ID: 905225895

View in Genome Browser
Species Human (GRCh38)
Location 1:36479049-36479071
Sequence AAAGAAGCCCAGGCAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 700
Summary {0: 1, 1: 1, 2: 3, 3: 59, 4: 636}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905225895 Original CRISPR AAAGAAGCCCAGGCAGAGCT TGG (reversed) Intronic
900375946 1:2354839-2354861 CGTGAGGCCCAGGCAGAGCTCGG + Intronic
900431279 1:2604289-2604311 AAAGGACGCCGGGCAGAGCTGGG + Intronic
900593133 1:3468622-3468644 AAAGCAGCCCAGAAAGAGCATGG - Intronic
900716079 1:4145083-4145105 AAAGAAGCTGAGGCAGAGAGAGG + Intergenic
901340587 1:8495291-8495313 ATAGGAGCAGAGGCAGAGCTGGG - Intronic
901531891 1:9859028-9859050 AAAGCAGCCCAGGGACACCTTGG + Intronic
901560211 1:10064143-10064165 AAAGGAGCGCCGGCAGAGATTGG - Intronic
901598219 1:10401723-10401745 AATGAAGCCCAGGCTGGGCGCGG + Intronic
901681249 1:10914193-10914215 AAAGAAGCCCAGAAAGCCCTGGG + Intergenic
902540688 1:17152404-17152426 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
902735459 1:18397847-18397869 GAAGAGGCCCAGACAGAGTTGGG + Intergenic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
903313009 1:22475110-22475132 ACAGAAATCCAGGCAGAGGTGGG + Intronic
903342893 1:22665681-22665703 TGAGAAGCCCAGGCAGGGTTCGG - Intergenic
903516690 1:23916006-23916028 AAAGAAGACCAGAAGGAGCTGGG + Intergenic
903661678 1:24982399-24982421 AAAAAAACCCAGGCAGAGGAGGG - Intergenic
903739982 1:25553056-25553078 ACAGTAGCCCAGGGAGAGCAGGG - Intronic
904503106 1:30929007-30929029 ACAAAGGGCCAGGCAGAGCTGGG + Intergenic
904558487 1:31381089-31381111 AAACCAGCCCAGGCAGCACTAGG + Intergenic
904650674 1:32003615-32003637 AGAGAAGCCCAGGGAGAGAAGGG - Intergenic
905002020 1:34680048-34680070 AAAGGGGCCCAGGTACAGCTCGG - Intergenic
905122896 1:35695441-35695463 AAAGAAGAACAGGCAGAGGAGGG - Intergenic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
905410113 1:37762810-37762832 AAAGCCTCCCAGGCCGAGCTGGG - Exonic
905768835 1:40624560-40624582 ATAGAGGCTCAGGCAGAGATAGG + Exonic
906001001 1:42424871-42424893 AAAGAAGCCTGGGCAGAGCACGG - Intergenic
906107986 1:43306029-43306051 GAAGAGGCACAGGCAGACCTGGG + Intronic
906153382 1:43600540-43600562 ACAGAAGCACAGGGACAGCTGGG - Intronic
906715473 1:47965441-47965463 GATGAAGCCCAGGCAGAGGGAGG + Intronic
906992722 1:50755840-50755862 AAAGGAGTCAATGCAGAGCTTGG - Intronic
907158077 1:52352710-52352732 ATAAAGGCACAGGCAGAGCTGGG + Exonic
907188965 1:52633154-52633176 CAGGAAGCGCAGGCAGAGCCAGG + Intergenic
907685809 1:56609973-56609995 AAAGGAGCCAATGTAGAGCTTGG - Intronic
908487677 1:64611049-64611071 AAAGGGGCCAAGGCACAGCTTGG - Intronic
909105181 1:71397952-71397974 AATGAAGCCAAGGTACAGCTTGG + Exonic
909167425 1:72246984-72247006 ACAGAAGCCCAGGTACAGCTCGG - Intronic
909452443 1:75812969-75812991 ATAGTAGCCCAGGTAGAGTTTGG + Intronic
910077385 1:83297452-83297474 AAAAAAGTCCAGGCTGAGGTGGG + Intergenic
910423912 1:87100329-87100351 AAAGGAGTCCAGGTATAGCTTGG - Intronic
911790912 1:102014402-102014424 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
912206046 1:107510633-107510655 AAAGAAGCCAAGGCAGAGCTTGG + Intergenic
912469718 1:109898153-109898175 AAAGAAGCCCAGGTTGCTCTGGG - Intergenic
912587962 1:110784086-110784108 AAAAAATACCAGGCAGAGCCAGG + Intergenic
912735914 1:112149467-112149489 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
912846106 1:113075985-113076007 AAAGTAGGCCAGGCCGGGCTTGG - Intronic
913458983 1:119063655-119063677 AAAGGGGCCAAGACAGAGCTCGG + Intronic
914422343 1:147541002-147541024 GAAAAAGCCCAGGCTGAGTTGGG - Intergenic
914857380 1:151362619-151362641 AAAGGGGCCCAGGTATAGCTTGG + Intergenic
915034215 1:152909009-152909031 GGAGAAACCTAGGCAGAGCTGGG + Intronic
915468798 1:156113882-156113904 GAAGGAACCCAGGCAGTGCTTGG + Intronic
916209828 1:162351453-162351475 GAAGTAGCCCTGGCTGAGCTTGG - Intronic
916384830 1:164255613-164255635 AAAGGAGCCAAGGTATAGCTTGG + Intergenic
916729348 1:167552754-167552776 ATAGGAGCCCAGGCAGGGCGCGG + Intronic
916901412 1:169228197-169228219 ATAGAAGCCCAGGCTGGGCATGG - Intronic
917002503 1:170375161-170375183 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
917313865 1:173704642-173704664 AAAGAAGCACAGACAGTCCTTGG - Intergenic
917839490 1:178966105-178966127 AAAGAGGACCAAGCAGAGTTTGG + Intergenic
918463064 1:184795638-184795660 AAAGAACCCGAGGCAGTGATGGG + Exonic
918757699 1:188358115-188358137 AAAGGAGCCCAGGTACAGCTTGG - Intergenic
918766942 1:188499075-188499097 AAAGAGGTCCAGGCACAGCTTGG + Intergenic
919291946 1:195643794-195643816 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
920081770 1:203379978-203380000 AAAGGAAGCCAGGCAGAGTTGGG + Intergenic
920693018 1:208161070-208161092 AAAGGATCCAAGGCAGACCTGGG - Intronic
920722832 1:208403602-208403624 GAGGAAACTCAGGCAGAGCTTGG + Intergenic
921128021 1:212195411-212195433 AAAGGAGCCCAGGTATAGCTTGG + Intergenic
922228271 1:223664554-223664576 AAAACAACACAGGCAGAGCTAGG + Intronic
922852982 1:228749843-228749865 AAAGGAACCCAGGAAGAGCCAGG - Intergenic
1063737697 10:8779218-8779240 TAAGAAGGCCAGGCAAAGATGGG + Intergenic
1064450733 10:15439974-15439996 AAAGCAACCCTGGCAGAGGTGGG + Intergenic
1064509254 10:16071718-16071740 ATAGAAGCCCAGAGAGAGGTAGG + Intergenic
1064563257 10:16613483-16613505 AAAGATGCCCAGGCTCAGATGGG - Intronic
1064584178 10:16823016-16823038 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1064712497 10:18141033-18141055 ATGGAAGCCGAGGCAGAGCCAGG - Intronic
1065179182 10:23107765-23107787 ATATAAACCCAGGCTGAGCTGGG - Intronic
1065494554 10:26315211-26315233 AAAGAGATCCAGGGAGAGCTGGG - Intergenic
1065564786 10:26997630-26997652 AGAGAAGCTGAGGCAGGGCTTGG + Intronic
1066451845 10:35537115-35537137 AAAGGGGCCAAGGCACAGCTCGG + Intronic
1066612591 10:37265580-37265602 AAGGAGGCCCAGGCAGGCCTGGG - Intronic
1066704220 10:38160015-38160037 AGAGAAGCTGAGGCAGTGCTTGG - Intergenic
1066986402 10:42471861-42471883 AGAGAAGCTGAGGCAGGGCTTGG + Intergenic
1067155601 10:43779020-43779042 AAAGAAGCCCGGGCAGGCCTGGG + Intergenic
