ID: 905225849

View in Genome Browser
Species Human (GRCh38)
Location 1:36478727-36478749
Sequence CATGCCCTGCACTACCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905225849 Original CRISPR CATGCCCTGCACTACCTTGG AGG Intronic
903121152 1:21217834-21217856 GATACCCTGCACCAGCTTGGAGG + Intronic
903212955 1:21828905-21828927 CACACCCTGCTCTACCTGGGGGG - Exonic
904402111 1:30263688-30263710 CAAGCCCTGCAGGACCTTAGTGG + Intergenic
904702135 1:32363979-32364001 AATGCCCTGCAGCACCTCGGGGG - Exonic
904891917 1:33785684-33785706 CATGCCCTATCCTACCATGGAGG + Intronic
905225849 1:36478727-36478749 CATGCCCTGCACTACCTTGGAGG + Intronic
905470105 1:38185370-38185392 CACGCCCTGTGTTACCTTGGGGG - Intergenic
905489724 1:38334037-38334059 GAAGCCCTGCCATACCTTGGAGG + Intergenic
905790121 1:40785053-40785075 CCTGCCCTGCCCTACCCTGCCGG + Intronic
906246985 1:44283185-44283207 CATGCCTAGCTCTGCCTTGGGGG + Intronic
907043913 1:51288056-51288078 CCTGCCCTGCCCTGCCTTTGGGG - Exonic
915244924 1:154549914-154549936 CATCCCCTGAACTACTTGGGAGG - Exonic
920546498 1:206822787-206822809 CAGGCCCTGCACTAGGTTTGGGG - Intronic
920598666 1:207299966-207299988 AATCCCGAGCACTACCTTGGAGG - Intergenic
1064491268 10:15860038-15860060 CACGCCCTGCCTTGCCTTGGTGG - Intronic
1075783491 10:125032554-125032576 CATGCCCTGGACTATTTTTGGGG - Intronic
1075958564 10:126546521-126546543 CTTCCCCTGAACTACCCTGGAGG - Intronic
1077349679 11:2086692-2086714 CAAGCCCTGCAGTACCTTTCCGG + Intergenic
1080039968 11:27749260-27749282 CATGCCCTGCACAACTCTAGGGG - Intergenic
1084779906 11:71401172-71401194 CAGGCCGTGCACTGCCTTAGAGG - Intergenic
1087105760 11:94405129-94405151 CAAGCACTGCAATACCTTGACGG + Intergenic
1096591221 12:52660370-52660392 CCTGCCCTGCTCTACCCTGGTGG + Intergenic
1099999766 12:89819313-89819335 AATGCCCTGCAATGCCTTTGTGG - Intergenic
1111999825 13:95199831-95199853 GATGCCCTGCATTTCCCTGGGGG - Intronic
1119400204 14:74357874-74357896 CATGCCCAGCACCTCCCTGGGGG - Exonic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1123176053 14:106420302-106420324 CATGCCCAGGAACACCTTGGAGG + Intergenic
1202947631 14_KI270726v1_random:43260-43282 CATGCCCAGGAACACCTTGGAGG - Intergenic
1129198589 15:73985362-73985384 CTGGCCCTGCACTTCCTGGGAGG - Exonic
1130973819 15:88757443-88757465 CATGCCCAGCATTACCCTGGTGG - Intergenic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1131438492 15:92441260-92441282 CCTGCCCTGGACTCCCTAGGAGG - Intronic
1132646975 16:1003647-1003669 CATGCCCTGCACTCCTCTGATGG + Intergenic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1144389632 17:14781186-14781208 CAGGCTCTGCAATATCTTGGGGG - Intergenic
1144697321 17:17313811-17313833 CTTGCCCTTCACTACCTGGCAGG - Intronic
1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG + Intronic
1152582068 17:81170545-81170567 CATGCCCTGCACTCCCATCGGGG - Intergenic
1156290702 18:35747085-35747107 CTTGCCCTGCCCTGCCCTGGAGG + Intergenic
1156510422 18:37631957-37631979 CATGCTCTGCAGGCCCTTGGTGG - Intergenic
1160066784 18:75583100-75583122 CGTGCCCGGCACTGCCCTGGTGG - Intergenic
1160368513 18:78350174-78350196 CATGCCCTGGAGAGCCTTGGTGG + Intergenic
1160429996 18:78804535-78804557 CAGGCCCAGCACTCACTTGGTGG + Intergenic
1161378176 19:3950660-3950682 CACCCCCTCCCCTACCTTGGAGG - Intergenic
1161393708 19:4034007-4034029 CATGCCCTTCCCTTCCTAGGTGG + Intronic
1161979839 19:7624621-7624643 CCTGCCCTGCACTGCCAGGGTGG + Intronic
1162328511 19:10012428-10012450 CCTGCCCTGCCCTGCCTTGCTGG + Intergenic
1163602497 19:18257471-18257493 CATGCCCTGCACCACACGGGTGG + Exonic
1166198265 19:41220367-41220389 CACGCCCTGCACTGCCTGGCAGG - Intronic
925086946 2:1115945-1115967 CCTGCCCTCCAGGACCTTGGCGG + Intronic
925369643 2:3335406-3335428 CATGCCCTGCAGGACCATGGAGG + Intronic
929800209 2:45093290-45093312 CATGCCCTCCTCTACCTGGATGG - Intergenic
