ID: 905232357

View in Genome Browser
Species Human (GRCh38)
Location 1:36522142-36522164
Sequence CTGGAGACCCAGTCTGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905232357_905232365 4 Left 905232357 1:36522142-36522164 CCCCCCTCAGACTGGGTCTCCAG No data
Right 905232365 1:36522169-36522191 CAGAGTTCTGCCTTCCTCTCCGG No data
905232357_905232366 5 Left 905232357 1:36522142-36522164 CCCCCCTCAGACTGGGTCTCCAG No data
Right 905232366 1:36522170-36522192 AGAGTTCTGCCTTCCTCTCCGGG No data
905232357_905232371 20 Left 905232357 1:36522142-36522164 CCCCCCTCAGACTGGGTCTCCAG No data
Right 905232371 1:36522185-36522207 TCTCCGGGGCTCCCTTGAGTGGG No data
905232357_905232370 19 Left 905232357 1:36522142-36522164 CCCCCCTCAGACTGGGTCTCCAG No data
Right 905232370 1:36522184-36522206 CTCTCCGGGGCTCCCTTGAGTGG No data
905232357_905232367 6 Left 905232357 1:36522142-36522164 CCCCCCTCAGACTGGGTCTCCAG No data
Right 905232367 1:36522171-36522193 GAGTTCTGCCTTCCTCTCCGGGG No data
905232357_905232372 21 Left 905232357 1:36522142-36522164 CCCCCCTCAGACTGGGTCTCCAG No data
Right 905232372 1:36522186-36522208 CTCCGGGGCTCCCTTGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905232357 Original CRISPR CTGGAGACCCAGTCTGAGGG GGG (reversed) Intergenic
No off target data available for this crispr