ID: 905236877

View in Genome Browser
Species Human (GRCh38)
Location 1:36556090-36556112
Sequence CTGACTCCTTCCCATGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905236876_905236877 16 Left 905236876 1:36556051-36556073 CCTGTATCTACAGCACATTGGTG No data
Right 905236877 1:36556090-36556112 CTGACTCCTTCCCATGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905236877 Original CRISPR CTGACTCCTTCCCATGATGC TGG Intergenic
No off target data available for this crispr