ID: 905231469

View in Genome Browser
Species Human (GRCh38)
Location 1:36517170-36517192
Sequence CACAGCAGAATGGAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905231469_905231483 28 Left 905231469 1:36517170-36517192 CCTGACCACTCCATTCTGCTGTG No data
Right 905231483 1:36517221-36517243 GAGCAACCCTGGGAACCACATGG No data
905231469_905231482 18 Left 905231469 1:36517170-36517192 CCTGACCACTCCATTCTGCTGTG No data
Right 905231482 1:36517211-36517233 CAGAACGAGAGAGCAACCCTGGG No data
905231469_905231477 -9 Left 905231469 1:36517170-36517192 CCTGACCACTCCATTCTGCTGTG No data
Right 905231477 1:36517184-36517206 TCTGCTGTGGGTGCAGGGGACGG No data
905231469_905231478 -8 Left 905231469 1:36517170-36517192 CCTGACCACTCCATTCTGCTGTG No data
Right 905231478 1:36517185-36517207 CTGCTGTGGGTGCAGGGGACGGG No data
905231469_905231479 -7 Left 905231469 1:36517170-36517192 CCTGACCACTCCATTCTGCTGTG No data
Right 905231479 1:36517186-36517208 TGCTGTGGGTGCAGGGGACGGGG No data
905231469_905231481 17 Left 905231469 1:36517170-36517192 CCTGACCACTCCATTCTGCTGTG No data
Right 905231481 1:36517210-36517232 CCAGAACGAGAGAGCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905231469 Original CRISPR CACAGCAGAATGGAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr