ID: 905225948

View in Genome Browser
Species Human (GRCh38)
Location 1:36479324-36479346
Sequence TGGGATTCTCTGGGAATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905225943_905225948 6 Left 905225943 1:36479295-36479317 CCACATCTGTGGCTCAGACTTGA 0: 1
1: 0
2: 3
3: 16
4: 218
Right 905225948 1:36479324-36479346 TGGGATTCTCTGGGAATCCCAGG 0: 1
1: 0
2: 2
3: 13
4: 223
905225940_905225948 15 Left 905225940 1:36479286-36479308 CCAGCTACCCCACATCTGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 224
Right 905225948 1:36479324-36479346 TGGGATTCTCTGGGAATCCCAGG 0: 1
1: 0
2: 2
3: 13
4: 223
905225941_905225948 8 Left 905225941 1:36479293-36479315 CCCCACATCTGTGGCTCAGACTT 0: 1
1: 0
2: 3
3: 18
4: 223
Right 905225948 1:36479324-36479346 TGGGATTCTCTGGGAATCCCAGG 0: 1
1: 0
2: 2
3: 13
4: 223
905225942_905225948 7 Left 905225942 1:36479294-36479316 CCCACATCTGTGGCTCAGACTTG 0: 1
1: 0
2: 2
3: 17
4: 247
Right 905225948 1:36479324-36479346 TGGGATTCTCTGGGAATCCCAGG 0: 1
1: 0
2: 2
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905225948 Original CRISPR TGGGATTCTCTGGGAATCCC AGG Intronic
900719247 1:4164659-4164681 TGGCATTCTCTAGGAACCTCAGG + Intergenic
901005595 1:6170304-6170326 TAGGACTCTCTGGGGGTCCCAGG - Intronic
901467373 1:9431032-9431054 TGGGATTCTTTGGGAAGCCGAGG + Intergenic
903318833 1:22529448-22529470 TGTGATTCTGTGGGAATACTGGG + Exonic
903442784 1:23401058-23401080 TGGGATTCTCTGGTAACTCCAGG - Intronic
905225948 1:36479324-36479346 TGGGATTCTCTGGGAATCCCAGG + Intronic
906551174 1:46667852-46667874 TGGGAGTCTCTGCAAAGCCCTGG - Intronic
906560128 1:46750358-46750380 TGGAAGTCTCTGGGGAACCCAGG - Intergenic
909146391 1:71938845-71938867 TGAGATTCTCTGAGAGTCTCTGG + Intronic
912079012 1:105912328-105912350 TGGGGTTCTCATCGAATCCCTGG - Intergenic
912740961 1:112197071-112197093 TGAGATTCTCTGGGAAAAGCAGG + Intergenic
916424106 1:164664394-164664416 TGGGAAGCTGTGGGAAGCCCCGG + Intronic
919037649 1:192335825-192335847 TGGGACTTTCAGGGAATACCAGG + Intronic
921314688 1:213879309-213879331 AGGGAATCTCTGAGAATCTCTGG - Intergenic
922408220 1:225341235-225341257 TGGCATGCGCTGGTAATCCCAGG - Intronic
922462329 1:225823418-225823440 GGGGAGTCTCCGGGAAACCCAGG + Intronic
924451292 1:244181432-244181454 TGGAAGTCTCTAGGAATGCCAGG + Intergenic
1065123465 10:22550404-22550426 TGTCATCCGCTGGGAATCCCCGG - Intronic
1065444468 10:25783668-25783690 TGGTGTTCACTGGGAATGCCTGG + Intergenic
1066255771 10:33677182-33677204 TGGGATTTTCTGAGAGTTCCAGG - Intergenic
1066488470 10:35871882-35871904 TGGGTCCCTCTGGGGATCCCAGG - Intergenic
1067049200 10:43002212-43002234 TGGGTTTCTAGGGGAATCCAGGG + Intergenic
1067237416 10:44462723-44462745 TGGCATTCCCTGGCATTCCCTGG - Intergenic
1068591090 10:58853839-58853861 TGTGACTCTGTTGGAATCCCTGG + Intergenic
1068757948 10:60675493-60675515 TGTGTTTCTCTGAGAATTCCTGG + Intronic
1069305097 10:66959276-66959298 TAGCATTCTCAGGGAATGCCTGG + Intronic
1069800775 10:71080269-71080291 TGGGATCCTCTGGGAGGCTCAGG + Intergenic
