ID: 905230528

View in Genome Browser
Species Human (GRCh38)
Location 1:36512385-36512407
Sequence AGGGTGCGGCCTCATTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905230520_905230528 3 Left 905230520 1:36512359-36512381 CCTTCCAGCTTACTGTTCTCATC No data
Right 905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG No data
905230521_905230528 -1 Left 905230521 1:36512363-36512385 CCAGCTTACTGTTCTCATCCCCA No data
Right 905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG No data
905230519_905230528 17 Left 905230519 1:36512345-36512367 CCGGGGCACAGGCTCCTTCCAGC No data
Right 905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905230528 Original CRISPR AGGGTGCGGCCTCATTCCTG TGG Intergenic
No off target data available for this crispr