1067322019 10:45230087-45230109 AAAGGGGCCTAGGCACAGCTTGG + Intergenic
1067702688 10:48585082-48585104 AGAGAAGCTGAGGCAGGGCTTGG + Intronic
1068011303 10:51455165-51455187 AAAGAGGCCAAGGTAGAGCTTGG - Intronic
1069282784 10:66676498-66676520 AAAGTATCCCAGGCAGAGAGAGG - Intronic
1069701027 10:70426062-70426084 CAAGAAGCCCAGGAAGAAATGGG - Exonic
1070704712 10:78629255-78629277 AAAGAGGGCCTGGCAGAGCCAGG - Intergenic
1070853304 10:79584824-79584846 AATGCATCCCAGGCAGAGATGGG - Intergenic
1070870069 10:79743777-79743799 AAAGGGGCCAAGGTAGAGCTCGG + Intergenic
1070892834 10:79954805-79954827 AGAGAAGCCAAGGCAGGGCTTGG + Intronic
1070909864 10:80108699-80108721 AGAGAAGCTGAGGCAGGGCTTGG + Intergenic
1071243841 10:83741064-83741086 AAAGGAGCCAAGGTATAGCTTGG - Intergenic
1071307989 10:84315992-84316014 AAAGATGCATAGGCAGAGGTAGG - Intergenic
1071636991 10:87265997-87266019 AAAGGGGCCAAGGTAGAGCTCGG + Intergenic
1071658253 10:87471957-87471979 AAAGGGGCCAAGGTAGAGCTCGG - Intergenic
1071816307 10:89235352-89235374 AAAGAAGCCCTAGGAGGGCTGGG + Intronic
1071981041 10:91004505-91004527 AAAGAGGCCAAGGTACAGCTCGG - Intergenic
1071984780 10:91039484-91039506 ATAGAAACCCAGGCAGAACAAGG + Intergenic
1072410328 10:95196019-95196041 AAAGCAGCACAGGCTGGGCTGGG - Intronic
1072744441 10:97929953-97929975 AGAGGAGCCCAGGCTGTGCTGGG + Intronic
1072948306 10:99830540-99830562 AAAGAAACAAAGGAAGAGCTTGG - Intronic
1073033582 10:100547551-100547573 ACAGCAGCCCTGGCACAGCTGGG - Intronic
1073282828 10:102367235-102367257 AAAGAAGACCCAGCACAGCTTGG + Intronic
1073356538 10:102859459-102859481 AAAGATGACCAGACAGGGCTGGG - Intronic
1073922940 10:108480486-108480508 AAAGGAGCCAAGGTACAGCTCGG + Intergenic
1074445490 10:113518009-113518031 ACAGCAGCCCAGCCAGAGCAGGG - Intergenic
1074776505 10:116771506-116771528 AAAGAGGCCAGGGCAGAGCCTGG + Intergenic
1075049239 10:119170349-119170371 ATAGAAGGTGAGGCAGAGCTGGG + Intronic
1075498736 10:122953365-122953387 AAAGAAGCCCCGGCCGGGCACGG - Intronic
1076383995 10:130044388-130044410 AGGGAAGCCCAGGCTGGGCTGGG - Intergenic
1076470499 10:130714869-130714891 AGTGAAGAGCAGGCAGAGCTGGG - Intergenic
1076770909 10:132664185-132664207 AAAGAAAGCCAGGCAGAGCAAGG - Intronic
1077499800 11:2904178-2904200 CAAGAAGCTCAGGCAGAGTCAGG + Intronic
1077722992 11:4646129-4646151 AGAGAAGCCCAGACATACCTGGG - Intronic
1077726401 11:4679284-4679306 AAAGTAGCCCAGGCTGGGCACGG - Intergenic
1077740849 11:4843493-4843515 AAAGGAGCCAAGGTACAGCTCGG - Intronic
1078698601 11:13659727-13659749 AAAGGAGCCCAGGTGCAGCTTGG + Intergenic
1079737327 11:24013146-24013168 AAAGGAGCCCAGTTACAGCTTGG + Intergenic
1080079681 11:28201499-28201521 AAAGAAGCCCAGGACCAGATGGG - Intronic
1080477470 11:32608897-32608919 AAAGGAGCCAAGTCACAGCTTGG - Intronic
1080694301 11:34587844-34587866 AAAGAGGAACAGGCAGTGCTGGG + Intergenic
1082766198 11:57169821-57169843 AAAGGGGCCAAGGTAGAGCTTGG - Intergenic
1082863794 11:57879843-57879865 AAAAAAGCCCAGGCTGAGAAAGG - Intergenic
1083433610 11:62628021-62628043 AAAGAAGCAGAAGGAGAGCTAGG - Intronic
1083627221 11:64077952-64077974 AAAGGAGGCCAGGCTGAGCACGG - Intronic
1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG + Intronic
1084039089 11:66531210-66531232 AAAGCAGCAGAGGCAGGGCTTGG - Intronic
1084051243 11:66601385-66601407 AAAATAGCCCAGTCAGAGCCGGG - Intronic
1084068106 11:66717128-66717150 AAAAAAAGCCAGGCAGAGTTAGG + Intronic
1084520777 11:69661320-69661342 AACGAAGCCCAGGCAGGGAGAGG + Intronic
1084864152 11:72041884-72041906 CAAGAAGCCCAGGCAGATTCTGG + Intronic
1086173221 11:83859911-83859933 AAAGGGGCCAAGGTAGAGCTTGG + Intronic
1087062104 11:93989270-93989292 ACTGGAGCCCAGGAAGAGCTGGG + Intergenic
1090376576 11:126293860-126293882 TAAGAAGACCATGGAGAGCTTGG + Intronic
1091216403 11:133904973-133904995 GAAGATACCCAGGCAGGGCTGGG + Intergenic
1091272941 11:134330874-134330896 AAAAAAACCCTGGCAGAACTGGG - Intergenic
1091897094 12:4114317-4114339 AAAAAAGCCCAGGCCGGGCGTGG + Intergenic
1092977018 12:13755352-13755374 CAAATAGCCCAGGCAGAGCCAGG - Intronic
1093570508 12:20661610-20661632 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1094379880 12:29831259-29831281 AAAGAGGCCCAGGTACAGCTTGG - Intergenic
1094445637 12:30526890-30526912 AAAGAAACTCAGGCTTAGCTAGG - Intergenic
1096180468 12:49547880-49547902 ACAGAGGTCCTGGCAGAGCTGGG - Intronic
1096423922 12:51484825-51484847 AAAGAAGTACAGGAAGTGCTGGG + Intronic
1096572176 12:52529924-52529946 AAGGAAGGGCAGGCAGGGCTGGG - Intergenic
1098939559 12:76518755-76518777 AAAGGGGCCCAGGTACAGCTTGG - Intronic
1099008878 12:77267059-77267081 AAAGCAACCAAGGCAGAGCAAGG - Intergenic
1099627184 12:85090071-85090093 AAAGGAGCCCAGGCACAGCTTGG + Intronic
1099860716 12:88222440-88222462 AAAGGTGCCCAGGTATAGCTTGG + Intergenic
1099984652 12:89648889-89648911 AAAGGGGCCCAGGAACAGCTTGG + Intronic
1100086542 12:90917709-90917731 AAAGAAGCCCAGACCGAGGTAGG - Intronic
1101321174 12:103674243-103674265 AAAGAACCTCAGTCTGAGCTGGG + Intronic
1101682292 12:106981069-106981091 GATGAAGCACAGGCAGATCTGGG + Intronic
1101823305 12:108200903-108200925 AAGGAAACCCAGGCAGCACTGGG + Intronic
1102993893 12:117333636-117333658 AACGCAGCCCAGGCTGAGCCCGG - Intronic
1103264569 12:119618096-119618118 AAAGGAGCCAAGGTACAGCTTGG + Intronic
1103358167 12:120337096-120337118 AAAGGAGCCAAGGTACAGCTCGG - Intergenic
1103885503 12:124197334-124197356 GAAGTAGCACTGGCAGAGCTTGG - Intronic
1103908094 12:124337583-124337605 AAGGAAGCTGAGGCAGGGCTAGG + Intronic
1104729112 12:131095246-131095268 CAAGGTGCCCAGGCAGGGCTGGG - Intronic
1104752831 12:131250924-131250946 AAAGAACCCAAAGCTGAGCTGGG + Intergenic
1104933394 12:132352155-132352177 AAGGAGGCCGAGGCGGAGCTCGG + Intergenic
1105257200 13:18751650-18751672 AAAGATGCGCAGGTACAGCTTGG - Intergenic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105437458 13:20390843-20390865 AAAGGAGGTCAGCCAGAGCTGGG + Intergenic
1105547562 13:21361975-21361997 AAAGAAGCCCAGCCATCCCTGGG + Intergenic
1105650549 13:22372364-22372386 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