1070158208 10:73849431-73849453 AGTGATTCTCTGTGAATCCGTGG - Intronic
1070388476 10:75948251-75948273 TGGGATTCTCTGATAATCTATGG - Intronic
1071201018 10:83220731-83220753 TGGGATTCTTATAGAATCCCTGG + Intergenic
1071319182 10:84435995-84436017 TAGGATGCTTTGGGAATCTCAGG + Intronic
1074389559 10:113045487-113045509 TGGGGTTCCCTGGGGGTCCCAGG - Intronic
1075826628 10:125362372-125362394 AGGGATCCTCTGGGTCTCCCTGG + Intergenic
1076254593 10:129012142-129012164 TGTGGGTCTGTGGGAATCCCTGG - Intergenic
1076340894 10:129744215-129744237 TGGGGTTCTCTGGGCTTGCCAGG - Intronic
1078292569 11:10027657-10027679 TGGGAATCTTTGGGCAGCCCTGG + Intronic
1079099430 11:17531598-17531620 TGGCTTCCTCTTGGAATCCCTGG - Intronic
1083620599 11:64047512-64047534 TGTGATCCTCTGTGAATGCCAGG - Intronic
1085196131 11:74672921-74672943 TGGGTTTCTCTGGGCAGCACAGG - Intergenic
1091586646 12:1820729-1820751 TGGATTTCTATAGGAATCCCAGG + Exonic
1092901949 12:13068097-13068119 TGGAATTTTCTGGGGATCCTTGG + Intronic
1093369845 12:18353827-18353849 TGGGATTCTCATCAAATCCCTGG + Intronic
1098002641 12:65961386-65961408 TGAGATTCTCTGTGGAGCCCTGG - Intronic
1101074669 12:101116517-101116539 TGGGATACGCTGGAAAGCCCTGG - Intronic
1102254312 12:111406917-111406939 GGGGATTCCCAGGGAACCCCAGG - Intronic
1103317207 12:120065645-120065667 TGGCATTCTCTGTGCATGCCAGG + Intronic
1103584571 12:121942471-121942493 TGGGACTCTCTGGGAAGCCAGGG + Intronic
1104389914 12:128383496-128383518 TGGGAATCCCTGGGTGTCCCGGG + Intronic
1105678650 13:22703206-22703228 TGGGATTTTGTTGGTATCCCGGG - Intergenic
1106974997 13:35200417-35200439 TGGGAATCTCTGGAAATCCTAGG - Intronic
1108934388 13:55867481-55867503 TGGGATTCTCATCTAATCCCTGG + Intergenic
1111423967 13:88054922-88054944 TGGGATTCTCTGATAACACCTGG + Intergenic
1113489050 13:110677505-110677527 TGTGATTGTCTGGGTCTCCCTGG - Intronic
1113489083 13:110677652-110677674 TGTGATTGTCTGGGTCTCCCTGG - Intronic
1116600480 14:46915926-46915948 TGGGTATCTCTGGGCATCTCTGG + Intronic
1117739354 14:58800234-58800256 TGGGTTACTCTGGGAAATCCAGG + Intergenic
1119746885 14:77051183-77051205 TGGGCTTCTCTGGGTCTCTCAGG - Intergenic
1120849438 14:89155935-89155957 TGGAATTCTCTTGAGATCCCGGG + Intronic
1121619416 14:95336031-95336053 TGGGTTGCTCTGGGAGTCACTGG + Intergenic
1121926025 14:97928106-97928128 TGGGATTATCTGGGATTAGCAGG - Intronic
1122300317 14:100727544-100727566 TGGGCTTCTCTGGGAATTGGGGG - Intronic
1123141487 14:106083365-106083387 TGGAAACCCCTGGGAATCCCAGG + Intergenic
1123166664 14:106331598-106331620 TGGAAACCCCTGGGAATCCCAGG + Intergenic
1123169350 14:106356637-106356659 TGGAAACCCCTGGGAATCCCAGG + Intergenic
1123194319 14:106601827-106601849 TGGAAACCCCTGGGAATCCCAGG + Intergenic
1123968369 15:25481095-25481117 TGGGCTTCTCTGGGACTACCTGG - Intergenic
1125556447 15:40589586-40589608 TGAGGTTCTCTGGGAATCAATGG - Intergenic
1129407497 15:75328946-75328968 TCGGATTCTCAGGGGATCCTGGG + Intergenic
