13:24015174-24015196 GAGCCACCGTGCCTGGCCACTGG + Intronic
1106712814 13:32356352-32356374 GAGCCACTGTGCCTGGCCAGGGG + Intronic
1106816592 13:33415082-33415104 GAGCCACCATGCCCGGCGACAGG - Intergenic
1107610296 13:42106290-42106312 GAGCCACTGTGCCTGGCCTCAGG + Intronic
1107808293 13:44175187-44175209 GAGCCATGCTGCCTGGGGATGGG + Intergenic
1108211592 13:48144933-48144955 GAGCCACTGTGCCTGGCCATGGG - Intergenic
1108529177 13:51312932-51312954 GAGCCACTGTGCCTGGCCAATGG + Intergenic
1108592660 13:51924674-51924696 GGGCCACACTGTTTGGAGACAGG - Intergenic
1110626966 13:77662951-77662973 GAGCCCTTCTGCCTGGCGCCTGG + Intergenic
1111446745 13:88355844-88355866 GAGCTACTCTGCCAGGAGTTGGG - Intergenic
1113696544 13:112350101-112350123 GAGCCACCCTGCCTGATGGCAGG + Intergenic
1113983582 13:114296098-114296120 GAGCCACTGTGCCTGGCCCCTGG - Intronic
1113992348 14:16037601-16037623 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1114272869 14:21114350-21114372 GAGCCACCCTGCCTGGCCAGTGG + Intergenic
1114441815 14:22754478-22754500 GAGCCACTGTGCCCGGCCACAGG - Intergenic
1114633762 14:24175985-24176007 GAGCCACCGTGCCTGGTGAGGGG + Intronic
1115930136 14:38482181-38482203 GAGCTGCACTGCCTGGAGTCGGG - Intergenic
1117052364 14:51874140-51874162 GAGCCACTGTGCCTGGCCCCAGG - Intronic
1117301886 14:54438262-54438284 GAGCCACTGTGCCTGGTCACAGG + Intronic
1117481993 14:56155866-56155888 GAGCCACTGTGCCTGGCTTCAGG + Intronic
1117715200 14:58573377-58573399 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
1117902727 14:60551591-60551613 GATCCGATCTGCCTGGAGTCAGG - Intergenic
1117970174 14:61243824-61243846 GAGCCACTGTGCCTGGCCAGAGG - Intronic
1118175010 14:63430227-63430249 GAGCCACTGTGCCTGGTGTTAGG - Intronic
1118214023 14:63791247-63791269 GAATCACTCTGGCTGGACACTGG - Intergenic
1118962026 14:70542652-70542674 GAGCCACCATGCCTGGACATAGG - Intergenic
1119394889 14:74318997-74319019 GAGCCACTGTGCCTGGTCTCGGG + Intronic
1120189931 14:81431492-81431514 GAGCCACCGTGCCTGGCCACAGG - Intronic
1121258103 14:92546207-92546229 GAGCCACTGTGCCTGGCCCCTGG + Intronic
1122276371 14:100592799-100592821 AAGCCAGGCTGCCTGGAGGCTGG + Intergenic
1122610428 14:102978719-102978741 GAGCCACTGTGCCTGGCCCCTGG - Intronic
1122813709 14:104301856-104301878 GAGCCACTCCACCTGGTGCCGGG + Intergenic
1124111863 15:26797862-26797884 GAGCCACCGTGCCTGGCCACTGG - Intronic
1124341113 15:28889551-28889573 AAGCCTGTCTGCCTGGAGCCAGG - Intronic
1124509817 15:30314235-30314257 GCACCTCTGTGCCTGGAGACAGG - Intergenic
1124733074 15:32216319-32216341 GCACCTCTGTGCCTGGAGACAGG + Intergenic
1124966008 15:34434144-34434166 GAGCCTGTCTGCCTGGAGCCAGG + Intronic
1124982628 15:34580243-34580265 GAGCCTGTCTGCCTGGAGCCAGG + Intronic
1125146058 15:36469974-36469996 TAGCAGCTCTGCCTGGTGACTGG - Intergenic
1125653710 15:41338669-41338691 GAGCCACTGCGCCTGGCGCCTGG - Intronic
1125749094 15:42016620-42016642 GAGCCACTGTGCCTGGCCCCTGG + Intronic
1125799890 15:42436235-42436257 GAGCCACTGTGCCCGGCCACTGG + Intronic
1126467731 15:48976122-48976144 GAGTCGCTGTGCCTGGAGAAGGG - Intergenic
1127167613 15:56263305-56263327 GAGCCACCGTGCCTGGCCACGGG + Intronic
1128083081 15:64867731-64867753 CAGCCACTCTCCCTGGGGCCTGG + Exonic
1128438366 15:67678679-67678701 GAGCCACTGTGCCCGGTGTCTGG - Intronic
1128588390 15:68872184-68872206 GAGCCACTGTGCCTGGCCAATGG + Intronic
1129126047 15:73442394-73442416 GAGCCACTGCGCCTGGTCACTGG + Intergenic
1129816107 15:78555977-78555999 GAGCCACTGTGCCTGGCCATGGG - Intergenic
1130549039 15:84878021-84878043 GAGCCACTGTGCCTGGCCTCTGG - Intergenic
1130773746 15:86953673-86953695 GAGCCACTGTGGCTGGACAAGGG + Intronic
1130961820 15:88664435-88664457 GTGCCACGCTGCCTGGAGCTGGG - Intergenic
1130996504 15:88907346-88907368 GAGCCACTGGGCCTGGAGAATGG - Exonic
1131693419 15:94850634-94850656 GAACCACTCTACTTGGAAACTGG - Intergenic
1131821905 15:96282336-96282358 GAGCCACTGTGCCTGGCCAGGGG - Intergenic
1132667893 16:1090315-1090337 GAGCCCCTCTCCCTGCAGAGGGG + Exonic
1132767279 16:1540893-1540915 CAGACACTCAGCCTGGAGTCAGG - Intronic
1132825111 16:1900811-1900833 GAGCCACTGTGCCTGGCCATTGG - Intergenic
1133251643 16:4486006-4486028 GAGCCACCATGCCTGGCCACAGG + Intronic
1133299269 16:4772278-4772300 GAGCCACTGTGCCTGGCCCCAGG + Intergenic
1133706957 16:8363943-8363965 GAGCCACCGTGCCTGGCCACAGG - Intergenic
1133740109 16:8644911-8644933 CAGCCACCATGTCTGGAGACGGG + Intronic