1106529158 13:30572144-30572166 AAACAATGCCAGGCAGAGGTGGG + Intronic
1106808777 13:33338581-33338603 AAAAAATCCCAGTCAGAGCAAGG + Intronic
1107009923 13:35660061-35660083 AAAGAACACCAGTCAGAGATGGG - Intronic
1108000935 13:45905085-45905107 AAATAAGCCCAAGCTGAACTGGG + Intergenic
1109503619 13:63270242-63270264 AAAGAGGCCCAGGTACAGCTTGG - Intergenic
1110189479 13:72714684-72714706 AAAGTGGCCCAGGTATAGCTTGG + Intronic
1110534922 13:76639757-76639779 CAAATAGCCCAGGCAGAGGTTGG + Intergenic
1112048084 13:95617438-95617460 ATAGGAGTCCAGGCAGGGCTTGG - Intronic
1112160102 13:96858283-96858305 AAAGAAGCCAACACAGTGCTAGG + Intergenic
1112512229 13:100020142-100020164 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1112580275 13:100672438-100672460 AAAGAAGCCCTGTCTGAGCAAGG + Intronic
1113087756 13:106585717-106585739 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1113561537 13:111285586-111285608 ACAGCAGCCCTGGCCGAGCTTGG + Intronic
1113611955 13:111653054-111653076 GGGGAAACCCAGGCAGAGCTGGG - Intronic
1113899908 13:113790934-113790956 AAGGACAGCCAGGCAGAGCTGGG + Intronic
1114585953 14:23813806-23813828 AGAGAAGGCCAGGCAAAACTGGG - Intergenic
1115051873 14:29072716-29072738 AAAGAGGCCAAGGTATAGCTTGG - Intergenic
1115441729 14:33443565-33443587 TAAGGAGCCCAGGCAGAGAGGGG + Intronic
1115510968 14:34137558-34137580 AAAGAAGGCAAGCCAGAGCAAGG + Intronic
1115878764 14:37891791-37891813 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1117378530 14:55137568-55137590 GAAGAAAGCCAGGCAGAGCGAGG + Intronic
1117911830 14:60644019-60644041 AAATTATCCCAGGCGGAGCTGGG + Exonic
1118239585 14:64043599-64043621 AAAGGAGCCAAGGAACAGCTCGG + Intronic
1118755258 14:68838487-68838509 ACAGGAGCCCAGGTACAGCTTGG + Intergenic
1119450159 14:74702426-74702448 AAAGGAGCCAAGGTACAGCTTGG - Intronic
1119741699 14:77017928-77017950 AGAGATGGCCAGGCAGAGGTGGG + Intergenic
1121030812 14:90657180-90657202 CAGGGAGCCCATGCAGAGCTTGG + Exonic
1121390186 14:93566905-93566927 AAAGAATTCCAGGCCGAGCGTGG - Intronic
1121411169 14:93749153-93749175 ACAGAAGGCCTGGCAGATCTGGG - Intronic
1121423823 14:93834122-93834144 ACAGAAGTCCAGGCAGGGCAGGG - Intergenic
1121735278 14:96213958-96213980 AAAGATGCTCAGGCAGGGCCAGG + Intronic
1122873521 14:104652145-104652167 AAAGGTGCCCAGGCTGAGCCGGG - Intergenic
1123031078 14:105451362-105451384 AGAGAAGAGCAGGCAGGGCTTGG + Intronic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1124226241 15:27897438-27897460 AAAGGAGCCAAGGCAGAGCTCGG + Intronic
1124291423 15:28456380-28456402 AAGGAGGCTGAGGCAGAGCTGGG - Intergenic
1125685896 15:41563055-41563077 AAACCAGCCCACGCAGAACTAGG + Intronic
1126802648 15:52313708-52313730 AATGAAGCCCAGGCCGAGGCTGG + Exonic
1127639057 15:60898159-60898181 AAAGAAGCAGAGGCTCAGCTTGG + Intronic
1127681812 15:61305039-61305061 ATAGGAGCCAAGGCAGGGCTTGG + Intergenic
1128429100 15:67573974-67573996 CAATAAACCCAGTCAGAGCTGGG - Intronic
1128449019 15:67790931-67790953 ACAGAAGACGAGTCAGAGCTAGG + Intronic
1129901065 15:79149820-79149842 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1130915221 15:88299653-88299675 ACAGATGCCCACGGAGAGCTGGG - Intergenic
1131363059 15:91812166-91812188 AAAGAAGTCCAGGCTGGGCGTGG - Intergenic
1131719341 15:95150323-95150345 TAACAAGCCCAGGCAGAGAGGGG - Intergenic
1131868949 15:96741963-96741985 TATGAAACACAGGCAGAGCTAGG - Intergenic
1132301902 15:100781251-100781273 AAAGAAGCCCTGGAAGGGCCCGG - Intergenic
1132728035 16:1347202-1347224 AAAGGGGCCCAGGCAGCACTGGG - Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135473624 16:22754202-22754224 AAGGAAACTCAGGCATAGCTGGG + Intergenic
1135663020 16:24312819-24312841 AAAAAAGGCAGGGCAGAGCTGGG + Intronic
1135996298 16:27251976-27251998 GGGGAAACCCAGGCAGAGCTAGG - Intronic
1137271447 16:46905020-46905042 AGAGAGGCTGAGGCAGAGCTAGG + Intronic
1137272749 16:46913042-46913064 AGAGAAGCCAGGGCACAGCTGGG - Intronic
1137273896 16:46920688-46920710 AAAGAAGCCCAAGAACAGTTTGG - Intronic
1137485771 16:48889479-48889501 CATGAAGCCCATGCAGTGCTGGG - Intergenic
1137818591 16:51422396-51422418 AAAGGAGCCAAGGTACAGCTCGG - Intergenic
1137906505 16:52327488-52327510 AGGGAAGCCCAGGTAGAGCTGGG + Intergenic
1138181254 16:54941627-54941649 GAAGAAGCCTAGGTAAAGCTAGG + Intergenic
1139685571 16:68600801-68600823 AAAGAAGCCAAGGCTGGGCGTGG + Intergenic
1139754094 16:69129132-69129154 AGAAAAGCCCAGGCAGAGGCCGG + Intronic
1139891505 16:70255866-70255888 AAAGAGGCCCTGGCAGCCCTTGG + Intronic
1142135678 16:88451032-88451054 AAAGCAGCCCTGGCAGGGTTAGG + Intergenic
1142142429 16:88478632-88478654 AACGAGGCTCCGGCAGAGCTGGG + Intronic
1142150470 16:88510366-88510388 ACCGAGGACCAGGCAGAGCTTGG - Intronic
1142187943 16:88703376-88703398 AAAGGGTCCCAGGCAGAGCTTGG + Intronic
1143368514 17:6423936-6423958 AGAGAAGCCCAGGAAGCCCTTGG + Exonic
1143455990 17:7068130-7068152 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1143878630 17:10012810-10012832 AGAGAAACCCAGGCAGGGCGCGG + Intronic
1145233801 17:21194450-21194472 CAAGAAGCCCAGCCACAGCCCGG + Intergenic
1145416022 17:22714794-22714816 TGAGAAGCCCAGGCTTAGCTTGG - Intergenic
1146123913 17:30217428-30217450 ACTGAGGCCCAGGAAGAGCTGGG + Intronic
1146187926 17:30737506-30737528 AAAGAAGGCCAGGCTGGGCATGG - Intergenic
1146953352 17:36921507-36921529 AAAGCAGGCAAGGCAGGGCTTGG - Intergenic
1147113633 17:38282312-38282334 GAGAGAGCCCAGGCAGAGCTGGG + Intergenic
1147561333 17:41511218-41511240 TAAGAAGCCCAGCCTGAGCAGGG + Intergenic
1147875369 17:43617085-43617107 GAAGAAGCCCATGCAGATCCTGG - Intergenic
1148333842 17:46828491-46828513 AAAGAAGCCCTGGCAGGGCGTGG - Intronic
1148415980 17:47506873-47506895 GAGAGAGCCCAGGCAGAGCTGGG - Intergenic
1149072193 17:52556401-52556423 AAAGGGGCCAAGGTAGAGCTTGG + Intergenic
1149259444 17:54863020-54863042 AAATAAGGGCAGGCAGAGCAAGG + Intergenic
1149366773 17:55953022-55953044 AAAGGAGCCAACACAGAGCTTGG + Intergenic
1150427196 17:65086233-65086255 GAAGCAGCCCAGGCAGGGATTGG + Intergenic