1130047722 15:80459101-80459123 TTGGAGACTCTGGGAATCCCTGG - Intronic
1130302442 15:82690057-82690079 TGGCAGTCTCTGGCATTCCCTGG - Intronic
1130371327 15:83287148-83287170 TGGGCTTCTCTGCCATTCCCTGG + Intergenic
1131419684 15:92294980-92295002 GGGGTTTCTGTGGGAAACCCAGG + Intergenic
1131828959 15:96342131-96342153 TGGGATACTCTCTGAATTCCAGG + Intergenic
1132234372 15:100208037-100208059 TGGAGTTCTTTGGGATTCCCTGG - Intronic
1135207359 16:20494518-20494540 TGGGATTCTCATCTAATCCCTGG - Intergenic
1135211526 16:20529114-20529136 TGGGATTCTCATCTAATCCCTGG + Intergenic
1136870898 16:33807371-33807393 TGGAAACCCCTGGGAATCCCAGG - Intergenic
1137598246 16:49738873-49738895 TTGGGTTCTCTGGTAACCCCTGG - Intronic
1139047741 16:63083523-63083545 TAGGGTTCTCTGGTAACCCCTGG - Intergenic
1141052906 16:80788535-80788557 TGGGATTCTGTGGAAAGCACAGG + Intronic
1141500769 16:84442820-84442842 TAGGATTCTTTTGGAATCGCTGG - Intronic
1141560928 16:84867339-84867361 TGGGTTCCTCTGGGAAGCGCTGG + Intronic
1141846032 16:86609798-86609820 TGGGCTTCAGTGGGATTCCCGGG + Intergenic
1142066479 16:88065838-88065860 TGGGATCCTGTGGGCCTCCCGGG - Intronic
1142311180 16:89314863-89314885 TGGGATCCTCTGTGAAGCGCAGG + Intronic
1142311674 16:89317708-89317730 TCGGATTTCCTGGGAAACCCAGG - Intronic
1203101274 16_KI270728v1_random:1308687-1308709 TGGAAACCCCTGGGAATCCCAGG + Intergenic
1142644463 17:1302943-1302965 TGGGAGGCTCTGGGCACCCCAGG + Intergenic
1143276081 17:5711931-5711953 TGGAATTTAGTGGGAATCCCAGG + Intergenic
1143447916 17:7019711-7019733 TGGGATTTTTTGGGGACCCCGGG - Intergenic
1143523251 17:7457851-7457873 TAGGATTGTCTGGGGATCACAGG + Intergenic
1145767509 17:27469087-27469109 TGCTATTCTCTGGGAGCCCCGGG + Intronic
1149724142 17:58875679-58875701 TGTGATTGTCTGTGAATCACAGG - Intronic
1152607524 17:81300254-81300276 TGAGATGCTCAGGGTATCCCAGG + Intergenic
1152626307 17:81389382-81389404 CAGGGTTCTCTGGGAATCTCTGG - Intergenic
1152802778 17:82339662-82339684 CCTGATTCTCTGGGAATTCCAGG - Intergenic
1153428274 18:4989381-4989403 TGGGATTCTCTTCTAATCCATGG + Intergenic
1155571820 18:27202932-27202954 TGGGATTCACTGGTAAGCCATGG + Intergenic
1155626744 18:27843712-27843734 TGGGATTCTGTGGTTATCTCTGG - Intergenic
1155787039 18:29914352-29914374 TGGGATTCTCATCCAATCCCTGG - Intergenic
1157245639 18:46051980-46052002 TGGCATTCCCTGAGAACCCCTGG + Intronic
1157593279 18:48848738-48848760 TGGGAGTCTCCTGGAGTCCCTGG - Intronic
1157708305 18:49827982-49828004 TGGGTATCTGTGGGAATTCCTGG - Intronic
1158931985 18:62331630-62331652 TGTGACTCTCTGGGGATCACTGG - Intronic
1160131634 18:76230597-76230619 AGGGATGCTCAGGGAAGCCCGGG - Intergenic
1161237611 19:3205593-3205615 TGGGACCCTCTGCAAATCCCAGG - Intronic
1161949945 19:7462378-7462400 TGGGCTCCTCAGGGAACCCCAGG + Intronic
1162137432 19:8564413-8564435 TGGGATGCACTGAGAGTCCCTGG + Intronic
1162398211 19:10430257-10430279 TGGGATTCTCAGGGCACTCCTGG + Intronic
1162496226 19:11024766-11024788 GGGGCTGCTCTGAGAATCCCAGG + Intronic
1163102862 19:15108292-15108314 TGGGAATCTTTGGGAAGGCCTGG - Intronic