1133752602 16:8736413-8736435 GAGCCACTCTGCCTGCAGGTAGG + Intronic
1134440332 16:14295976-14295998 GAGCCACTGTGCCTGTGGCCTGG + Intergenic
1134541597 16:15071481-15071503 GAGCCACTGTGCCTGGCCCCGGG - Intronic
1134694061 16:16210013-16210035 GAGCCACTGTGCCTGGCCTCAGG + Intronic
1134815428 16:17201758-17201780 GAGCCACTGTGCCCGGTGAGAGG + Intronic
1134977777 16:18584629-18584651 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
1135332383 16:21571455-21571477 GAGCCACTGTGCCTGGCCAAAGG - Intergenic
1135647953 16:24179906-24179928 CAGGCACTATGCCTGGAGCCAGG - Intronic
1135689471 16:24524485-24524507 GAGCCACTGTGCCTGGTCTCTGG + Intergenic
1135803209 16:25518398-25518420 GAGCCACTGTGCCTGGCCAATGG - Intergenic
1136291410 16:29274506-29274528 GAGCCACTGTGCCTGGCAGCTGG - Intergenic
1136343131 16:29658006-29658028 GAGCCACTGTGCCCGGCCACTGG - Intergenic
1136746993 16:32599223-32599245 GAGCCACTGTGCCTGGCCCCTGG - Intergenic
1137421708 16:48340673-48340695 GAGCCACTGTGCCTGGTTTCAGG - Intronic
1137557658 16:49482938-49482960 AACCCACGGTGCCTGGAGACAGG + Intergenic
1137637165 16:49996579-49996601 GAGCCACTGTGCCCAGTGACAGG - Intergenic
1137760054 16:50933318-50933340 AAGCCACACTGGTTGGAGACAGG - Intergenic
1138107440 16:54296229-54296251 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1138417682 16:56880452-56880474 GAGCCACCCTGCCTGGAGGTGGG - Intronic
1139832812 16:69813753-69813775 GAGCCACTGTGCCTGGCCTCTGG + Intronic
1140095366 16:71870762-71870784 GAGCCACTGTGCCTGGCCAAGGG + Intronic
1140359383 16:74331586-74331608 GAGCCACTGTGCCTGGCCCCAGG - Intergenic
1141107729 16:81247376-81247398 GAGCCACTGTGCCTGGTCAATGG - Intronic
1141260824 16:82452243-82452265 GTGCCACTCTGGGTGGAGTCAGG - Intergenic
1141347059 16:83256545-83256567 GAGCCACCGTGCCTGGCCACTGG - Intronic
1141540056 16:84713269-84713291 GAGACCCTCTGTCTGTAGACAGG + Intronic
1141602070 16:85133084-85133106 GAGCCACTGTGCCTGGCCAGGGG + Intergenic
1141748515 16:85942513-85942535 AAGCCAGTGTGCCTGGAGCCAGG - Intergenic
1142013133 16:87727150-87727172 GACGCAATCTACCTGGAGACAGG + Intronic
1142308122 16:89296978-89297000 GGGCCACACTTCCTGGACACTGG - Intronic
1203049123 16_KI270728v1_random:858427-858449 GAGCCACTGTGCCTGGCCCCTGG - Intergenic
1143160345 17:4865741-4865763 ACACCACTCTGCCTGGATACTGG - Intronic
1143488436 17:7268859-7268881 GAGCCATTGTGCCTGGCCACTGG - Intergenic
1143792136 17:9306025-9306047 GAGCCACTGTGCCTGGCCACAGG + Intronic
1143932424 17:10443634-10443656 GAGCCACCATGCCTGGACAACGG - Intronic
1144995467 17:19265106-19265128 GAGCCACCATGCCTGGCCACCGG - Intronic
1145378650 17:22375059-22375081 GAGTCACTGTGACTGGAGAATGG - Intergenic
1146123689 17:30216136-30216158 GTGCCACCCTCCCTGGAGCCTGG - Exonic
1146405800 17:32536317-32536339 GAGCCACTGTGCCTGGCCCCAGG + Intronic
1146578642 17:34016138-34016160 GAGCCACTGTGCCTGGCCATGGG - Intronic
1147011709 17:37454575-37454597 GAGCCACTGTGCCTGGCCAAGGG + Intronic
1147263042 17:39219855-39219877 AAGTCCCTCTGCCTGGAGCCAGG - Intronic
1147532079 17:41288830-41288852 GAGCCACTGTGCCTGGTTAAAGG - Intergenic
1147703286 17:42409383-42409405 GAGCCACTGTGCCTGGCCAAGGG + Intronic
1147927519 17:43954680-43954702 GAGACACTCTGCCTTGGGAGGGG - Intronic
1148481229 17:47960661-47960683 GAGCCACTGTGCCTGGCCAAAGG - Intergenic
1148579121 17:48731017-48731039 GAGCCACTGTGCCTGGCCCCAGG - Intergenic
1148650379 17:49246059-49246081 GAGCCACTGTGCCTGGTCAAGGG - Intergenic
1148839691 17:50487164-50487186 GAGCCATTGTGCCTGGTGAAGGG + Intergenic
1150140984 17:62728307-62728329 GAGCCACTGTGCCTGGCCACAGG + Intronic
1150701727 17:67452768-67452790 GAGCCACTGGGCCTGGCCACTGG + Intronic
1150903144 17:69305583-69305605 GAGCCACTGTGCCTGGCCAAAGG - Intronic
1152428633 17:80234287-80234309 GAGCCACTTTGCCTGGCCTCAGG + Intronic
1152799556 17:82324438-82324460 GAGCCGGGCTGCCAGGAGACAGG - Intronic
1152874084 17:82775930-82775952 GAGCCACCGTGCCTGGCGAAAGG - Intronic
1153156636 18:2157697-2157719 GAGCCACCATGCCTGGAGATTGG - Intergenic
1153483653 18:5573486-5573508 AAGCCACTATGGCTAGAGACAGG + Intronic
1153832817 18:8938244-8938266 GAGCCACCATGCCTGGCCACAGG - Intergenic
1155045010 18:22095815-22095837 GAGCCACTGTGCCTGGCCAGTGG - Intronic
1155265146 18:24084947-24084969 GAGCCACTGTGCCTGGCCTCAGG + Intronic
1155397618 18:25403264-25403286 GAGCCACTGTGCCTGGCCAAAGG + Intergenic