1151150812 17:72084567-72084589 AAAGAAGTCCCAGCAAAGCTGGG + Intergenic
1151694243 17:75705965-75705987 GAATAAGACCAGGCAAAGCTGGG - Intronic
1151902019 17:77022578-77022600 AAAGGGGCCCAGGTACAGCTGGG + Intergenic
1152592728 17:81221884-81221906 AAGGAAGCCCAGGGTGACCTTGG - Intronic
1152841552 17:82572026-82572048 AAAGAAGGTGAGGCAGAGCATGG - Intronic
1152960471 18:76823-76845 AAAGAAGGTCAGGCAGTGCATGG - Intergenic
1153201473 18:2651932-2651954 AAAGAAGCCAAATCAGAGCCGGG - Intergenic
1154297366 18:13162448-13162470 AGAGAAGCCCAGAGAGAGTTAGG + Intergenic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154425258 18:14267223-14267245 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154432954 18:14322462-14322484 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155355907 18:24953889-24953911 ACAGAAGGCCTGGCAGAGATGGG - Intergenic
1155410635 18:25541117-25541139 AGAGAAGGCCAGGCAGAGGATGG + Intergenic
1155707858 18:28838375-28838397 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
1156153044 18:34266317-34266339 AAAGAAGCCAATACACAGCTCGG + Intergenic
1156265921 18:35488477-35488499 AAAGGGGCCAAGGTAGAGCTTGG - Intronic
1156493622 18:37511441-37511463 AGGGAGGCCCAGGCTGAGCTGGG - Intronic
1156736227 18:40263121-40263143 AAAGGACCCCAGGTACAGCTTGG + Intergenic
1157616586 18:48991060-48991082 GAAGGAGGCCAGGGAGAGCTCGG + Intergenic
1158129723 18:54139487-54139509 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1159116405 18:64117894-64117916 AAAGAAAAGCAGGCAGAGGTAGG - Intergenic
1159282933 18:66310556-66310578 AAAGAAGCCAAGGTACAGCTTGG - Intergenic
1159461207 18:68724114-68724136 AAAGGGGCCAAGGCATAGCTTGG - Intronic
1160180680 18:76633122-76633144 AAAGAAGAGCAGGCAGGGCATGG + Intergenic
1160209202 18:76862151-76862173 AAAGAAACCCAGGCCGGGCAGGG - Intronic
1160542925 18:79634884-79634906 AATGAAGCCCATGCAGAGGAAGG + Intergenic
1161054228 19:2181830-2181852 AGAGAAACCCAGGCAGAGAGAGG - Intronic
1161390956 19:4019871-4019893 ACAGAGGCCCTGGCAGGGCTGGG + Intronic
1161602148 19:5190866-5190888 AAAGAAGCCCTGGCTGGGCGCGG + Intronic
1161737234 19:5998828-5998850 AGGGAGGCCCAGCCAGAGCTTGG + Intronic
1162056226 19:8065751-8065773 ACAGAGGCCCAGGCAGAGGCCGG + Exonic
1162612903 19:11769962-11769984 AAAGAGGCCCAGGCTGGGCACGG - Intronic
1163056817 19:14726162-14726184 AAAGGGGCCCAGGTATAGCTTGG - Intronic
1163251436 19:16128454-16128476 AAAAAAGCCCAGACATAGCAGGG + Intronic
1164026340 19:21356743-21356765 AAATAAGGCCAGCCAGATCTAGG - Intergenic
1164049435 19:21571630-21571652 AAATAAGGCCAGCCAGATCTAGG + Intergenic
1164563594 19:29310469-29310491 AAAGAAGGCCAGGCTAAGATGGG - Intergenic
1164759609 19:30719235-30719257 GAAGAATTCCAGACAGAGCTGGG + Intergenic
1166141504 19:40807742-40807764 AAAGAAGCCAAGGGAAACCTGGG - Intronic
1167119150 19:47506488-47506510 AAAGAAGGGAAGGCTGAGCTGGG - Intronic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925527029 2:4814216-4814238 AAAGGAGCCAAGGTATAGCTTGG - Intergenic
925886785 2:8400517-8400539 AAGGGAAGCCAGGCAGAGCTGGG - Intergenic
926524273 2:13957192-13957214 AGAGAAGCACAGGCAGAGAGAGG - Intergenic
926689722 2:15725026-15725048 AAAGAGGATCAGGCAGAGCTGGG - Intronic
926860488 2:17303717-17303739 AAGGAGGGCAAGGCAGAGCTGGG - Intergenic
927048394 2:19303106-19303128 ATAGCATCCCAGGCAGAGCATGG + Intergenic
927302813 2:21535840-21535862 AAAGGAGCCCAGGAACAGCTCGG + Intergenic
927678259 2:25122734-25122756 AAAGAAACCCCGGCAGAGTGAGG - Intronic
927718398 2:25367479-25367501 AACGATGCCCACACAGAGCTGGG + Intergenic
928402242 2:30987572-30987594 AAAGAAGCCCAGAGAGGCCTGGG - Intronic
928983740 2:37160320-37160342 AAACAAGCACAGGGATAGCTGGG - Intergenic
929156671 2:38794503-38794525 GAACAAGCCTAGGCAGAGGTTGG + Intergenic
930551392 2:52839200-52839222 AAAGAAGCCAAAGGAGAGCTTGG - Intergenic
930812898 2:55561142-55561164 AAAGGAGCCAAGGTACAGCTTGG + Intronic
930960149 2:57251592-57251614 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
930990728 2:57650811-57650833 AGGGGAGCCAAGGCAGAGCTGGG - Intergenic
931667936 2:64623605-64623627 AAAAAAGCCCATGGAGTGCTTGG + Intergenic
932113401 2:69022450-69022472 AAAGAAGGCAGGGCAGAGCAGGG + Intronic
932752325 2:74379347-74379369 AAGGGAGCCCTGGCAGAGCCAGG + Intronic
933085092 2:78046006-78046028 AAAGATGCCAAGGTACAGCTCGG + Intergenic
933334746 2:80943464-80943486 AAAAAAGCACAGGCGGAACTAGG - Intergenic
933988126 2:87610928-87610950 ACAGAAGCTGAGGCACAGCTTGG + Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
934736809 2:96693843-96693865 TGAGAAGCCCAGACAGAGCTGGG + Intergenic
935107943 2:100062953-100062975 AAAAATGACCAGGCAGGGCTGGG + Intronic
935425809 2:102917266-102917288 AAAGAGGCCAAGGCATAGCTCGG - Intergenic
936288778 2:111201545-111201567 AGGGAAGACCAGCCAGAGCTTGG + Intergenic
936305714 2:111339880-111339902 ACAGAAGCTGAGGCACAGCTTGG - Intergenic
937073461 2:119083557-119083579 AAGGAGGGCCAGGCAGGGCTGGG - Intergenic
937730346 2:125222690-125222712 AAAGAGGCCAAGGTAGAGCTTGG - Intergenic
938079306 2:128361073-128361095 AGAAAGCCCCAGGCAGAGCTCGG + Intergenic
938777821 2:134557453-134557475 AAAGTGGTCCAGGCACAGCTTGG + Intronic
939125374 2:138171937-138171959 AAAGCGGCCCAGGTACAGCTTGG + Intergenic
940729813 2:157375739-157375761 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
940905231 2:159163235-159163257 GAAGGAGGCCAGGCACAGCTGGG - Intronic
941196712 2:162461280-162461302 AAAATGGCCAAGGCAGAGCTGGG - Intronic
943788154 2:191901378-191901400 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
944329352 2:198446962-198446984 AAATAAACACAGGCAGAGTTGGG - Intronic
945347026 2:208731140-208731162 CAAGAAGCCCAGGATTAGCTTGG + Intronic
946732480 2:222722879-222722901 AAAGAAGTCCAGGCTGGGCCGGG + Intergenic
947137724 2:226991904-226991926 CACGAGTCCCAGGCAGAGCTGGG + Intronic
947241248 2:227996688-227996710 TAAGAAGCCCAGGAAGAGGGTGG - Intronic
947536552 2:230943392-230943414 CAAGAAGCCCAGCCAGCCCTGGG + Intronic
947654171 2:231812055-231812077 AAACAACCCCAAGAAGAGCTGGG - Intergenic
948896985 2:240932231-240932253 AAAGGAGTCCGGGCAGAGCCAGG + Intronic