1163628473 19:18404140-18404162 TGAGGTTTTCTGGGCATCCCTGG - Intergenic
1164504027 19:28843330-28843352 TGGGATTCTCTCAGCTTCCCAGG - Intergenic
1165426812 19:35750408-35750430 TGGGCTTCTCAGGAAGTCCCTGG + Intronic
1165713310 19:38027378-38027400 TGGGCTTCTCCAGGAACCCCAGG + Intronic
1166809951 19:45508763-45508785 TGGAATTATCTGGGAAGCCTGGG - Intronic
1167618178 19:50547593-50547615 TGGGAATCACTGGCAATGCCTGG + Intronic
1168177070 19:54633742-54633764 TGGGATTCTCTGGGAGACCCAGG - Intronic
1168232847 19:55044399-55044421 TGGGAGTCCCAGGCAATCCCAGG + Exonic
1168311569 19:55463499-55463521 GGGGATCCCCTGAGAATCCCAGG + Intergenic
925071624 2:973486-973508 TGGGATTCTCTGGGCTTCTTGGG + Intronic
925194379 2:1911614-1911636 TGGAATTCTATGGAAACCCCAGG - Intronic
925357743 2:3253992-3254014 TGGCATTCTCGGGCACTCCCAGG + Intronic
925592054 2:5519694-5519716 TGGCAATCTCTGGCATTCCCCGG + Intergenic
925682494 2:6437405-6437427 TGGGATTCTGTGGGACTGCATGG + Intergenic
927074864 2:19567458-19567480 TGGGATTCAGTGGGGAGCCCTGG - Intergenic
928914876 2:36459917-36459939 TGGGATTGTCTGTGAAGTCCAGG + Intronic
929929064 2:46238126-46238148 TCGGAGTCTCTGGGAGACCCTGG + Intergenic
930798637 2:55419776-55419798 AGCGCGTCTCTGGGAATCCCTGG + Intronic
932129726 2:69177168-69177190 TTGCATTCTCTGGGGAACCCGGG + Intronic
932189601 2:69729630-69729652 TGCTATTCTCGGGAAATCCCAGG + Intronic
932215250 2:69962110-69962132 TGGGATCCTATGGGATTTCCTGG + Exonic
935301353 2:101696933-101696955 TGGGATTCGCTGAGCATCGCTGG - Intronic
937197747 2:120174801-120174823 TGGGTTACTCAGGGAACCCCTGG - Intronic
937342724 2:121101502-121101524 GTGGACTCTCTGGGCATCCCAGG + Intergenic
937656264 2:124380462-124380484 TGTAATTCTCTGGAAATCACAGG + Intronic
938317309 2:130339146-130339168 TGAGTTTCTCTTGGAGTCCCCGG + Exonic
939848154 2:147272650-147272672 TAGGATTATTTAGGAATCCCAGG + Intergenic
942078510 2:172379271-172379293 TGGCATTGTCTTTGAATCCCTGG + Intergenic
943383322 2:187175622-187175644 TGGGATTCTCATCAAATCCCTGG + Intergenic
945421541 2:209643352-209643374 TGTGATTATGTGGGAATCCCAGG + Intronic
946078104 2:217092546-217092568 TGGGATATTCTCAGAATCCCAGG + Intergenic
947591982 2:231391039-231391061 TGAGAATCACTGGGAATCTCTGG + Intergenic
948252966 2:236545123-236545145 TTGGATTCTGTGGGACACCCCGG + Intergenic
949020400 2:241738087-241738109 TGGGAGTCACTGGAAATCGCTGG + Intronic
1168989101 20:2079150-2079172 TGGGACTTTCTTGAAATCCCAGG + Intergenic
1174040883 20:47698417-47698439 TGAGACTCTCTGGGACTCCTGGG + Intronic
1175536031 20:59713422-59713444 TGGTTCTCTCTGGGAATACCTGG - Intronic
1176996394 21:15560282-15560304 AGGGATTCTCTGGGATTTTCTGG - Intergenic
1177341637 21:19810768-19810790 TGTGTTTCTCTGGTTATCCCAGG - Intergenic
1178418683 21:32425743-32425765 TGGGAATATCTGGCAATCTCTGG + Intronic
1178873800 21:36397042-36397064 AGGTATTGTCAGGGAATCCCTGG - Intronic
1179055477 21:37928090-37928112 TGGGATTCACTGGGAGCCACTGG - Intergenic