1156257328 18:35410485-35410507 GACCCACTGTTCCTGGAGAAAGG - Intergenic
1156488542 18:37482379-37482401 GAGTCACTCTGCCTGGATTCTGG + Intronic
1157283283 18:46360168-46360190 GAACCACACTGCCAGGAGAGAGG - Intronic
1157562833 18:48660635-48660657 GAACCTCTCTGCCTGGAGGAGGG - Intronic
1157900734 18:51514201-51514223 GAGCCACTCTGCCTCTAGCTGGG - Intergenic
1158041165 18:53095958-53095980 CAGCCACTGTGCCTGGCCACTGG - Intronic
1158340128 18:56457267-56457289 CTGCCACACTGCCTAGAGACTGG + Intergenic
1159368569 18:67502137-67502159 GAGCCACCCTGCCCGGCCACAGG - Intergenic
1159722083 18:71903679-71903701 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1159779206 18:72642043-72642065 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1160241976 18:77131579-77131601 GTGCGACTCTGGCTGGAAACAGG - Intronic
1160251608 18:77208114-77208136 GAGCCACTGTGCCCGGAGGCTGG + Intergenic
1160731847 19:644809-644831 GAGCCCCACAGCCTGGAGCCAGG + Intergenic
1160956018 19:1692032-1692054 GAGCCTCTGTGTGTGGAGACGGG + Intergenic
1161068425 19:2249191-2249213 AGGCCACTCTGCCTGGAGTGGGG + Intergenic
1161463038 19:4410256-4410278 GAGCCACTGTGCCTGGCCCCAGG - Intronic
1161486830 19:4540345-4540367 AAGGCACTATTCCTGGAGACAGG + Exonic
1161520393 19:4720581-4720603 GAACCACTCTCCCTGGGGAAGGG - Intronic
1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG + Intronic
1161627670 19:5336760-5336782 GAGCCACTCTGCCTGGTGAGCGG + Intronic
1161670889 19:5608641-5608663 GGCCCACTCTGCCTGGAATCAGG + Intronic
1162258851 19:9516279-9516301 GAGCCACCATGCCTGGCCACTGG - Intergenic
1162330318 19:10024420-10024442 GAGCCACTGTGCCTGGTCGCAGG + Intergenic
1162364575 19:10240592-10240614 GAACCACTCTGCCTGGCCTCCGG + Intergenic
1162379922 19:10325511-10325533 GAGCCACCGTGCCATGAGACAGG + Intronic
1162529694 19:11228844-11228866 GAGCCACTATGCCTGGCCAGGGG + Intronic
1162870253 19:13581045-13581067 GAGCCACTGTGCCTGGCCATGGG + Intronic
1162999651 19:14358709-14358731 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
1163121017 19:15217808-15217830 GAGCCACCGTGCCTGGACACTGG + Intergenic
1163330627 19:16635075-16635097 GAGCCACTGTGCCCGGCCACGGG - Intronic
1163355978 19:16811297-16811319 GAGCCACTGTGCCTGGCCATAGG - Intronic
1163455028 19:17401535-17401557 GAGCCACTGTGCCTGGCCAGAGG + Intergenic
1163624281 19:18379926-18379948 GAGCCACTGTGCCTGGCCATGGG - Intronic
1163733455 19:18963716-18963738 GAGCCACTGTGCCTGGCCAAAGG - Intergenic
1163872784 19:19837027-19837049 GAGCCACCATGCCTGGCTACAGG + Intergenic
1164497124 19:28776715-28776737 GAGCCACTGTGCCTGGCTACTGG - Intergenic
1164854339 19:31509506-31509528 GAGCCACCCTGCCTGGCCCCAGG - Intergenic
1164910574 19:32008023-32008045 GAGCCACTGTGCCTGGCCACAGG - Intergenic
1165432271 19:35779711-35779733 GAGCCACTGTGCCTGGCCTCTGG + Intronic
1165472776 19:36013156-36013178 CAACCCCTATGCCTGGAGACAGG + Intronic
1165590732 19:36967277-36967299 GAGCCACTGTGCCTGGCCAAAGG - Intronic
1165775972 19:38404490-38404512 GAGCCACTGTGCCTGGGCAAAGG + Intronic
1165957333 19:39509389-39509411 AAGCCATACTGCCTGGAGACTGG - Intergenic
1166224691 19:41387671-41387693 GAGCCACTGTGCCTGGCCAAAGG - Intronic
1166655525 19:44608731-44608753 GAGCCACTGTGCCTGGCCTCCGG - Intergenic
1166750618 19:45162525-45162547 GGGCCACTCTGCCCAGGGACGGG + Intronic
1166877486 19:45906280-45906302 GAGCCACTGTGCCTGGCGAAGGG + Intergenic
1167629882 19:50619301-50619323 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1168155989 19:54473137-54473159 AACCCTCTCTGCCTGGGGACTGG - Exonic
1168167678 19:54562807-54562829 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
1168570687 19:57466499-57466521 GAGCCACACTGCCTGGAGTTGGG + Intronic
925434448 2:3824970-3824992 GACCCACTGTGGCTGGAGAAGGG - Intronic
925745468 2:7039786-7039808 GAGCCACACTTCCCGGAGGCAGG - Exonic
926171897 2:10557935-10557957 TAGCCACTCTGCTGGGGGACAGG + Intergenic
927112962 2:19877411-19877433 GAGCCACTGTGCCTGGCCAAAGG - Intergenic
927191870 2:20522519-20522541 GTTCCACTCTGCCTGGGGAGAGG + Intergenic
927412137 2:22838906-22838928 GAGCCACTGTGCCTGGCCAAGGG - Intergenic
927586369 2:24309482-24309504 GAGCCACTGTGCCTGGCCAATGG + Intronic
928287000 2:30000231-30000253 GAGCCACTGTGCCTGGCCATGGG - Intergenic
929664880 2:43826282-43826304 GAGCCACTGTGCCTGGCCACTGG + Intronic
930279989 2:49358583-49358605 GAGCCACCGCGCCTGGCGACTGG - Intergenic