948908241 2:240989980-240990002 AAAGAAGTGCAGGCAGTGCCCGG - Intronic
948929726 2:241124282-241124304 AGAGCAGCCCAGGCAGAGGCAGG + Intronic
1169245860 20:4024005-4024027 ATAGAAGCCCAGAGAGAGGTAGG - Intergenic
1169322557 20:4645470-4645492 AAAGTGGCCCAGGTACAGCTTGG - Intergenic
1169343338 20:4812258-4812280 AAAGGAGTCCAGGCAGTGATGGG - Intronic
1169609663 20:7364677-7364699 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1169792857 20:9429785-9429807 AAAGATGCCAAGGCAGGCCTTGG + Intronic
1170115274 20:12851319-12851341 AAAGAACACCAGGCAGTGCTGGG + Intergenic
1170289363 20:14751167-14751189 AAGGAAGCCCAAGGAGGGCTGGG - Intronic
1170310055 20:14982579-14982601 AAAGGGGCCAACGCAGAGCTTGG + Intronic
1171294513 20:24005723-24005745 AAGAAAGCCCAGGCAGACCTTGG - Intergenic
1171358991 20:24573388-24573410 AAAGCAGCACAGGCAAAGCTGGG - Intronic
1171367303 20:24633941-24633963 AGGGAACCCCAGGCAGAGTTTGG - Intronic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1173463321 20:43261411-43261433 CAAGAGGCCCAGGCAGGGCTGGG - Intergenic
1174414116 20:50356032-50356054 CAAGAAGGAGAGGCAGAGCTGGG + Intergenic
1175284415 20:57828525-57828547 AAAAGACTCCAGGCAGAGCTGGG - Intergenic
1175460140 20:59146260-59146282 AGAGAAGCAGAGGCAGAGATGGG + Intergenic
1175694012 20:61087654-61087676 AGGGAAGACCAGGCAGAGCCTGG + Intergenic
1176023579 20:62974769-62974791 AAGGAGGACCAGCCAGAGCTGGG - Intergenic
1176023642 20:62975015-62975037 AAAGGTGCCCAGGCAGTGCTGGG - Intergenic
1176657723 21:9602717-9602739 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1177250247 21:18582943-18582965 AAGGAAGGCCAGGTAGACCTGGG - Intergenic
1177722660 21:24928034-24928056 AAAGGGACCCAGGCACAGCTTGG + Intergenic
1178448681 21:32670953-32670975 AAAGCAGCCCAGGGAGACTTCGG + Intronic
1178696452 21:34796918-34796940 AAGGAAGCCCAGGTGGGGCTGGG + Intronic
1178770666 21:35500921-35500943 AAAGAAGACCAGAGAGAGATGGG - Intronic
1178855360 21:36245927-36245949 CAGGAAGCTCAGGCAGAGGTAGG - Exonic
1179228309 21:39476228-39476250 ATGGAAGCCCAGGAGGAGCTTGG + Intronic
1179553086 21:42155610-42155632 ACAGAAGCCCAGGCAGATAGTGG - Intergenic
1181334097 22:22116267-22116289 AGGGAGGCCGAGGCAGAGCTGGG - Intergenic
1181908155 22:26216168-26216190 ACAGAAAACCAGGGAGAGCTGGG + Intronic
1182237680 22:28889129-28889151 CAAGCAACCCAGGCAGACCTGGG - Intronic
1182916456 22:34037221-34037243 AAAGAAGAGCAGGCAAAGGTAGG + Intergenic
1183253663 22:36746946-36746968 TCAGAAGCCCAGCCAGAGCTTGG - Intergenic
1183328907 22:37208949-37208971 GAGGAGGCCCAGGCAGAGCCAGG + Intronic
1183494477 22:38134831-38134853 AGAGAAGTCCATGAAGAGCTGGG - Intronic
1183673444 22:39286493-39286515 ACAGAAACCCAGACAGGGCTTGG + Intergenic
1184090876 22:42292438-42292460 GAGGAATCCGAGGCAGAGCTGGG + Intronic
1184289392 22:43490326-43490348 AGGGAGGCCCAGGCAGAGCTGGG - Intronic
1184520804 22:44992855-44992877 GAAGAAAACCAGGGAGAGCTGGG - Intronic
1184864081 22:47192850-47192872 GGAGGAGCCCAGGCAGAGGTGGG - Intergenic
949348165 3:3096660-3096682 AAAGATGCCGAGGAAGACCTAGG - Intronic
949433927 3:4007756-4007778 CAAGCAGAACAGGCAGAGCTGGG + Intronic
949813888 3:8038294-8038316 ACAGAATCCCAGCCTGAGCTGGG + Intergenic
949906299 3:8861542-8861564 ATGGGAACCCAGGCAGAGCTTGG + Intronic
949929843 3:9070002-9070024 ACAAAAAGCCAGGCAGAGCTGGG + Intronic
950375446 3:12568174-12568196 AAGGTAGCCCAGGCTGAGCTAGG + Intronic
951093100 3:18598097-18598119 AAAGGAGCCAATGTAGAGCTTGG - Intergenic
951920849 3:27852722-27852744 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
952313376 3:32210566-32210588 AAAGAAGTCCAGGCTGGGCACGG - Intergenic
952624960 3:35392794-35392816 AATGAAGTCCAGGCTGAGATGGG - Intergenic
953144569 3:40262544-40262566 CAAGAGGCCCAGGAAAAGCTGGG + Intergenic
953929620 3:46999433-46999455 GTAGAGGCCCTGGCAGAGCTGGG - Exonic
954457328 3:50607008-50607030 AGAGAAGCCAGGGCAGAGTTGGG + Exonic
954814522 3:53270203-53270225 AAAGCAGGCCCGGCAGGGCTTGG - Intergenic
955125004 3:56102287-56102309 GAGGAAGCCCAGGCAGTGCTAGG + Intronic
955945523 3:64189991-64190013 AATGGAGCCCATGCAGTGCTCGG - Intronic
957530013 3:81428803-81428825 AAAGAGGCCCTGGCTGTGCTTGG - Intergenic
958128365 3:89386391-89386413 AAAGAGGCCAAGGTATAGCTTGG + Intronic
958710207 3:97708805-97708827 AAAGAGGCCAAGGTACAGCTCGG + Intronic
958735709 3:98007271-98007293 AAAGCACCCCAGGCAGAGGGAGG + Intronic
958857152 3:99398907-99398929 AAAGAGGCCAAAGCACAGCTTGG - Intergenic
958893459 3:99805249-99805271 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
958920791 3:100103215-100103237 AAAGAAGCCCACTCAGACCATGG + Intronic
959531078 3:107434107-107434129 AAGGAAGGCCAGGCAGAGGATGG - Intergenic
959733282 3:109628573-109628595 AAGGAAGCCCAGGCAGAAGATGG - Intergenic
959769195 3:110072312-110072334 AAAGAGGGCCAGGTACAGCTTGG + Intergenic
961012690 3:123447084-123447106 ACAGAAGCTCAGGAAGAGATGGG + Intronic
961511435 3:127406226-127406248 CAAGAAGCTCAGGCAGGGCTTGG - Intergenic
962210955 3:133477169-133477191 AACGAGGCCCTGGCAGAGTTGGG - Intergenic
963777340 3:149452386-149452408 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
963878343 3:150501340-150501362 AAAGAGGCCAAGGCACAGCTTGG - Intergenic
964026457 3:152080120-152080142 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
964475087 3:157090791-157090813 ACTGAAGCCAAGGCAGGGCTGGG + Intergenic
964974000 3:162598554-162598576 ACAGAAGCTGAGGCAGGGCTTGG + Intergenic
965065423 3:163841376-163841398 AAAGTGGCCAAGGCATAGCTTGG - Intergenic
965520065 3:169662497-169662519 AAAGAGGCCCAGCGAGCGCTCGG - Intronic
965957615 3:174389723-174389745 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
966340320 3:178918362-178918384 AAAGAAGACCAGGCTGGGCGCGG + Intergenic
966910553 3:184557241-184557263 AGAGGTGCCCCGGCAGAGCTGGG + Intronic
966982598 3:185152509-185152531 AGAGCAGCCCCGGCAGAGCCCGG + Intronic
967260246 3:187634734-187634756 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
967565013 3:190962605-190962627 AAAGGAGCCAATGTAGAGCTTGG + Intergenic