930543168 2:52733108-52733130 CAGGCTCTGCACTACAGTGGTGG + Intergenic
935327001 2:101946618-101946640 AATGCCCTGCCCTACCATGAAGG + Intergenic
936578551 2:113675581-113675603 CATTCTCTGCACTCTCTTGGAGG + Intergenic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
942590741 2:177543946-177543968 CATGCCCTTCACTACCGGAGAGG - Intergenic
945063141 2:205925796-205925818 CATGCCCTCCACAATCCTGGAGG + Intergenic
947995864 2:234526620-234526642 CATGCACTGTGTTACCTTGGGGG - Intergenic
1174176961 20:48651356-48651378 CTGGCCCTGCCCTACCCTGGGGG - Intronic
1174382325 20:50164072-50164094 CATTCCCTGCCCTGCCTTGGAGG - Intergenic
1178537131 21:33419863-33419885 CAGGCCCTGCACTGCATTTGAGG + Intronic
1183340588 22:37278566-37278588 CACTCCCTGCACTTCCTTTGAGG - Intergenic
951036460 3:17938320-17938342 CCTGCCCTGCTCTACCAAGGGGG + Intronic
953914588 3:46910120-46910142 CAAGCCCCTCACTGCCTTGGAGG - Intergenic
955688064 3:61564090-61564112 CATGGCCTACACTACCGTAGAGG - Intronic
955902278 3:63769809-63769831 CATGCCCTGCACCTCCATGAAGG + Intergenic
967956926 3:194884530-194884552 AAGCCCCTGCACTACCCTGGAGG - Intergenic
976627985 4:87207467-87207489 CATGCCCATCACTAACATGGGGG - Intronic
980730066 4:136812598-136812620 CAAGCCCGGCTCCACCTTGGGGG + Intergenic
980803420 4:137782678-137782700 CAAGCCCAGAACTGCCTTGGTGG + Intergenic
983931432 4:173457218-173457240 CATGCCCTGCACAACCACTGAGG + Intergenic
984885368 4:184444997-184445019 CAGGCCCTGCCGTACCATGGTGG + Intronic
987419666 5:17704224-17704246 CATGCCCTTCACTTCATTGCTGG + Intergenic
993616236 5:90115780-90115802 CATGCCAGGCACTGTCTTGGTGG - Intergenic
997834570 5:137181867-137181889 CATGCCCTGCAGTCTCCTGGGGG - Intronic
1004748193 6:18533979-18534001 CATTCCCTGCATTCCTTTGGGGG + Intergenic
1005373133 6:25155416-25155438 CATGCCCTACACTATCCTGTGGG - Intergenic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1010507441 6:76677580-76677602 CAGGCCCTGAACTGCCTTGTGGG + Intergenic
1011585849 6:88924185-88924207 TTTGCCCTGCATTACCTGGGAGG - Intronic
1015846747 6:137528229-137528251 CATGCCCTGCTCTTCCTGGCAGG + Intergenic
1017052174 6:150403513-150403535 CATTCCCTCCACTACCCTGCTGG - Exonic
1017580086 6:155854995-155855017 CCTGCCCCGCATTCCCTTGGGGG - Intergenic
1017760374 6:157563399-157563421 CTTGCCCTGCTCTGACTTGGGGG + Intronic
1019864516 7:3694294-3694316 CATGCACTGCCCAACCTAGGAGG - Intronic
1022808462 7:33846410-33846432 CTTGCTCTGCATGACCTTGGAGG - Intergenic
1023636388 7:42215405-42215427 CAAGCCCTCCTCGACCTTGGGGG + Intronic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1029654045 7:101912797-101912819 CATGCCCAGCAATACCCTGTCGG - Intronic
1030309411 7:108054347-108054369 CTTTCCCTGAACTACCTAGGTGG + Intronic
1038219051 8:25590232-25590254 CATGCCCTGCACAACCCCAGGGG - Intergenic
1038392749 8:27219757-27219779 GATGCCCTTCACTACTTTGCTGG + Intergenic
1047311281 8:123694472-123694494 CATGTGGTGCACTGCCTTGGGGG + Intronic
1047910962 8:129528551-129528573 CAGGCCCTGCCCAACCCTGGTGG + Intergenic
1049620146 8:143594481-143594503 CAGGCCGTGCAGCACCTTGGTGG - Intronic
1051265414 9:15304840-15304862 CAAGCCCTGTACTAGCCTGGAGG - Intronic
1056119600 9:83474227-83474249 CATGGCCTTCACTTCCTTTGTGG + Intronic
1056660417 9:88539072-88539094 CATCCCCTGCACCAACTGGGAGG - Intronic
1060348820 9:122839470-122839492 ACTGCCCTGCACCACCTCGGTGG - Intergenic
1061001567 9:127905634-127905656 CTGGCCCTGCCCTTCCTTGGTGG - Intergenic
1061404126 9:130384338-130384360 CATGCCTTTCTCTACCGTGGTGG + Intronic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1196917348 X:120551033-120551055 CATGCTCTGCAATACTTTCGGGG + Intronic
1197722685 X:129755838-129755860 CATGTCAGGCACTCCCTTGGAGG - Intronic
1198431973 X:136576426-136576448 AATGCCCTGCACCCCCTTGCAGG - Intergenic
1199495934 X:148452410-148452432 TATGCCCTGGACTACCTTACTGG + Intergenic