930597847 2:53410149-53410171 GAGCCACTGTGCCTGGCCCCTGG - Intergenic
930649475 2:53950555-53950577 GAGCCACTGTGCCTGGCCATTGG - Intronic
930761840 2:55047040-55047062 GAGCCACTGCGCCTGGCCACAGG - Intronic
932063527 2:68529788-68529810 GAGCCCTTCTGCCTGGCGCCTGG + Intronic
933317250 2:80730029-80730051 CAGCCACTCTGCCTTTTGACTGG - Intergenic
933542614 2:83666731-83666753 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
933910980 2:86941527-86941549 GAGCCACTGTGCCAGGCGAATGG + Intronic
933973269 2:87487475-87487497 GAGCCTCACAGCCTGGAGGCTGG + Intergenic
934021750 2:87961883-87961905 GAGCCACTGTGCCAGGCGAATGG - Intergenic
935288494 2:101588288-101588310 GAGCCACTGCGCCTGGCCACTGG + Intergenic
935876295 2:107511781-107511803 CAGCCACTCTTCCATGAGACTGG + Intergenic
935933009 2:108150064-108150086 GAGTCAGTCTGCCTGCAGAATGG - Intergenic
936020690 2:108992816-108992838 GAGCCACTGTGCCACGAGGCAGG - Intergenic
936249632 2:110858008-110858030 GAGCCACTGTGCCTGGATGCTGG + Intronic
936320452 2:111462736-111462758 GAGCCTCACAGCCTGGAGGCTGG - Intergenic
936443489 2:112576843-112576865 GAGCCACTGTGCCTGGCCTCCGG + Exonic
936853920 2:116934474-116934496 GAGCCACTGCGCCTGGCCACAGG + Intergenic
937097152 2:119242826-119242848 GAGCCAGTCCGCCTGGATTCTGG - Intronic
937129891 2:119501969-119501991 GAGCCACTACGCCTGGCCACTGG - Intronic
937413851 2:121698919-121698941 GAGTCACTGTGCCTGGACCCAGG - Intergenic
938237921 2:129721887-129721909 GGGCCCCTCTGGCTGGGGACGGG + Intergenic
940674671 2:156714015-156714037 GAGCCACTGTGCCTGGCCAGAGG + Intergenic
941596449 2:167483007-167483029 GAGCCACCCCGCCTGGCCACTGG - Intergenic
942767379 2:179472796-179472818 AAGCAGCCCTGCCTGGAGACAGG - Intronic
944558290 2:200909422-200909444 GAGCCACTATGCCTGGCCAAGGG - Exonic
944785814 2:203069012-203069034 GAGCCACCATGCCTGGCCACTGG + Intronic
947594471 2:231402193-231402215 GAGCCTCTCTGCCTGGTAAGGGG - Intergenic
947779139 2:232741726-232741748 GAGCCACTGTGCCTGGCCCCTGG + Intronic
948057664 2:235020895-235020917 GGGACACTCTGCCTAGAGTCTGG - Intronic
948615890 2:239198541-239198563 GAGCGCCTCTGCATGGGGACAGG - Intronic
948791324 2:240378481-240378503 GAGCCACTATGCCTGGCCAATGG - Intergenic
1169120182 20:3091095-3091117 GAGCCACTGTGCCTGGCCATTGG + Intergenic
1169358142 20:4924898-4924920 GAGCCACTTTGCCTGGCCACAGG - Intronic
1169422956 20:5474363-5474385 TGGCCACTCTGCCTGGAGAGAGG + Intergenic
1169426472 20:5501112-5501134 TGGCCACTCTGCCTGGAGAGAGG - Intergenic
1169437595 20:5607000-5607022 GAGCCACTGTGCCTGGCCAAAGG - Intronic
1170568826 20:17621627-17621649 CAGCCCCTCTTCCTGGGGACAGG + Intronic
1171143279 20:22761007-22761029 AAGCCACTTTGCATGGAGGCAGG + Intergenic
1171476898 20:25417569-25417591 GAGCCACTGTGCCTGGCCAAAGG - Intronic
1171868299 20:30506497-30506519 GAGCCACTACGCCTGGACTCCGG - Intergenic
1172362981 20:34327122-34327144 GAGCCACTGTGCCTGGCCCCTGG - Intergenic
1172566805 20:35937180-35937202 GAGCCACCAAGCCTGGCGACTGG - Intronic
1172606455 20:36217417-36217439 GAACCACTCCTCCTGGAGGCAGG + Intronic
1172607853 20:36227028-36227050 GAGCCACTGTGCCTGGCCCCTGG - Intronic
1172681082 20:36715842-36715864 GAGCCACTGTGCCTGGCCCCAGG - Intronic
1173780697 20:45754540-45754562 GAGCCACCATGCCTGGCCACAGG - Intronic
1173973890 20:47172942-47172964 GAACCTCTCTGCCTGGCGCCTGG - Intronic
1174132051 20:48352080-48352102 GAGCCACTGTGCCTGGTCAGAGG + Intergenic
1174492008 20:50906503-50906525 GAGCCACTCATCCAGGAGGCAGG - Intronic
1174688744 20:52481612-52481634 CAGCCACTCTGCCTGGGAGCTGG + Intergenic
1174705984 20:52656566-52656588 GAGCCACTGTGCCTGGTGGAGGG + Intergenic
1175223896 20:57433751-57433773 GAGCCAGTCAAGCTGGAGACAGG + Intergenic
1175230532 20:57470875-57470897 GAGCCTCTCTGCCTGTGCACCGG + Intergenic
1175522232 20:59609290-59609312 ATGCCACTCTGCCAGCAGACAGG + Intronic
1175778222 20:61666270-61666292 GAGCCACGGTGCCTGGAGCTGGG + Intronic
1176029954 20:63007049-63007071 GAGCTCCTCTTCCTGGAGCCGGG + Intergenic
1176114488 20:63425433-63425455 GAGCCACTGTGCCTGGCCAACGG - Intronic
1176551755 21:8226014-8226036 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1176570664 21:8409013-8409035 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1176578573 21:8453180-8453202 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1176999226 21:15591167-15591189 GAGCCACTGTGCCTGGCCAAAGG + Intergenic