967868998 3:194214041-194214063 AAAGAAGCCAAGACACAGCAAGG + Intergenic
967873887 3:194253201-194253223 AAAGAATTCCAGCCCGAGCTGGG + Intergenic
968014697 3:195319057-195319079 AAAGAGGCCAAGGTACAGCTCGG + Intronic
968403004 4:314986-315008 AAAGGAGCCAAGGGACAGCTTGG - Intergenic
968921984 4:3527116-3527138 AAAGCAGCCCCTGCAGAGATGGG - Intronic
969490857 4:7498562-7498584 CAAGGCGGCCAGGCAGAGCTGGG + Intronic
969500085 4:7547352-7547374 GCAGTGGCCCAGGCAGAGCTGGG - Intronic
970307979 4:14752701-14752723 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
970339164 4:15086340-15086362 AAAGAAGCCAACATAGAGCTTGG - Intergenic
970382134 4:15518772-15518794 AAAGAAGCCAAGGTACAACTCGG - Intronic
970495973 4:16626595-16626617 AATGAAGCTTAGCCAGAGCTGGG - Intronic
971121698 4:23711836-23711858 AAAGAAGCTTAGGCCGAGCGTGG - Intergenic
971545477 4:27880143-27880165 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
971649698 4:29256602-29256624 AAAGGGGCCAAGGTAGAGCTGGG + Intergenic
971683188 4:29728679-29728701 AAAGCATCCCAGGCCGAGCATGG + Intergenic
971760982 4:30765007-30765029 AAAAAAGACCAGGCAGGGCGCGG - Intronic
973119373 4:46501103-46501125 AAAGCAGCCCAGCAAGTGCTTGG + Intergenic
973340266 4:48996118-48996140 AAGCAAGCCCAGGCAGAGGGGGG - Intronic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
974573692 4:63689020-63689042 AAAGGAGCCAAGGTACAGCTGGG + Intergenic
975491273 4:74991406-74991428 AAAGGAACCTAGGCAGAGCCAGG + Intronic
975729246 4:77321367-77321389 AAAGAGGCCAAGGTACAGCTTGG - Intronic
976875627 4:89850448-89850470 AAAGAGGCCAATGTAGAGCTTGG - Intergenic
977041469 4:92024569-92024591 AAAGGGGCCAAGGCACAGCTTGG - Intergenic
978237096 4:106472729-106472751 ACAGAAGCCCTGGCAGAGAAGGG - Intergenic
979372569 4:119907019-119907041 AAAGAAGCTTAGGCCGGGCTAGG - Intergenic
979986721 4:127325042-127325064 AAAGGAGCCCAAGTAGACCTAGG + Intergenic
980469715 4:133234947-133234969 AAAGAAGCCCATGAAGATCTAGG + Intergenic
981842940 4:149133495-149133517 AAAGAAGCCCAGTTACAGCTTGG + Intergenic
982162879 4:152587386-152587408 AAACGATCCCAGGCACAGCTTGG + Intergenic
982208574 4:153016913-153016935 ACAGAAGGCTAGACAGAGCTAGG + Intergenic
982279124 4:153665976-153665998 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
982524990 4:156466919-156466941 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
983388514 4:167098340-167098362 AATGAAGACTAGGCAGAGATTGG - Intronic
983515457 4:168651521-168651543 AAAAAAGCCCAGCCCGACCTTGG + Intronic
984587331 4:181579043-181579065 CAGGAAGCCCAGGCAGGGATGGG - Intergenic
984786123 4:183568863-183568885 TAAGACTTCCAGGCAGAGCTGGG - Intergenic
984807262 4:183763199-183763221 AAAGAAGACTTGGCAGATCTGGG + Intergenic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
985989228 5:3541739-3541761 AAAGATGCCCAGGCCGGGCATGG + Intergenic
986016574 5:3762673-3762695 GAAGAAGCCAACACAGAGCTGGG - Intergenic
986455316 5:7912435-7912457 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
986847987 5:11778286-11778308 AAAGACAGCCAAGCAGAGCTGGG + Intronic
987252258 5:16111895-16111917 AAAGAAGCCAAGGTACAGCTTGG + Intronic
987289539 5:16495546-16495568 AAAGAGGCCAAGGTACAGCTCGG + Intronic
987543481 5:19284214-19284236 AAATGAGCCCAGGGACAGCTTGG - Intergenic
988080651 5:26410712-26410734 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
989265031 5:39463674-39463696 AAAGAAACCCATAGAGAGCTGGG - Intergenic
989305127 5:39946360-39946382 AAAGCAACCCAGCCAGAGCACGG - Intergenic
990140118 5:52693663-52693685 AAATAAGCCTCAGCAGAGCTGGG - Intergenic
990939547 5:61188126-61188148 AAAGAAGTCAAGGTACAGCTCGG + Intergenic
990950404 5:61293037-61293059 AATGAGGCAGAGGCAGAGCTGGG + Intergenic
991622748 5:68562410-68562432 AAGGGGGCCCATGCAGAGCTTGG + Intergenic
992098967 5:73388176-73388198 AAAGAAGCTCACCCTGAGCTTGG + Intergenic
993198556 5:84782291-84782313 AAAGAGCCCCAGGTATAGCTTGG - Intergenic
993409376 5:87554837-87554859 AAAGGGGCCAAGGCACAGCTTGG - Intergenic
993694315 5:91042139-91042161 AGAGAAGTTCAGGCAGGGCTTGG - Intronic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
994689546 5:102999751-102999773 AAAGAGGCCAAGGTATAGCTTGG - Intronic
994813751 5:104557059-104557081 AAAGGAGCCAAGGTAAAGCTTGG - Intergenic
994840911 5:104923955-104923977 GAAGAGGCCCAGGTACAGCTTGG + Intergenic
995687085 5:114782980-114783002 GCAAAAGGCCAGGCAGAGCTGGG + Intergenic
995701352 5:114939127-114939149 AAAGGGGCCAAGGCACAGCTTGG + Intergenic
995897729 5:117034214-117034236 CAATGAGCCCAGGCATAGCTAGG - Intergenic
995925531 5:117369296-117369318 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
996247529 5:121282866-121282888 AAAGAGGTCAAGGTAGAGCTCGG + Intergenic
996701044 5:126450723-126450745 AAAGGGGCCCAGGTACAGCTCGG + Intronic
997194383 5:131968217-131968239 ACAAATGCCCAGGCAGAGATTGG - Intronic
997274640 5:132574354-132574376 AAAGAAGCCAAGGTACAGCTTGG - Intronic
997342154 5:133153168-133153190 GGAGGAGCTCAGGCAGAGCTTGG - Intergenic
997517489 5:134501351-134501373 AGAGAATTCCAGGGAGAGCTTGG + Intergenic
997618223 5:135267326-135267348 GAAGTTTCCCAGGCAGAGCTTGG + Intronic
998469959 5:142375835-142375857 ATAGAAGCCGGTGCAGAGCTTGG - Intergenic
999026671 5:148241024-148241046 AAAGAAGCTTAGAAAGAGCTAGG - Intergenic
999033046 5:148315741-148315763 AAAGAAACTCAGTCAGAGCCTGG - Exonic
999466360 5:151809866-151809888 CAACAAGCCCTGGTAGAGCTGGG - Exonic
999504434 5:152180213-152180235 AAAGCAGCCAAGGTACAGCTCGG - Intergenic
999571604 5:152925675-152925697 AAAGGGGTCCAGGCACAGCTTGG + Intergenic
1000442474 5:161280294-161280316 AAAGAGGCCAATGCAGAGCTTGG - Intergenic
1001254043 5:170170270-170170292 AGAGGAGCCCAGGCAGGTCTTGG - Intergenic
1001254188 5:170171147-170171169 CTCTAAGCCCAGGCAGAGCTGGG + Intergenic
1002292145 5:178207236-178207258 ACAGGAGGCCAAGCAGAGCTGGG - Intronic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1002794045 6:456505-456527 AAAGGGGCCCAGGTATAGCTTGG - Intergenic
1002797527 6:486845-486867 CAGCAAGCCCAGGCAGAGCCGGG - Intronic
1003081647 6:3025990-3026012 AATGCAGCCCAGGCAGAGGACGG + Intergenic