1180065882 21:45412054-45412076 CGTGCTTCTCTGGGAATGCCGGG + Intronic
1182280105 22:29213605-29213627 TGGGAGTCTCTGTGAAGGCCGGG + Intronic
1182915386 22:34024569-34024591 TTGGAGTCTCTGGGGAGCCCAGG + Intergenic
1183377174 22:37472143-37472165 TGGGGTTCTTTGGGAGTCCCTGG - Intronic
1183464430 22:37972625-37972647 TGTCACTCTCTGGGAAGCCCAGG + Exonic
1183617412 22:38954108-38954130 TGGGTGTGTCTGGGAAACCCCGG - Intronic
1184425010 22:44404138-44404160 TGGGATCCTCAGGCAATGCCAGG - Intergenic
1185117503 22:48945999-48946021 TGGGAGTCTCTGGGCACCCTTGG + Intergenic
949323629 3:2839848-2839870 TGGTCTTCAATGGGAATCCCTGG + Intronic
954084099 3:48230464-48230486 AGGTATTGTCTGGGAACCCCTGG + Intergenic
954329744 3:49883442-49883464 TGGGAGTCTCTGGTACTCACTGG + Intergenic
955146701 3:56326903-56326925 TGGATTTCTCTGGGGATCCCTGG + Intronic
957008630 3:74980196-74980218 TTGGTTTCTCTTAGAATCCCAGG + Intergenic
957728809 3:84105575-84105597 GTGGCTGCTCTGGGAATCCCTGG + Intergenic
961665803 3:128492626-128492648 TGCGAGGCTCTGGGAATGCCAGG + Intronic
962365378 3:134775589-134775611 TTGGACTCTCTGGGGCTCCCTGG - Intronic
964374183 3:156033463-156033485 TGCGATTTCCTGGGAAACCCAGG - Intergenic
965300410 3:166999844-166999866 TGGGATTCTCATCTAATCCCTGG + Intergenic
968960294 4:3739923-3739945 AGGGAGTCTTTGGGATTCCCTGG + Intergenic
969350730 4:6596621-6596643 AGGGATTCTCTGGGCGTCCAGGG - Intronic
969837798 4:9857666-9857688 TGTGATTCTCTGGGGAACTCTGG - Intronic
973240304 4:47949353-47949375 TGTGATTCTCTGGGGATCCCTGG - Intronic
974360129 4:60866681-60866703 TGTTATTCTCTGGGAGTCCGGGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974467748 4:62278769-62278791 GAGGGTTCTCTTGGAATCCCAGG - Intergenic
981719325 4:147785507-147785529 TGGGATGCTCAGGGAATTCATGG - Intronic
982034414 4:151331589-151331611 TGGGATTCTCCAGGAATCAGTGG + Intergenic
982798436 4:159673003-159673025 TGGGATTCTCATCAAATCCCTGG - Intergenic
983337049 4:166409615-166409637 TGGTATTTTCTGGGAACACCTGG - Intergenic
983937270 4:173510646-173510668 GTGGATTCACAGGGAATCCCAGG - Intergenic
985520136 5:370389-370411 TGGGATGCTCTGAGAAGCCTGGG - Intronic
985539125 5:479667-479689 TCTGATGCCCTGGGAATCCCAGG - Intronic
985842818 5:2321618-2321640 GGAGATTCTCTGGGCATGCCTGG - Intergenic
987508783 5:18808256-18808278 TGGGTTTCTCTCTGAATCCCAGG - Intergenic
989821050 5:45796271-45796293 TGGGATTCTCACCCAATCCCTGG - Intergenic
994843328 5:104952896-104952918 TTGGTTTCTCTGGGTATCTCAGG + Intergenic
999262304 5:150245502-150245524 AGGGATTCAGAGGGAATCCCCGG - Intronic
1001953779 5:175834080-175834102 TGAGATGCACAGGGAATCCCTGG + Intronic
1003042744 6:2703043-2703065 GGGGATTTTCTGAGACTCCCAGG + Intronic
1004406653 6:15339221-15339243 TGGGATTTTCTCCAAATCCCTGG - Intronic
1005051508 6:21688047-21688069 TGGCATTCTCTGGCATTCCTTGG - Intergenic
1005982363 6:30846124-30846146 TAGGCTGCTCTGGAAATCCCAGG - Intergenic
1007072415 6:39047468-39047490 TGGGATTTTCTGTCACTCCCAGG + Intergenic
1008128743 6:47696822-47696844 TGGAATTATTTGGGAATTCCTGG + Intronic