1177166309 21:17608767-17608789 GAGTCCCACTGCCTGGACACAGG - Intronic
1177713867 21:24814207-24814229 GAGCCACTGTGCCTGGCCAACGG - Intergenic
1178190430 21:30273665-30273687 GAGCCACTGTGCCTGGCCATAGG - Intergenic
1178439915 21:32590442-32590464 GGCTCACTCTGCCTGAAGACAGG + Intronic
1178583211 21:33853212-33853234 CTACCACCCTGCCTGGAGACAGG - Intronic
1178665115 21:34539926-34539948 GAGCCATTCTCACTGGAGTCAGG + Intronic
1178699844 21:34823725-34823747 GAGCCACTGTGCCTGGCCCCTGG + Intronic
1178815587 21:35926499-35926521 CAGCCATTCTGCCTGCAGTCAGG - Intronic
1179134315 21:38666551-38666573 GAGCCACTGTGCCTGGCCAGAGG - Intergenic
1179464216 21:41561075-41561097 GAGGCTCTCTGCCTTGAGACTGG - Intergenic
1180314923 22:11269916-11269938 GAGCCACTGCGCCTGGACTCCGG - Intergenic
1182089404 22:27583849-27583871 GACCCACTCAGACAGGAGACAGG + Intergenic
1182503909 22:30768390-30768412 GAGCCACCATGCCTGGCCACAGG - Intronic
1182990659 22:34764383-34764405 AAGCCTCCCTTCCTGGAGACAGG + Intergenic
1183214480 22:36470337-36470359 GCCCTGCTCTGCCTGGAGACAGG - Intronic
1183522728 22:38304837-38304859 GAGCCACTGTGCCTGGCCTCGGG - Intronic
1183843761 22:40522808-40522830 GAGCCACTGTGCCTAGCCACAGG + Intronic
1183970711 22:41475431-41475453 GAGCCACTGTGCCTGGCTAGTGG + Intronic
1184176099 22:42789994-42790016 GAGCCACTGTGCCTGTAATCAGG - Intergenic
1184245710 22:43234865-43234887 GAGCCAAGCAGCCTGGAGAAAGG - Intronic
1185148131 22:49150214-49150236 CAGCCACTCTGGCTGGAGTCTGG + Intergenic
1185376913 22:50486921-50486943 GAGCCTCTCTGCATGGGGTCTGG - Intronic
1203256774 22_KI270733v1_random:142934-142956 GAGCCACTGCGCCTGGACTCCGG + Intergenic
949288715 3:2438018-2438040 AAACCACTCTGGCTGGAGGCAGG - Intronic
950547653 3:13648180-13648202 GAAAAGCTCTGCCTGGAGACAGG - Intergenic
950755399 3:15166932-15166954 GAGCCACTTGCCCTGGAGGCTGG - Intergenic
952315256 3:32226630-32226652 AAGCCCCTCAGCCTGGAAACTGG - Intergenic
953634539 3:44651542-44651564 GAGCCACTGTGCCTGGACCACGG - Intronic
953903570 3:46857133-46857155 GAGCCACTCTGCCAGCAGTGTGG - Intergenic
954024338 3:47770334-47770356 GAGCCACTGTGCCTGGTCCCAGG - Intronic
954479462 3:50784870-50784892 GAGCCACCGTGCCTGGCCACAGG - Intronic
954562876 3:51572920-51572942 GAGCCACTGTGCCTGGCAAAAGG + Intronic
955218331 3:57003477-57003499 GTGCCAGCCTGCCTGGAGTCAGG - Intronic
955810235 3:62780155-62780177 GAGCCACTGTGCCTGGCCTCAGG + Intronic
955856580 3:63278920-63278942 GAGGCACCCTGCTTGGAGGCGGG + Intronic
956100568 3:65763784-65763806 GAGCCACTGTGCCTGGCCTCAGG - Intronic
956483562 3:69697334-69697356 GAGCCACCATGCCTGGTGATAGG + Intergenic
956709822 3:72029494-72029516 GAGCCACTGTGCCTGGCCAAAGG - Intergenic
958052239 3:88363115-88363137 GAGCTACACTGCCTGCAGAGTGG + Intergenic
959386550 3:105715752-105715774 GAGCCACCGTGCCTGGTGCCTGG - Intronic
959492867 3:107012717-107012739 GAGCCACCGTGCCTGGCCACTGG - Intergenic
959862070 3:111227613-111227635 TAGCCATTCTGACTGGAGACTGG - Intronic
960953773 3:123016864-123016886 GAGCCACTGTGCCTGGCCTCAGG + Intronic
960955221 3:123026847-123026869 GAGCCACTGCCCCTGGAGCCTGG + Intronic
961461308 3:127052090-127052112 GTGCCACTCTGTCTGGAATCAGG + Intergenic
961476728 3:127151258-127151280 GGGCAACTCTGCATGGAGAAGGG - Intergenic
962103187 3:132364057-132364079 GAGCCACTGTGCCTGGCCAGGGG - Intronic
962937816 3:140097285-140097307 GGACCACTGTGCTTGGAGACAGG - Intronic
964384203 3:156129958-156129980 GATCCACTGTGCATGGAGAGAGG - Intronic
964693879 3:159485232-159485254 GAGCCAGCCTGCCTGGGGTCAGG + Intronic
966732794 3:183164245-183164267 GAGCCACTGTGCCTGGCCCCAGG + Intergenic
967260380 3:187635786-187635808 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
968195864 3:196705766-196705788 GAGCCACTGTGCCTGGCTATAGG - Intronic
968600724 4:1508147-1508169 GTGCCAGGCTACCTGGAGACAGG - Intergenic
968747241 4:2366475-2366497 GAGCAACTTGGCCGGGAGACGGG - Intronic
970608620 4:17705654-17705676 GATCCACTATGCTTGGGGACTGG + Intronic
970781715 4:19745545-19745567 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
971074681 4:23133682-23133704 GAGCCACTGTGCCTGGCCACTGG + Intergenic
971634169 4:29034795-29034817 GAGCCACTGTGCCTGGCCAGTGG + Intergenic
971803574 4:31325112-31325134 AAGCCACTGTGCTTGGATACAGG + Intergenic
971857846 4:32065073-32065095 GAGCTACTGTGCCTGGAAACAGG + Intergenic
972596472 4:40534098-40534120 GAGCCACCATGCCTGGCGCCTGG + Intronic