1003199388 6:3945172-3945194 GAAGAAGCCCTGGCAGAGAGGGG - Intergenic
1003404113 6:5814707-5814729 AAAGAAGCCCAGCCATCCCTGGG - Intergenic
1003456527 6:6287798-6287820 AAATAATTCCAGGCAGAACTTGG + Intronic
1005491281 6:26349528-26349550 AAAAAAGACCAGGCCGAGCACGG - Intergenic
1006307126 6:33229774-33229796 AAAGAAGCCCAGGCTGGGTGCGG + Intergenic
1006424681 6:33956609-33956631 CAGGAAGCCCAGGCAGAGCTGGG - Intergenic
1007658292 6:43466258-43466280 AGAGATGCCCAGACAGACCTGGG + Intergenic
1007748023 6:44055111-44055133 AAAGAAGCCCAGGGAAGGGTGGG + Intergenic
1007834913 6:44666907-44666929 AAAGAAGACTGGGCAGAGCCTGG + Intergenic
1007889283 6:45271419-45271441 AAAGAGGCCAAGGTATAGCTCGG + Intronic
1007951575 6:45877215-45877237 AAACAAGAACAGGCTGAGCTCGG - Intergenic
1008104680 6:47428866-47428888 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1009309630 6:62134260-62134282 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1009490529 6:64284809-64284831 AAAGAGGCCAACACAGAGCTTGG - Intronic
1009780322 6:68260606-68260628 AAAGAGGCCAATGTAGAGCTTGG - Intergenic
1009825041 6:68856961-68856983 AAAGAAGCCAAGGTACAGCTTGG + Intronic
1010254963 6:73747109-73747131 AAAGAAGCCAAGGCAGAAATCGG - Intronic
1010790584 6:80060004-80060026 AAAGAAGCCCAAGTAGGTCTTGG + Intergenic
1010810430 6:80293403-80293425 AAAGGGGCCAAGGCACAGCTTGG - Intronic
1011262473 6:85483769-85483791 AGAGAAGCCCAGAAAGAGCTTGG + Intronic
1011738278 6:90334050-90334072 AAAGGGGCCAAGGCACAGCTTGG - Intergenic
1012423990 6:99094462-99094484 ACAGATGCCCAGACAAAGCTGGG + Intergenic
1012653306 6:101784298-101784320 AAAGCAGCCAAGGTACAGCTCGG + Intronic
1013012685 6:106134529-106134551 CAACAAGCCCAGGCAGAACCAGG + Intergenic
1013486372 6:110600307-110600329 AAGGAGGCCCAAGCAGAGGTAGG + Intergenic
1013829563 6:114255747-114255769 AAAGAGGCCAAGGTACAGCTTGG - Intronic
1014254583 6:119148211-119148233 GAAGGAGCCCAGGCAGGGCTTGG + Intronic
1015039837 6:128703611-128703633 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
1016128310 6:140434023-140434045 AAAGAAACCAAGGTACAGCTTGG + Intergenic
1016178324 6:141109127-141109149 AGAGAAGCTGAGGCAGGGCTTGG + Intergenic
1016621024 6:146109339-146109361 AAAGGGGCCAAGGCACAGCTTGG + Intronic
1016761651 6:147744605-147744627 AAAGAAACCCAGGCTGGGCGCGG + Intergenic
1016887357 6:148970609-148970631 AACGAATGCCAGGCAGAGCCAGG + Intronic
1020102766 7:5404075-5404097 TAAGAATCCCAGGCAGGGCCGGG + Intronic
1020455970 7:8374178-8374200 AAAGGGGCCCATGTAGAGCTTGG + Intergenic
1020589684 7:10118844-10118866 AAAGTAGCCAAGGCTGAGCATGG - Intergenic
1023060460 7:36321567-36321589 AAAGGGGCCAAGGCACAGCTTGG + Intergenic
1023786873 7:43716878-43716900 AAAGGGGCCAATGCAGAGCTTGG + Intronic
1024137064 7:46420266-46420288 ACAGAACCACAGGCAGACCTGGG - Intergenic
1024458112 7:49631814-49631836 AAAGCAGCCAAGGCAGAGAGCGG + Intergenic
1024979443 7:55145172-55145194 ACAGAGGCACAGTCAGAGCTGGG - Intronic
1025777601 7:64572769-64572791 AAATAAGGCCAGCCAGATCTGGG - Intergenic
1025801741 7:64793371-64793393 AAATAAGGCCAGCCAGATCTAGG - Intergenic
1025864814 7:65371562-65371584 AAACAAGGCCAGCCAGATCTAGG - Intergenic
1026244154 7:68603495-68603517 AAAGTAGTTAAGGCAGAGCTTGG - Intergenic
1026289908 7:68997086-68997108 AAAGAAACCCAGGCCGGGCGCGG + Intergenic
1027295159 7:76762665-76762687 AAAAAAGTCCAGGCTGAGGTGGG + Intergenic
1028031995 7:85927538-85927560 AAAGGAGACCAGTCAGATCTGGG + Intergenic
1028126087 7:87114960-87114982 AAAGAGGCCAATGTAGAGCTTGG + Intergenic
1029566221 7:101340024-101340046 GAAGAAGCCCTGGCTGAGCACGG + Intergenic
1030038857 7:105432121-105432143 GATGAAGCCCAGGCTGAGTTTGG + Intergenic
1030218097 7:107067152-107067174 AGAGAGGACCAGGCATAGCTTGG + Intronic
1030505921 7:110422192-110422214 AAAGAAGCCGATGAAGAGCCAGG + Intergenic
1031674215 7:124589141-124589163 AAAGGAGCCAATGTAGAGCTTGG + Intergenic
1032632923 7:133673076-133673098 AAATAAGCCCTGGAAGAACTGGG - Intronic
1032992378 7:137408016-137408038 AAAGAAGCTCAGGCAGAATTCGG + Intronic
1033003703 7:137536850-137536872 ATGGAAGCCCAGGCAGAGTGAGG + Intronic
1033566820 7:142586878-142586900 AAAGAATTCCAGGCAGAGGGAGG + Intergenic
1033818385 7:145103146-145103168 CCAGAAACCCAGGCAGAGCCTGG + Intergenic
1034399956 7:150855613-150855635 AAAGAAGGCTAGGCAGGACTGGG + Intronic
1034675234 7:152888093-152888115 AAAGAACCCCAGGCTGCTCTGGG - Intergenic
1037203267 8:16283873-16283895 GAGGAAACCCAGGCAGAACTTGG + Intronic
1037986227 8:23292286-23292308 CTAAAAGCCTAGGCAGAGCTGGG - Intronic
1038885904 8:31662971-31662993 ATACAAGCCCAGGCAGGGCTTGG - Intronic
1039158998 8:34595880-34595902 AAAGAGTCCCAGGTATAGCTTGG - Intergenic
1039419406 8:37423437-37423459 GAAGAAGACCTGGAAGAGCTGGG - Intergenic
1039975471 8:42360245-42360267 AAAGAAGGCCAGGCCGGGCAAGG - Intronic
1040572682 8:48624430-48624452 ACAGGGGCCCAGGCAGAGCTTGG - Intergenic
1040863446 8:52024119-52024141 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1041230577 8:55747066-55747088 AAAGAAGCGCAGTCAGGGCCGGG + Intronic
1041682209 8:60605141-60605163 AAAGGGGCCCAGGAAGAGCTCGG + Intronic
1041682411 8:60606748-60606770 AAAAAGGCCCAGGTATAGCTTGG - Intronic
1042113818 8:65410171-65410193 AAAGAGACAGAGGCAGAGCTGGG - Intergenic
1042161830 8:65904654-65904676 AAAGGGGCCAAGGTAGAGCTTGG + Intergenic
1042435585 8:68760938-68760960 AAAGATTCCAAGGTAGAGCTAGG - Intronic
1042635441 8:70868499-70868521 AAAGAGGCCAATGTAGAGCTCGG - Intergenic
1043127599 8:76419193-76419215 ACAGAGTCCCAGGCAGAGATAGG - Intergenic
1044282633 8:90374742-90374764 AAAGCGGCCAAGGCACAGCTCGG - Intergenic
1044558479 8:93589936-93589958 AATGAAGCCCAGGCTGGGCATGG + Intergenic
1044627189 8:94245563-94245585 GAAGAAGGCCATGCAGAGATTGG - Intergenic
1046814755 8:118571628-118571650 AAAGGAGCCAACACAGAGCTTGG + Intronic
1047940437 8:129823521-129823543 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1048857377 8:138696290-138696312 AGATAAGCCCAAGGAGAGCTGGG + Intronic
1049013375 8:139903068-139903090 CAGGGAGCCCAGGCACAGCTTGG - Intronic
1049316434 8:141971314-141971336 CATGAAGCCCAGGGAGTGCTTGG - Intergenic