1009411325 6:63368437-63368459 TGGGATTCCCAGAGAATGCCAGG + Intergenic
1013264798 6:108485367-108485389 TGAGACCCTCTGGGAATCCTTGG - Intronic
1017598654 6:156058116-156058138 GGGGAAACTCTGGGAATCCGTGG - Intergenic
1024161008 7:46676031-46676053 TGAGAATGTCTGGGAATTCCAGG + Intronic
1024169429 7:46768750-46768772 AGGGATACTCTGGGAATTCTTGG + Intergenic
1024659449 7:51478794-51478816 TGTGATTCTATGGGGAACCCAGG + Intergenic
1027677609 7:81179603-81179625 TGAGTTTCTCAGGGAATTCCAGG - Intronic
1029929358 7:104354381-104354403 TGGGATTGTTTGGGAATTGCTGG + Intronic
1030983140 7:116210321-116210343 AGGGATTCTCTGGGCGTCCACGG - Intergenic
1032501967 7:132406468-132406490 TTGGATGCTATGGGAAACCCAGG + Intronic
1032917767 7:136511131-136511153 TGGGATTCTCATCGAATCCCTGG + Intergenic
1033665471 7:143436884-143436906 TGGGATTTTCTATGAATCCAGGG + Intergenic
1035686406 8:1526790-1526812 GGGGAGTCTCTGGGAAGCTCTGG - Intronic
1036217029 8:6889323-6889345 AGGGAGTTTCTGGGAGTCCCTGG + Intergenic
1036827315 8:11987380-11987402 TGGGAGTCCCTGGAAGTCCCTGG - Intergenic
1037745100 8:21637002-21637024 TGGCATTCTCTGCTGATCCCAGG + Intergenic
1039048535 8:33472607-33472629 AGTGATTCTCTGGGAAGACCTGG + Intronic
1039071092 8:33649986-33650008 TGGTGTTCTCTGGTATTCCCTGG - Intergenic
1039922654 8:41904158-41904180 GGGGGCTCTCTGGGAAGCCCAGG - Intergenic
1040418550 8:47218404-47218426 TGGAATTTCCTGGGAATTCCAGG - Intergenic
1040717212 8:50271730-50271752 TAAGATTCTCTGGGAATCTCTGG + Intronic
1041896234 8:62927338-62927360 TGCGATTTTCTGGAAATCCAGGG - Intronic
1041933946 8:63316346-63316368 TGGGACCCTCTGGGAACCTCTGG - Intergenic
1044952286 8:97446204-97446226 TCTGCTTCTCTGGGAATCTCGGG - Intergenic
1044957668 8:97498305-97498327 TGGGCTTCCCTGTGAAGCCCAGG - Intergenic
1044957669 8:97498307-97498329 TGGGCTTCACAGGGAAGCCCAGG + Intergenic
1045385158 8:101665402-101665424 TTGGATTATCTGGGAAGCTCAGG + Intronic
1048437880 8:134434515-134434537 TGGGCCTCACTGGGAATGCCTGG - Intergenic
1051858114 9:21592939-21592961 TGAGATTCTGTGGAAATCCAGGG + Intergenic
1057672640 9:97107640-97107662 TTGAATTCTCTGGGAAGCCCAGG + Intergenic
1058828523 9:108795631-108795653 TGGGATTCTCATAAAATCCCTGG - Intergenic
1059502877 9:114770501-114770523 TGGCATTCTCAGGAAATCCGAGG + Intergenic
1061302066 9:129711107-129711129 TGGGATTCTGGGGGTCTCCCTGG - Intronic
1061857826 9:133452542-133452564 TGGGATTTTATGGGAATTGCAGG + Intronic
1062099534 9:134721008-134721030 ATGGAGTCTCTGGGGATCCCAGG + Intronic
1062526561 9:136980241-136980263 TGGTATCCTCTGTGAAGCCCTGG - Exonic
1186430580 X:9501029-9501051 TGCGAGTCTGTGGGAAGCCCTGG + Intronic
1189438308 X:41012276-41012298 TGGGAGTCTCAGGGGGTCCCAGG - Intergenic
1194939792 X:99995800-99995822 GGGGATTTTCAGGGAATCCAGGG + Intergenic
1195244657 X:102984532-102984554 GGGGATTCTCAGGGAACCCAGGG - Intergenic
1196768086 X:119267940-119267962 TGGGAATCACTGGGAATCAGGGG - Intergenic
1197897793 X:131334067-131334089 TGGGTTTCTCTGGGATGGCCAGG - Intronic