973633097 4:52837966-52837988 GAGGCAGTCTGACTGGAGACTGG + Intergenic
974151461 4:58015533-58015555 GTGCTACCCTGCCTGGAGAGAGG + Intergenic
974936452 4:68414344-68414366 GAGCCACTGCGCCTGGCCACTGG - Intergenic
975232810 4:71954526-71954548 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
975326352 4:73063018-73063040 GAGCCACTGTGCCTGGCCATAGG - Intronic
975862007 4:78687509-78687531 GAGCCACTGTGCCTGGAGAATGG - Intergenic
976430211 4:84954918-84954940 GAGCCACTGTGCCTGGCCACTGG - Intronic
977148482 4:93477863-93477885 CTGCCACTATGCTTGGAGACAGG + Intronic
977706488 4:100076623-100076645 GAGCCACTGTGCCTGGACCCAGG + Intergenic
977968030 4:103178240-103178262 GAGCCACACAGCCAGAAGACCGG + Intronic
978496121 4:109360865-109360887 GAGCCACCATGCCCGGAGGCTGG + Intergenic
980110066 4:128627066-128627088 GAGCCACCGTGCCCGGCGACAGG - Intergenic
980992919 4:139753926-139753948 GATTAACTCTGTCTGGAGACTGG + Intronic
982708853 4:158739527-158739549 AAGCCACTGTGCCTAGAGGCTGG + Intergenic
983195219 4:164799099-164799121 GAGCCACCATGCCCAGAGACTGG - Intergenic
985267838 4:188166511-188166533 GAGCCACCGTGCCTGGCGAGAGG + Intergenic
986240613 5:5956464-5956486 GAGCTTCTCAGCATGGAGACAGG + Intergenic
986417435 5:7543723-7543745 GAGCCACTGTGCCTGGCCAATGG - Intronic
988580431 5:32463981-32464003 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
989384860 5:40845149-40845171 GAGCCACTGTGCCTGGACAAGGG + Intronic
989600594 5:43197068-43197090 GAGCCACCATGCCTGGCCACTGG + Intronic
990170142 5:53038804-53038826 GAGCCACTGTGCCTGGCCACCGG - Intronic
990573589 5:57103682-57103704 GAGCCACCATGCCTGGTTACTGG + Intergenic
990707849 5:58549865-58549887 GAGCCACTGTGCCTGCCGAAAGG - Intronic
991024381 5:62014245-62014267 GAGCCACTGTGCCTAGCCACTGG - Intergenic
991090379 5:62688700-62688722 GAGCCACCATGCCTGGACCCCGG + Intergenic
991302784 5:65145325-65145347 GAGCCTCTGTGTCTGGAGAGTGG - Intergenic
991321753 5:65381668-65381690 GAGCCACTATGCCTGGCCTCTGG + Intronic
991569679 5:68041107-68041129 GAGCCACTGTGCCAGGCCACAGG - Intergenic
992560513 5:77948199-77948221 GAGCCACTGTGCCCGGCTACTGG - Intergenic
995084582 5:108092598-108092620 GAGCCACTGTGCCTGGCAAGTGG + Intronic
995385261 5:111581652-111581674 GAGCCACTCATACTGGGGACTGG + Intergenic
995491010 5:112691678-112691700 AAGTCAATCTGCCTGGAGATGGG - Intergenic
995750709 5:115450757-115450779 GAGACACTCTGGCTTGAGATGGG - Intergenic
996116441 5:119625216-119625238 GAGCCACTCTGCATGGCCAGTGG + Intronic
996771642 5:127092803-127092825 GAGTCATACTGCCTGGAGTCAGG - Intergenic
997085266 5:130789859-130789881 GAGCCACTGCGCCTGGTCACTGG - Intergenic
997983684 5:138487270-138487292 GAGCTCCTCTGCATGGTGACAGG - Intergenic
998268313 5:140683545-140683567 GAGCCACTGTGCCTGGCCTCAGG - Intronic
998820064 5:146049945-146049967 TAGCCTCACTGCCTTGAGACAGG - Intronic
999085479 5:148885111-148885133 GAGCCCATCTACCTGGAGATTGG + Intergenic
999118113 5:149182883-149182905 GAGGCACTCTGGCTGGAGGGAGG - Intronic
1000625122 5:163529649-163529671 GAGCCACTGAGCCTGGACAGAGG - Intergenic
1001287388 5:170433925-170433947 AGGCCCCTCTGCATGGAGACAGG - Intronic
1001303871 5:170557279-170557301 TAGCCACCATGCCTGGATACTGG - Intronic
1001405980 5:171477969-171477991 GGGCCTCTCTAACTGGAGACAGG - Intergenic
1001638236 5:173227918-173227940 GAGACAAACTGCCTGGAGGCCGG - Intergenic
1001790146 5:174449336-174449358 GAGCCACTGTGCCTGCTGCCTGG - Intergenic
1001934245 5:175693324-175693346 TCCCCACCCTGCCTGGAGACAGG + Intergenic
1002416116 5:179121799-179121821 GAGCCTCTCTGCCTGGGGTGGGG - Intronic
1002434515 5:179222468-179222490 GGGCCACCCTGCCTGCAGAGAGG + Intronic
1002625580 5:180526081-180526103 GAGCCATTGTGCCTGGCTACTGG + Intronic
1004010911 6:11686384-11686406 GAGCCACTGTGCCTGGCCCCAGG - Intergenic
1004071714 6:12304503-12304525 GATCAACTCTGCCTGGGGACAGG + Intergenic
1004362444 6:14983276-14983298 GAGCCACTGTGCCTGGACTTTGG - Intergenic
1004681584 6:17900792-17900814 GAGCCACTGTGCCTGGCCCCTGG - Intronic
1004702876 6:18095387-18095409 GAGCCACTGTGCCTGGACTATGG - Intergenic
1004991401 6:21142348-21142370 AAGCCAGTCTGGCAGGAGACTGG + Intronic
1005009468 6:21322375-21322397 GAGCCACTGTGCCTGGCCAATGG + Intergenic
1005057507 6:21743844-21743866 GAGCCACTGTGCCTGGCCAGGGG + Intergenic
1005943080 6:30575783-30575805 GAGCCACTGTGCCTGGCCAGGGG - Intronic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1007756294 6:44101839-44101861 GAGCAACTCTTCTTGTAGACAGG - Intergenic