1049549520 8:143250576-143250598 AAAGCAGCCCAGTCAGATGTGGG + Exonic
1049687906 8:143946330-143946352 AAGGTAGGGCAGGCAGAGCTGGG - Intronic
1050189955 9:3014414-3014436 AAAGAAACACAGGCAGAGACTGG + Intergenic
1051499526 9:17762076-17762098 TAAGAGGACCAGGCAGAGTTGGG + Intronic
1052595921 9:30558381-30558403 AAAGGGGCCAACGCAGAGCTTGG - Intergenic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878205 9:33583327-33583349 AAAGACGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1053023877 9:34714929-34714951 TAGGAAGACCAGGCAGAGATGGG - Intergenic
1053027025 9:34738634-34738656 AAAGAAGTCTAGGCAGGGCGTGG - Intergenic
1053351234 9:37414624-37414646 ACAAAAGCCCAGGCAGGGCCGGG + Intergenic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053497779 9:38560880-38560902 AAAGACGCACAGGTACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053515103 9:38723672-38723694 TTACAAGCCCAGGCAGAGCCAGG - Intergenic
1053540552 9:38969319-38969341 AAAGAAACACAGGCATACCTAGG + Intergenic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053804898 9:41791475-41791497 AAAGAAACACAGGCATACCTAGG + Intergenic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1054140386 9:61523982-61524004 AAAGAAACACAGGCATACCTAGG - Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054625590 9:67394604-67394626 AAAGAAACACAGGCATACCTAGG - Intergenic
1054860397 9:69946957-69946979 ACACAAGCACAGGAAGAGCTGGG - Intergenic
1055018966 9:71648833-71648855 AAAAAATCCCAGGCAGGGCCAGG + Intergenic
1055914479 9:81386801-81386823 AGAGAAGACTAGGCAGAGCATGG - Intergenic
1056135385 9:83625008-83625030 AAAGAAGCCAAGCCTTAGCTGGG - Intronic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057224093 9:93278165-93278187 GGAAGAGCCCAGGCAGAGCTTGG + Intronic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057784071 9:98073571-98073593 AAAGAAGCCCAGGCCAGGCGCGG - Intronic
1058275071 9:103030247-103030269 AAATAAACCCAGGCACGGCTGGG + Intergenic
1058401530 9:104625178-104625200 AAAGGGGCCAATGCAGAGCTCGG + Intergenic
1060859582 9:126943713-126943735 AAAGCAGTCCAGGCAGCGGTAGG - Intronic
1061073284 9:128325246-128325268 CCAGACCCCCAGGCAGAGCTGGG - Intronic
1061441941 9:130611103-130611125 CACGAAGCCCAGGCAGCCCTTGG - Intronic
1061531725 9:131219289-131219311 AAACAAGGCCAATCAGAGCTCGG - Intronic
1061976154 9:134068734-134068756 GAAGGTCCCCAGGCAGAGCTGGG - Intergenic
1062036697 9:134385654-134385676 GAAGAAGCCCAGGCATTGTTCGG - Intronic
1062043006 9:134412670-134412692 AAACAGGCCCAGGCTCAGCTTGG - Intronic
1062360704 9:136186607-136186629 AAAGAGGCTGAGCCAGAGCTGGG - Intergenic
1062737626 9:138146883-138146905 AAAGAAGGTCAGGCAGTGCATGG + Intergenic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1203635451 Un_KI270750v1:106291-106313 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG + Intronic
1187953519 X:24493589-24493611 AAAGAGGCCTAGGCAGGGCGAGG + Intronic
1188480300 X:30630386-30630408 ATAGAAGCCCAGAGAGAGGTAGG - Intergenic
1188498967 X:30805533-30805555 AAACAAGGCAAGGCAGAGCCAGG - Intergenic
1189250583 X:39598261-39598283 ATGGAAGCCCAGGGAGAGGTGGG + Intergenic
1189261202 X:39679946-39679968 AGAGGAGCCCAGGGAGAGCTGGG + Intergenic
1189371270 X:40431457-40431479 AAAGGAGCCAATGTAGAGCTTGG + Intergenic
1189417578 X:40828788-40828810 AAAGAACCCCAGGAAGAGAAAGG - Intergenic
1189431416 X:40950627-40950649 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1189869659 X:45368969-45368991 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1189886066 X:45546024-45546046 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1190054493 X:47173833-47173855 AGAGAAGCCCAGGCAGAGTGAGG - Intronic
1190558558 X:51663984-51664006 AGGGTAACCCAGGCAGAGCTTGG - Intergenic
1190733817 X:53242104-53242126 AAATATGACCATGCAGAGCTGGG - Intronic
1191586725 X:62834869-62834891 AAAGAATCATAGGCAGAGGTTGG - Intergenic
1192174220 X:68875749-68875771 AACGAACCCCAGCCAGAGCCAGG - Intergenic
1192219485 X:69187725-69187747 AAAGAAGGCATGGCAGAACTAGG + Intergenic
1192617849 X:72646564-72646586 ACAGAAAACAAGGCAGAGCTAGG + Intronic
1193049093 X:77082383-77082405 AAGGAAGGGCAGGCAGAGCCAGG + Intergenic
1193320386 X:80114800-80114822 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1193585660 X:83318531-83318553 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
1194048055 X:89033818-89033840 AAAGTACTCCAGGCAGAGCTTGG - Intergenic
1194554240 X:95337700-95337722 AAAGAGGCCAAGGAACAGCTTGG - Intergenic
1194850136 X:98859302-98859324 AATGAAGTCCAGGCTGAGGTGGG + Intergenic
1194895267 X:99432459-99432481 AAAGGGGCCCAGGTACAGCTCGG + Intergenic
1195551824 X:106180233-106180255 AGAGATGCCCAGGGAAAGCTGGG - Intronic
1196017153 X:110952127-110952149 AAGCAAGCCCAGGCAGAGTAAGG - Intronic
1196099095 X:111829622-111829644 AAAGGTGCCCAGGTACAGCTTGG + Intronic
1196133996 X:112187434-112187456 TAAGAACCCCAGGCATAGCTGGG + Intergenic
1196886402 X:120250659-120250681 AAAGAACCGAAGGCAGAGCACGG + Intergenic
1197094309 X:122574939-122574961 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1197385483 X:125796218-125796240 AAAGGGGCCCAGGTAGAGCTGGG + Intergenic
1198399061 X:136251819-136251841 GAAGAAGCCTAGGGAGAGGTTGG + Intronic
1198518652 X:137431088-137431110 AAATAAGCCCAGGAAGATCCAGG - Intergenic
1199155046 X:144536961-144536983 AAAAAAGCCAAGGAACAGCTCGG - Intergenic
1199858702 X:151780705-151780727 AAAGAGGCCCAGGCAGAGGCTGG - Intergenic
1199869770 X:151888022-151888044 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1199928409 X:152493975-152493997 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1199997364 X:153033901-153033923 ACTGAAGGCCAGGCAGAGCACGG + Intergenic
1200086910 X:153611479-153611501 CAAAAAGCCCAGGCAAAGATGGG - Intergenic
1200141634 X:153905527-153905549 AGGGATGCCCAGGCACAGCTGGG - Exonic
1200753018 Y:6964384-6964406 AAAGAAGGGCAGGCAGATCCTGG + Intronic
1201264502 Y:12193104-12193126 AGAGAAGCTGAGGCAGGGCTTGG - Intergenic
1201570134 Y:15404711-15404733 AGAGAAGCCAAGGCTGGGCTTGG + Intergenic