1008594508 6:53027861-53027883 GAGCCACTGTGCCCGGCGCCCGG - Intronic
1009398821 6:63230661-63230683 GAGCCCTTCTGCCTGGTGCCTGG + Intergenic
1009418080 6:63437331-63437353 GCGCCAGTCTGCAGGGAGACAGG - Intergenic
1009846111 6:69137512-69137534 GAGCCACCATGCCTGGACAAGGG - Intronic
1012468702 6:99545776-99545798 AAGCCATTCTGCCAGGAGATAGG + Intronic
1015501989 6:133944223-133944245 GAGCCACTGTGCCTGGTCCCTGG + Intergenic
1016473170 6:144396959-144396981 GAGCCACTGTGCCTGGCCAGAGG - Intronic
1017458340 6:154623808-154623830 GAGCCACTGTGCCTGGTCAAGGG - Intergenic
1017669636 6:156757667-156757689 GAGCCACTGTGCCTGGCCAAGGG - Intergenic
1018079212 6:160244361-160244383 GAGCCACTGTGCCTGGCCAATGG + Intronic
1018396582 6:163382535-163382557 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
1018686163 6:166306856-166306878 GAGACCCTCTGCCTGGAGGCGGG - Exonic
1018788523 6:167128076-167128098 GAGTCCTTCTCCCTGGAGACGGG - Intronic
1019199032 6:170298877-170298899 GTTCCCCTCTGCCTGGAGAGTGG - Intronic
1019210448 6:170400620-170400642 GATCCCCTCTGCCTGGATGCTGG - Intronic
1019261745 7:85820-85842 CAGCCACTCTGCCGGGAGCTGGG + Intergenic
1019986881 7:4663386-4663408 GAGCCACCATGCGTGGAAACTGG + Intergenic
1020090288 7:5335015-5335037 GAGCCACTGTGCCTGGCCACTGG - Intronic
1020203846 7:6100612-6100634 GAGCCACTGTGCCTGGCACCTGG + Intergenic
1021711397 7:23419565-23419587 GAGCCACTGTGCCTGGCCTCAGG - Intronic
1021969008 7:25949864-25949886 GGGCCACTCGGCCTGGCGTCTGG + Intergenic
1021984650 7:26086775-26086797 GAGCCACCGTGCCTGGCCACTGG + Intergenic
1022245449 7:28554655-28554677 CAGACACTGTGCCTGGAGGCAGG + Intronic
1022728422 7:33001059-33001081 GAGCCACTGTGCCTGGCCCCAGG + Intronic
1022860805 7:34364647-34364669 CTGCCCCTCTGCCTGGAGCCAGG + Intergenic
1023242036 7:38159226-38159248 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
1023410747 7:39886841-39886863 GAGCCACTGCGCCTGGAGCCTGG + Intergenic
1023878389 7:44305332-44305354 GAGCCACTGTGCCTGGCTAGGGG - Intronic
1023940798 7:44767411-44767433 TCCCCACTGTGCCTGGAGACAGG + Intronic
1024080324 7:45850421-45850443 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
1025124139 7:56331250-56331272 GAGCCACTGTGCCTGGCCAAGGG - Intergenic
1025907333 7:65797751-65797773 GAGCCACTGTGCCTGGCCAAAGG + Intergenic
1026096962 7:67354098-67354120 GAGCCACTGTGCCTGGCCAAAGG + Intergenic
1026310710 7:69181389-69181411 GAGCCACTGTGCCTGGCTAGGGG + Intergenic
1026408023 7:70088409-70088431 GAGCCACCGTGCCTGGCCACAGG + Intronic
1026567961 7:71505312-71505334 GAGCCACTGTGCCTGGCCCCAGG - Intronic
1026855700 7:73752925-73752947 GAGCCACTGTGCCTGGCAAGGGG + Intergenic
1026938650 7:74273757-74273779 GAGCCACCATGCCTGGACATAGG + Intergenic
1026945462 7:74313273-74313295 GAGCCACTCCAGCTGGAGGCTGG - Intronic
1027154578 7:75757559-75757581 GAGCCACTGTGCCTGGCCAAGGG - Intergenic
1027175828 7:75902736-75902758 GAGCCACAGTGCCTGGCCACAGG - Intronic
1028397350 7:90385768-90385790 GAGCCACCATGCCTGGCCACTGG - Exonic
1029112552 7:98220973-98220995 GAGCCACTGTGCCTGGCTAATGG + Intronic
1029185464 7:98735377-98735399 GAGCCACTGTGCCTGGCCAAAGG - Intergenic
1029521393 7:101064942-101064964 GAGCCACTGTGCCTGGCCAAGGG - Intergenic
1029611513 7:101629014-101629036 GAGCCACTGTGCCTGGCCTCTGG - Intronic
1029697755 7:102225577-102225599 GAGCCACTGTGCCTGGCCAAGGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1030151699 7:106412691-106412713 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
1031929424 7:127669273-127669295 GAGCCACTGTGCCTGGCCAGCGG + Intronic
1032424122 7:131806786-131806808 GAGCCATGCTCCCTGGAGGCTGG - Intergenic
1032569514 7:132984731-132984753 GAGACCCTCTGCCTGGCAACCGG + Intronic
1033092646 7:138400641-138400663 GAGCCACTCATCCTCAAGACGGG + Intergenic
1033127215 7:138716846-138716868 GAGCCACTGTGCCTGGCCATGGG + Intronic
1033226058 7:139563310-139563332 GCCCCACTCAGCCTTGAGACTGG - Exonic
1033719049 7:144037537-144037559 GAGACACTCTCCTTGGAGACTGG - Intergenic
1034429400 7:151033707-151033729 GAGCCCCTCTGCCTGGTGCTGGG + Exonic
1035288972 7:157825014-157825036 GAGCCAAGCTGCCTTGAGATGGG - Intronic
1035486279 7:159228724-159228746 GAGCCCTTTGGCCTGGAGACTGG + Intergenic
1037628793 8:20633101-20633123 GAGCCACTGTGCCTGGTCCCAGG + Intergenic
1037640893 8:20742172-20742194 GAGCCACACTGCCTGGACTTTGG - Intergenic
1037668811 8:20996985-20997007 GAGGCACTGGGGCTGGAGACGGG - Intergenic
1038696189 8:29808636-29808658 GAGCCACCGTGCCTGGTGACTGG - Intergenic
1038994151 8:32902996-32903018 GAGCCACTGTGCCTGGCCAAGGG - Intergenic
1039106818 8:33999052-33999074 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
1039152375 8:34521048-34521070 GAGCCACCAGGCCTGGAGATTGG - Intergenic
1039243466 8:35582198-35582220 GAGCCACAATGACTGGTGACTGG - Intronic
1039340523 8:36644243-36644265 GAGCCACCGTGCCTGGCCACTGG + Intergenic
1039844204 8:41314283-41314305 GAGCCACTGTGCCTGGCCATGGG - Intergenic
1041457824 8:58079231-58079253 GACCCACTGTGCCGGGAGCCAGG + Intronic
1042386777 8:68185349-68185371 GAGCCAATGTGACTGAAGACTGG - Intronic
1044858504 8:96498772-96498794 GAGCCACTATGCCTGGCCATTGG + Intronic
1044871563 8:96625364-96625386 GAGCCACTCTGCCTGCTGTGTGG + Intergenic
1045004060 8:97902145-97902167 GAGCCACTGTGCCTGGCCAGGGG + Intronic
1045033532 8:98160029-98160051 CAGCCACTCTGCCTGGTGGGTGG + Intergenic
1045234399 8:100337615-100337637 GAGCCTATCTGCCTGCAGACTGG - Intronic
1045291862 8:100840548-100840570 GAGCCACCGTGCCTGGCCACAGG - Intergenic
1045561534 8:103268616-103268638 AAGCTTCTCTGCCTGGAGACAGG + Intergenic
1048079345 8:131108229-131108251 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
1048321918 8:133406662-133406684 GACACACCCTGCCTGGAGTCAGG + Intergenic
1049065268 8:140308596-140308618 GAGCCACTATGCCTGGCCATGGG - Intronic
1049299562 8:141862405-141862427 GAGCCACTCTGTTTGGGGAGGGG - Intergenic
1049431624 8:142567845-142567867 GGGCCACTGTGATTGGAGACAGG + Intergenic
1050624606 9:7489402-7489424 GAGCAACTCTGGCTTGAGTCAGG + Intergenic
1051642945 9:19240381-19240403 GAGCCACTGTGCCTGGTTCCCGG - Intronic
1053226737 9:36365280-36365302 GAGCCACTGTGCCTGACCACAGG - Intronic
1056208516 9:84342877-84342899 GAGCCACTGTGCCTGGCCAGGGG - Intergenic
1057163275 9:92906474-92906496 GAGCCACTGTGCCTGGCCAAGGG + Intergenic
1057384164 9:94592815-94592837 GAGCCACCGTGCCTGGCCACCGG + Intronic
1059346316 9:113631430-113631452 GAGACACAGTGCCAGGAGACGGG - Intergenic
1060051624 9:120382527-120382549 CAGCTCCTCTGTCTGGAGACAGG - Intergenic
1060187897 9:121575038-121575060 GAGCCCCTGTGCCTGGAGCAGGG + Intronic
1060498703 9:124136730-124136752 GAGCCACCATGCCTGGCTACAGG - Intergenic
1060846036 9:126838507-126838529 GAGACACTCTGGGTGGAGCCTGG + Intergenic
1061105796 9:128529412-128529434 GAGGCAGTCTGACAGGAGACAGG - Intronic
1061175374 9:128992477-128992499 GAGCCACTGTGCCTGGCCCCTGG + Intronic
1061224279 9:129271701-129271723 CAGCCCCTCTGCCTGGGGACTGG + Intergenic
1061403547 9:130381659-130381681 GAGCCACTGTGCCTGGCCCCTGG + Intronic
1061763072 9:132863767-132863789 GAGCCACATTGCCTGAAGAAAGG + Exonic
1062091798 9:134682279-134682301 CAGCCATGCTGCCTGGAGGCCGG + Intronic
1062312226 9:135944990-135945012 CAGCGACTCTGCCTGGCGACAGG + Intronic
1203472934 Un_GL000220v1:124638-124660 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1203363209 Un_KI270442v1:235801-235823 GAGCCACTGTGCCTGGACTCCGG - Intergenic
1185646435 X:1619109-1619131 GAGCCACTGTGCCTGGCCAAGGG - Intronic
1185662916 X:1741396-1741418 GAGCCACCGTGCCTGGCCACAGG - Intergenic
1186198166 X:7130527-7130549 GAGCCACTGTGCCTGGCCCCTGG - Intronic
1186626096 X:11295482-11295504 GACCCACTCTGTCTGGACACAGG + Intronic
1186698845 X:12067698-12067720 GAGCCACTGTGCCTGGCCAGTGG + Intergenic
1187876305 X:23806886-23806908 GAGCCACTGTGCCTGGCCATGGG - Intergenic
1189503431 X:41585869-41585891 GAGCCACCATGCCTGGCCACAGG - Intronic
1189508460 X:41637236-41637258 AAGCCACTCTGCCTGGCCTCAGG + Intronic
1189943407 X:46152163-46152185 GAGCCACTGTGCCTGGCCAAAGG - Intergenic
1189986367 X:46557005-46557027 GAGCCACTGTGCCTGGCCATAGG + Intergenic
1192114539 X:68397805-68397827 GAGCCACTGTGCCTGGCCACAGG + Intronic
1194400019 X:93431151-93431173 GAGCCTCTCTCCCTGGTAACGGG - Intergenic
1195011204 X:100733792-100733814 GAGCCACTGTGCCTGGCCTCTGG - Intergenic
1196479972 X:116136355-116136377 GAACTACTCTGCCTGGAGTTGGG + Intergenic
1198089343 X:133312344-133312366 GAGCCACCGTGCCTGGCAACTGG - Intronic
1199598236 X:149524936-149524958 GAGCCACTGTGGCTGGCTACAGG + Intronic
1199924593 X:152449599-152449621 CAGCAACTCAGCCTGGAGCCGGG - Intronic
1200608627 Y:5297314-5297336 GAGCCACACTGCCTGGGGTAGGG + Intronic
1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG + Intergenic